The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	54089	67009	5278208		Escherichia_phage(87.5%)	8	NA	NA
VED06016.1|54089_55022_+	transporter protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
VED06018.1|55609_56128_-	putative outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	96.5	1.1e-82
VED06020.1|56187_61359_-	outer membrane autotransporter domain protein	NA	A0A2L1IV18	Escherichia_phage	89.2	0.0e+00
VED06022.1|61388_61856_-	outer membrane autotransporter domain-containing protein (fragment)	NA	A0A2L1IV38	Escherichia_phage	100.0	6.1e-59
VED06024.1|61926_64101_-	outer membrane autotransporter domain protein	NA	A0A2L1IV38	Escherichia_phage	93.5	2.2e-308
VED06026.1|64187_64745_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	89.2	1.4e-81
VED06028.1|65062_65692_-	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	99.0	4.1e-119
VED06030.1|66439_67009_+	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
>prophage 2
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	206345	211296	5278208		Escherichia_phage(83.33%)	10	NA	NA
VED06372.1|206345_206498_-	Uncharacterised protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
VED06374.1|206515_206707_+	protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
VED06376.1|207020_207374_+	putative lipoprotein	NA	G9L6F1	Escherichia_phage	98.6	7.4e-33
VED06378.1|207373_207535_+	putative lipoprotein	NA	G9L6F1	Escherichia_phage	98.1	2.7e-22
VED06380.1|207550_208090_+	Uncharacterised protein	NA	G9L6F0	Escherichia_phage	96.1	1.9e-40
VED06383.1|208184_209261_-	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
VED06385.1|209290_209623_-	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
VED06387.1|209931_210138_-	inosine 5'-monophosphate dehydrogenase	NA	NA	NA	NA	NA
VED06389.1|210358_210841_-	inosine 5'-monophosphate dehydrogenase	NA	NA	NA	NA	NA
VED06391.1|210861_211296_-	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.0	2.9e-23
>prophage 3
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	243872	250397	5278208		Mycoplasma_phage(14.29%)	11	NA	NA
VED06463.1|243872_245156_-	peptidase B (aminopeptidase B)	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
VED06465.1|245400_245601_-	FeS assembly protein IscX	NA	NA	NA	NA	NA
VED06467.1|245612_245948_-	ferredoxin	NA	NA	NA	NA	NA
VED06469.1|245949_246267_-	chaperone protein HscA	NA	NA	NA	NA	NA
VED06471.1|246259_246490_-	chaperone protein HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	46.2	6.3e-09
VED06473.1|246489_247197_-	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	44.8	3.8e-44
VED06474.1|247249_247801_-	chaperone protein HscA	NA	A0A2K9L0P4	Tupanvirus	34.5	4.4e-16
VED06476.1|247817_248333_-	co-chaperone HscB	NA	NA	NA	NA	NA
VED06478.1|248428_248752_-	iron-sulfur cluster assembly protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
VED06480.1|248768_249155_-	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
VED06482.1|249182_250397_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 4
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	462286	469632	5278208		uncultured_Mediterranean_phage(33.33%)	11	NA	NA
VED06834.1|462286_462955_+	serine/threonine-specific protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	48.1	1.4e-51
VED06835.1|462996_463233_-	4-hydroxybenzoate decarboxylase subunit D	NA	NA	NA	NA	NA
VED06837.1|463243_464236_-	4-hydroxybenzoate decarboxylase subunit C	NA	NA	NA	NA	NA
VED06839.1|464799_465000_-	4-hydroxybenzoate decarboxylase subunit B	NA	NA	NA	NA	NA
VED06841.1|465122_465251_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED06843.1|465917_466148_-	RNA polymerase sigma factor RpoS	NA	A0A1W6DY88	Aeromonas_phage	45.5	1.1e-05
VED06844.1|466144_466750_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.7	2.8e-24
VED06846.1|466695_466857_-	RNA polymerase sigma factor RpoS	NA	NA	NA	NA	NA
VED06848.1|466971_468111_-	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED06850.1|468250_468877_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VED06852.1|468870_469632_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 5
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	778037	813909	5278208	transposase	Bacillus_phage(37.5%)	35	NA	NA
VED07554.1|778037_778484_-|transposase	transposase for IS629	transposase	A0A0N7C1X7	Escherichia_phage	98.6	1.7e-79
VED07556.1|778600_780124_-	reverse transcriptase-like protein from prophage or plasmid	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
VED07558.1|781763_782195_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	100.0	5.4e-78
VED07560.1|782604_784077_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
VED07562.1|784077_784797_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	4.2e-35
VED07564.1|784937_785333_+	putative transmembrane hydrogenase cytochrome b-type subunit oxidoreductase protein	NA	NA	NA	NA	NA
VED07566.1|785442_786279_+	oxidoreductase	NA	NA	NA	NA	NA
VED07568.1|786333_786576_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
VED07570.1|787756_788269_+	hemolysin C	NA	NA	NA	NA	NA
VED07572.1|788280_789207_+	hemolysin A	NA	NA	NA	NA	NA
VED07574.1|789218_791354_+	hemolysin A	NA	NA	NA	NA	NA
VED07576.1|791424_793548_+	alpha-hemolysin translocation ATP-binding protein HlyB	NA	W8CYL7	Bacillus_phage	29.7	1.4e-46
VED07578.1|793566_795003_+	hemolysin D	NA	NA	NA	NA	NA
VED07580.1|795262_796132_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.0	2.4e-64
VED07582.1|796271_797423_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VED07584.1|797342_797693_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
VED07586.1|798008_798509_-	PapX protein	NA	NA	NA	NA	NA
VED07588.1|798822_799833_-	protein PapG	NA	NA	NA	NA	NA
VED07590.1|799876_800125_-	minor pilin subunit PapF	NA	NA	NA	NA	NA
VED07592.1|800606_800927_-	Fimbrial protein	NA	NA	NA	NA	NA
VED07594.1|801003_801540_-	PapK protein	NA	NA	NA	NA	NA
VED07596.1|801549_802131_-	protein PapJ	NA	NA	NA	NA	NA
VED07598.1|802167_802629_-	chaperone protein PapD	NA	NA	NA	NA	NA
VED07600.1|802616_802886_-	chaperone protein PapD	NA	NA	NA	NA	NA
VED07602.1|802973_805493_-	PapC protein	NA	NA	NA	NA	NA
VED07604.1|805546_806131_-	minor pilin protein PapH	NA	NA	NA	NA	NA
VED07606.1|806193_806745_-	major pilin subunit PapA	NA	NA	NA	NA	NA
VED07608.1|806951_807266_-	major pilu subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
VED07610.1|807727_807949_+	PapI protein	NA	NA	NA	NA	NA
VED07612.1|808291_808528_-	putative regulatory protein	NA	NA	NA	NA	NA
VED07614.1|808596_809172_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED07616.1|809429_809996_-	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VED07618.1|811422_812142_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VED07620.1|812698_813151_-	putative transferase	NA	NA	NA	NA	NA
VED07622.1|813558_813909_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 6
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	1603682	1614064	5278208	integrase	Enterobacteria_phage(100.0%)	14	1603497:1603522	1614538:1614563
1603497:1603522	attL	TTCGACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
VED09494.1|1603682_1604864_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	92.7	4.3e-210
VED09496.1|1604860_1604956_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED09498.1|1604999_1605995_+	putative prophage ATP/GTP binding protein	NA	NA	NA	NA	NA
VED09500.1|1606863_1607358_+	putative prophage protein	NA	NA	NA	NA	NA
VED09502.1|1607561_1608125_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
VED09504.1|1608148_1608394_-	putative prophage regulatory protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
VED09507.1|1608390_1608561_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.2	1.9e-23
VED09512.1|1608521_1609124_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	92.6	1.9e-97
VED09517.1|1609675_1609942_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VED09521.1|1610334_1610532_+	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
VED09523.1|1610524_1610812_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED09525.1|1610804_1611260_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
VED09527.1|1611395_1611716_+	P4 phage protein	NA	NA	NA	NA	NA
VED09529.1|1611730_1614064_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
1614538:1614563	attR	TTCGACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 7
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	2233636	2312828	5278208	protease,transposase,tRNA,integrase	Stx2-converting_phage(18.52%)	83	2260379:2260394	2303758:2303773
VED10790.1|2233636_2233834_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VED10792.1|2234226_2234433_+	polyketide synthase pksM (fragment)	NA	NA	NA	NA	NA
VED10794.1|2234386_2234812_+	non-ribosomal peptide synthase	NA	NA	NA	NA	NA
VED10796.1|2235628_2235937_-|transposase	transposase (fragment), IS630 family	transposase	NA	NA	NA	NA
VED10798.1|2236332_2236809_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10800.1|2236811_2238290_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10801.1|2238299_2238806_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10803.1|2238815_2239238_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10805.1|2239230_2239374_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10807.1|2239439_2241032_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10809.1|2241022_2241676_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10811.1|2241966_2243949_+	putative type VI secretion protein	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
VED10813.1|2243959_2244427_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10815.1|2244436_2244736_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10817.1|2244739_2245816_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10819.1|2245823_2246375_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10821.1|2246393_2247806_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10823.1|2247833_2248148_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10825.1|2248144_2248531_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10827.1|2248742_2249720_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10829.1|2249774_2252147_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10831.1|2252150_2252957_+	putative type VI secretion protein	NA	A0A2I7SAX5	Vibrio_phage	42.4	3.3e-20
VED10833.1|2253123_2253861_+	putative type VI secretion protein	NA	A0A223W0B1	Agrobacterium_phage	30.9	2.7e-08
VED10835.1|2255708_2256095_+|transposase	IS629, transposase orfB, truncation	transposase	Q6H9S6	Enterobacteria_phage	95.3	6.1e-65
VED10837.1|2256648_2256798_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10839.1|2256781_2256922_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED10841.1|2257057_2257288_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED10843.1|2257852_2258068_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED10845.1|2258896_2260051_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
2260379:2260394	attL	TGTTATTACTTTTTAT	NA	NA	NA	NA
VED10847.1|2261116_2261302_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	72.4	2.6e-21
VED10849.1|2261365_2262499_+|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VED10851.1|2262637_2262901_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.6	3.6e-24
VED10853.1|2263482_2264616_+|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VED10855.1|2264844_2265246_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.1	2.0e-34
VED10857.1|2265242_2265854_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	72.8	1.7e-61
VED10859.1|2266015_2266288_-|transposase	transposase	transposase	NA	NA	NA	NA
VED10861.1|2266318_2266669_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
VED10863.1|2266665_2267100_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
VED10865.1|2267351_2267639_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	4.2e-42
VED10867.1|2267701_2267920_+	IS encoded protein	NA	NA	NA	NA	NA
VED10869.1|2268059_2268944_-|protease	serine protease (autotransporter)	protease	Q9LA58	Enterobacterial_phage	79.7	8.4e-134
VED10871.1|2269230_2270112_-|protease	serine protease (autotransporter)	protease	NA	NA	NA	NA
VED10873.1|2270083_2272189_-|protease	serine protease (autotransporter)	protease	Q9LA58	Enterobacterial_phage	53.5	1.7e-145
VED10875.1|2272650_2272857_-|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	98.5	3.0e-34
VED10877.1|2272975_2274052_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VED10879.1|2274270_2274678_-|integrase	putative integrase	integrase	Q716C2	Shigella_phage	96.6	2.9e-65
VED10881.1|2274994_2276146_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VED10883.1|2276065_2276416_-|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
VED10885.1|2276485_2276779_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED10887.1|2276867_2277104_-	PstII restriction-modification enzyme Res subunit	NA	NA	NA	NA	NA
VED10889.1|2277100_2279737_-	PstII restriction-modification enzyme Res subunit	NA	NA	NA	NA	NA
VED10891.1|2279739_2281368_-	DNA methylase N-4/N-6	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
VED10895.1|2281377_2283765_-|protease	putative serine protease	protease	NA	NA	NA	NA
VED10897.1|2283774_2284755_-	ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
VED10899.1|2284780_2287630_-	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
VED10901.1|2288040_2288634_+	putative type VI secretion protein	NA	NA	NA	NA	NA
VED10903.1|2289099_2289363_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED10905.1|2289503_2289881_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	8.4e-67
VED10907.1|2289925_2290201_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.3e-45
VED10909.1|2290613_2291876_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
VED10911.1|2292255_2292831_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VED10913.1|2292867_2294565_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VED10915.1|2294540_2294879_-	divalent cation tolerance protein	NA	NA	NA	NA	NA
VED10917.1|2294993_2296295_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
VED10919.1|2296412_2297849_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
VED10921.1|2298185_2298662_+	protein FxsA (suppressor of F exclusion of phage T7)	NA	NA	NA	NA	NA
VED10923.1|2298677_2299934_-	inner membrane protein YjeH	NA	NA	NA	NA	NA
VED10925.1|2300209_2300503_+	10 kDa chaperonin (Protein Cpn10) (groES protein)	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
VED10927.1|2300546_2302193_+	chaperonin Cpn60	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
VED10929.1|2302330_2302684_+	putative lipoprotein	NA	NA	NA	NA	NA
VED10931.1|2302733_2303603_-	protein	NA	NA	NA	NA	NA
VED10933.1|2303837_2304866_-	radical SAM superfamily protein	NA	NA	NA	NA	NA
2303758:2303773	attR	ATAAAAAGTAATAACA	NA	NA	NA	NA
VED10934.1|2304907_2305474_+	elongation factor P (EF-P)	NA	NA	NA	NA	NA
VED10936.1|2305525_2305651_+	entericidin A	NA	NA	NA	NA	NA
VED10938.1|2305761_2305908_+	entericidin B	NA	NA	NA	NA	NA
VED10940.1|2306082_2306400_+	quaternary ammonium compound-resistance protein	NA	NA	NA	NA	NA
VED10942.1|2306396_2306930_-	outer membrane lipoprotein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
VED10944.1|2307092_2308184_-	beta-lactamase	NA	NA	NA	NA	NA
VED10946.1|2308213_2308573_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
VED10948.1|2308583_2308979_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
VED10950.1|2308989_2309724_-	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
VED10952.1|2309716_2311525_-	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
VED10954.1|2311850_2312828_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 8
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	2414242	2478627	5278208	holin,transposase,tRNA,integrase	Shigella_phage(26.67%)	77	2458297:2458356	2478638:2478719
VED11189.1|2414242_2417098_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
VED11191.1|2417097_2417541_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VED11193.1|2417700_2419212_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VED11195.1|2419478_2420579_+	putative permease	NA	NA	NA	NA	NA
VED11197.1|2420578_2421661_+	putative permease	NA	NA	NA	NA	NA
VED11199.1|2421821_2423264_-	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.8	4.5e-84
VED11201.1|2423217_2423325_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11203.1|2423454_2423904_-	oxidoreductase	NA	NA	NA	NA	NA
VED11205.1|2423918_2424473_-	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.1	3.8e-23
VED11207.1|2425028_2425763_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	41.7	7.9e-45
VED11209.1|2425720_2426155_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	44.7	5.9e-24
VED11211.1|2426475_2426643_+	putative ATP-binding protein	NA	NA	NA	NA	NA
VED11213.1|2426605_2427229_+	putative ATP-binding protein	NA	NA	NA	NA	NA
VED11215.1|2427364_2428861_+	putative ATP-binding protein	NA	NA	NA	NA	NA
VED11217.1|2428863_2429010_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED11219.1|2428990_2429494_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED11221.1|2429486_2429669_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED11223.1|2429974_2430712_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED11225.1|2430860_2431700_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.7	2.7e-25
VED11227.1|2431692_2432904_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11229.1|2432857_2433922_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11231.1|2434031_2435027_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11233.1|2435019_2435910_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11235.1|2436741_2437773_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
VED11237.1|2438043_2438487_+	PTS system EIIA component	NA	NA	NA	NA	NA
VED11239.1|2438502_2438790_+	PTS system transporter subunit IIB	NA	NA	NA	NA	NA
VED11241.1|2438803_2439409_+	PTS system EIIC component	NA	NA	NA	NA	NA
VED11243.1|2439431_2440061_+	PTS system EIIC component	NA	NA	NA	NA	NA
VED11245.1|2440306_2440561_-|transposase	putative transposase (partial)	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
VED11247.1|2440981_2441995_-	Deoxyribose specific mutarotase	NA	NA	NA	NA	NA
VED11249.1|2442007_2442367_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED11251.1|2442380_2443325_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED11253.1|2443455_2444271_-	Deoxyribokinase	NA	NA	NA	NA	NA
VED11255.1|2444576_2445359_+	transcriptional regulator	NA	NA	NA	NA	NA
VED11257.1|2446323_2446689_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED11259.1|2446646_2447621_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	9.4e-171
VED11261.1|2447635_2448061_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
VED11263.1|2448057_2448408_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
VED11265.1|2448438_2449134_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.9	8.5e-57
VED11267.1|2449178_2450051_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	58.2	2.5e-98
VED11269.1|2450579_2450684_+	putative alcohol dehydrogenase (partial)	NA	NA	NA	NA	NA
VED11271.1|2450741_2451116_-	HTH regulator, TetR family	NA	NA	NA	NA	NA
VED11273.1|2451287_2452310_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	7.8e-200
VED11275.1|2452309_2453089_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VED11277.1|2453139_2453358_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VED11279.1|2453511_2454882_-	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VED11283.1|2454841_2455000_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11285.1|2454944_2456609_-	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.0e-15
VED11287.1|2456749_2456941_-|holin	betaine-carnitine-choline transporter family member	holin	NA	NA	NA	NA
VED11289.1|2457094_2457913_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VED11291.1|2457948_2458233_-	IS600 ORF1-like protein	NA	NA	NA	NA	NA
2458297:2458356	attL	TTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAG	NA	NA	NA	NA
VED11293.1|2458412_2458922_-	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
VED11295.1|2459421_2460372_-	virulence protein	NA	NA	NA	NA	NA
VED11297.1|2460376_2461465_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
VED11299.1|2461467_2462289_-	putative polysaccharide deacetylase	NA	NA	NA	NA	NA
VED11301.1|2462495_2462798_+|transposase	transposase ORF A, IS911	transposase	Q716C1	Shigella_phage	96.5	1.2e-36
VED11303.1|2463039_2463174_+|integrase	putative integrase	integrase	Q716C2	Shigella_phage	97.4	3.1e-16
VED11305.1|2463188_2463452_+|transposase	transposase ORF B (fragment), IS911	transposase	Q716C2	Shigella_phage	93.8	4.4e-30
VED11307.1|2463448_2463691_+|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VED11309.1|2463773_2464031_+	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED11311.1|2464724_2465354_-	iron(III) dicitrate transport system, ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	5.8e-12
VED11313.1|2465354_2465987_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	4.2e-10
VED11315.1|2465986_2466310_-	Iron(III) dicitrate transport system permease protein fecD	NA	NA	NA	NA	NA
VED11317.1|2466306_2466699_-	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED11319.1|2466650_2467304_-	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED11321.1|2467300_2468203_-	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VED11323.1|2468247_2470572_-	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VED11325.1|2470658_2471612_-	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED11327.1|2471608_2472130_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VED11329.1|2472615_2472909_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VED11331.1|2472909_2473119_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VED11333.1|2473646_2473757_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11335.1|2473880_2474138_+	Biofilm development protein YmgB/AriR	NA	NA	NA	NA	NA
VED11338.1|2474870_2476229_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED11339.1|2476467_2477853_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
VED11341.1|2477902_2478250_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VED11343.1|2478246_2478627_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	1.3e-64
2478638:2478719	attR	TTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAGACGGTTCAGGCTGTACGCTTAC	NA	NA	NA	NA
>prophage 9
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	2489843	2501018	5278208	transposase	uncultured_Caudovirales_phage(33.33%)	18	NA	NA
VED11381.1|2489843_2490662_+	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
VED11383.1|2490661_2491477_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	2.6e-12
VED11385.1|2491492_2491969_+	putative DNA repair protein	NA	NA	NA	NA	NA
VED11387.1|2492031_2492253_+	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
VED11389.1|2492416_2492785_+	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VED11391.1|2492874_2493249_+	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VED11393.1|2493245_2493464_+	aec77	NA	NA	NA	NA	NA
VED11395.1|2493388_2494294_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	1.4e-171
VED11397.1|2494251_2494617_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED11399.1|2494680_2495073_+	aec77	NA	NA	NA	NA	NA
VED11401.1|2495089_2495266_+	Aec78	NA	NA	NA	NA	NA
VED11403.1|2495368_2495524_+	putative restriction methylase	NA	NA	NA	NA	NA
VED11405.1|2495753_2495912_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED11407.1|2496175_2497081_+	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	65.3	4.2e-104
VED11409.1|2497029_2498013_+	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	54.5	1.2e-96
VED11411.1|2497991_2499065_+	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.2	5.0e-72
VED11413.1|2499085_2499838_+	putative DNA modification methylase	NA	NA	NA	NA	NA
VED11415.1|2499842_2501018_+	putative DNA modification methylase	NA	Q1MVP0	Enterobacteria_phage	26.9	5.5e-08
>prophage 10
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	3105307	3150572	5278208	protease,transposase	Bacillus_phage(27.27%)	56	NA	NA
VED12715.1|3105307_3105931_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
VED12716.1|3106056_3107262_+|protease	ATP-dependent specificity component of ClpP serine protease	protease	G3M9Z9	Bacillus_virus	57.7	1.4e-128
VED12717.1|3107517_3107880_+|protease	DNA-binding ATP-dependent protease La	protease	NA	NA	NA	NA
VED12718.1|3108064_3108343_+|protease	DNA-binding ATP-dependent protease La	protease	NA	NA	NA	NA
VED12719.1|3108644_3109862_+|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	63.4	1.5e-144
VED12720.1|3110069_3110342_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
VED12721.1|3110533_3110809_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VED12722.1|3111051_3111525_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VED12723.1|3111476_3112124_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VED12724.1|3112201_3112399_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VED12725.1|3112549_3112921_+	putative DNA uptake protein	NA	NA	NA	NA	NA
VED12726.1|3113014_3113260_+	thioesterase protein YbaW	NA	NA	NA	NA	NA
VED12727.1|3113627_3114161_-	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	72.8	3.6e-71
VED12728.1|3114225_3114666_-	bacterial extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VED12729.1|3114724_3115927_-	bacterial extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VED12730.1|3116026_3116845_+	putative hydrolase	NA	NA	NA	NA	NA
VED12731.1|3116997_3117456_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VED12732.1|3117485_3117785_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
VED12733.1|3118186_3118813_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.3	7.7e-17
VED12734.1|3118899_3119058_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
VED12735.1|3119111_3121031_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.5e-42
VED12736.1|3121211_3121550_+	glutamine synthetase	NA	NA	NA	NA	NA
VED12737.1|3121579_3122866_+	ammonia channel precursor (ammonia transporter)	NA	NA	NA	NA	NA
VED12738.1|3122914_3123775_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VED12739.1|3124033_3124567_+	putative lipoprotein	NA	NA	NA	NA	NA
VED12740.1|3124597_3124909_-	methylated DNA-protein cysteine alkyltransferase	NA	NA	NA	NA	NA
VED12741.1|3125349_3125640_+	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
VED12742.1|3125681_3126803_-	putative signal transduction protein	NA	NA	NA	NA	NA
VED12743.1|3127392_3127707_-	inner membrane protein	NA	NA	NA	NA	NA
VED12744.1|3128328_3128511_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VED12745.1|3128924_3129299_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED12746.1|3129844_3130138_-	acriflavin resistance protein B	NA	NA	NA	NA	NA
VED12747.1|3130130_3130412_-	acriflavin resistance protein B	NA	NA	NA	NA	NA
VED12748.1|3130422_3130812_-	acriflavin resistance protein B	NA	NA	NA	NA	NA
VED12749.1|3130756_3131020_-	acriflavin resistance protein B	NA	NA	NA	NA	NA
VED12750.1|3131079_3132999_-	acriflavin resistance protein B	NA	S5VTK5	Leptospira_phage	27.5	3.8e-38
VED12751.1|3133021_3133171_-	acriflavin resistance protein A	NA	NA	NA	NA	NA
VED12752.1|3133167_3134118_-	acriflavin resistance protein A	NA	NA	NA	NA	NA
VED12753.1|3134071_3134215_-	acriflavin resistance protein A	NA	NA	NA	NA	NA
VED12754.1|3134356_3135088_+	acrAB operon repressor	NA	NA	NA	NA	NA
VED12755.1|3135130_3135457_+	potassium efflux protein	NA	NA	NA	NA	NA
VED12756.1|3135432_3136224_+	potassium efflux protein	NA	NA	NA	NA	NA
VED12757.1|3136220_3136532_+	potassium efflux protein	NA	NA	NA	NA	NA
VED12758.1|3136473_3138492_+	potassium efflux protein	NA	NA	NA	NA	NA
VED12759.1|3138703_3138865_-	small protein involved in the cell envelope stress response	NA	NA	NA	NA	NA
VED12760.1|3138878_3139406_-	primosomal replication protein N	NA	NA	NA	NA	NA
VED12761.1|3139475_3139832_+	inner membrane protein	NA	NA	NA	NA	NA
VED12762.1|3140006_3140558_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
VED12763.1|3142670_3143000_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED12764.1|3142999_3143605_+	recombination and repair protein RecR	NA	NA	NA	NA	NA
VED12765.1|3143714_3145589_+	chaperone (heat shock protein)	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	3.0e-117
VED12766.1|3145769_3146414_+	adenylate kinase	NA	NA	NA	NA	NA
VED12767.1|3146545_3147508_+	ferrochelatase	NA	NA	NA	NA	NA
VED12768.1|3147504_3148464_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	8.5e-15
VED12769.1|3148615_3149920_+	inosine-guanosine kinase	NA	NA	NA	NA	NA
VED12770.1|3150050_3150572_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	3460798	3501193	5278208	protease,portal,integrase,plate,tail,holin,lysis,capsid,terminase,head	Enterobacteria_phage(41.27%)	65	3455412:3455427	3499572:3499587
3455412:3455427	attL	ATACAGAAAGAACAGG	NA	NA	NA	NA
VED13099.1|3460798_3461869_-|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	4.3e-201
VED13100.1|3462170_3462515_-	prophage protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
VED13101.1|3462615_3462795_-	prophage protein	NA	Q9AZ37	Salmonella_phage	100.0	3.3e-29
VED13102.1|3462891_3463596_-	prophage protein	NA	S5MC19	Escherichia_phage	81.2	9.1e-107
VED13103.1|3463791_3464418_-	prophage protein	NA	Q6H9Z5	Enterobacteria_phage	62.3	1.6e-70
VED13104.1|3464414_3464582_-	prophage protein	NA	Q716F2	Shigella_phage	96.4	3.6e-22
VED13105.1|3464924_3465407_-	prophage protein	NA	K7P6T5	Enterobacteria_phage	97.5	1.3e-77
VED13106.1|3465390_3466302_-	Putative phage-related DNA recombination protein	NA	K7PKG9	Enterobacteria_phage	99.3	1.3e-169
VED13107.1|3466298_3466607_-	prophage protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
VED13108.1|3466587_3466695_-	Uncharacterised protein	NA	A0A192Y6P5	Salmonella_phage	78.1	4.4e-05
VED13109.1|3466691_3466844_-	putative host killing protein	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
VED13110.1|3466828_3466963_-	prophage regulatory protein cIII	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
VED13111.1|3467157_3467628_-	prophage protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
VED13112.1|3467636_3467963_-	prophage protein	NA	A4KWR0	Enterobacteria_phage	99.1	4.5e-53
VED13113.1|3468266_3468671_-	prophage protein	NA	Q716D7	Shigella_phage	97.8	1.3e-68
VED13114.1|3468667_3469300_-	putative prophage repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
VED13115.1|3469403_3469619_+	regulatory protein cro (antirepressor)	NA	Q716D6	Shigella_phage	98.6	4.2e-31
VED13116.1|3469738_3470017_+	transcriptional activator protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
VED13117.1|3470051_3470213_+	prophage protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
VED13118.1|3470199_3471021_+	phage replication Protein	NA	K7PJZ3	Enterobacterial_phage	98.9	2.8e-152
VED13119.1|3471017_3472394_+	phage replicative DNA Helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
VED13120.1|3472390_3472660_+	prophage protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
VED13121.1|3472656_3472755_+	bacteriophage HK97 gp56	NA	Q9MCP6	Enterobacteria_phage	100.0	7.5e-12
VED13122.1|3472741_3472954_+	prophage protein	NA	A0A1V0E5J7	Salmonella_phage	100.0	2.8e-35
VED13123.1|3472934_3473375_+	recombination protein ninB from phage origin	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
VED13124.1|3473371_3474217_+	prophage protein	NA	I6R0S6	Salmonella_phage	57.0	2.4e-90
VED13125.1|3474392_3474563_+	phage protein	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
VED13126.1|3474555_3475065_+	putative phage endonuclease	NA	U5PWK7	Bacillus_phage	40.4	2.4e-24
VED13127.1|3475057_3475333_+	prophage protein	NA	F1C5C8	Cronobacter_phage	76.9	1.5e-36
VED13128.1|3475329_3475692_+	prophage holliday junction resolvase	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
VED13129.1|3475688_3475877_+	prophage protein	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
VED13130.1|3475873_3476362_+	phage antiterminator Q protein	NA	M1FPN0	Enterobacteria_phage	98.8	4.5e-89
VED13131.1|3476987_3477311_+|holin	holin	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
VED13132.1|3477294_3477771_+	phage endolysin	NA	K7PKV2	Enterobacteria_phage	99.4	2.9e-88
VED13133.1|3477767_3478205_+|lysis	bacteriophage lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.2	1.6e-69
VED13134.1|3478240_3478516_+	Uncharacterised protein	NA	K7P6G5	Enterobacteria_phage	96.7	3.3e-44
VED13135.1|3478634_3478886_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED13136.1|3479098_3479449_+	putative phage endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	2.3e-63
VED13137.1|3479574_3480069_+|terminase	phage terminase small subunit	terminase	U5P067	Shigella_phage	98.8	1.1e-87
VED13138.1|3480065_3481799_+|terminase	phage terminase, large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
VED13139.1|3481810_3481993_+	prophage protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
VED13140.1|3481992_3483234_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
VED13141.1|3483211_3483862_+|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
VED13142.1|3483876_3485082_+|capsid	major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.7e-223
VED13143.1|3485131_3485332_+	phage protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
VED13144.1|3485334_3485658_+	phage protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
VED13145.1|3485654_3486065_+	prophage protein	NA	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
VED13146.1|3486039_3486546_+	prophage protein	NA	Q8SBH5	Shigella_phage	91.7	9.5e-82
VED13147.1|3486542_3487103_+	phage protein	NA	Q8SBH4	Shigella_phage	98.9	8.8e-105
VED13148.1|3487111_3487282_+	phage protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
VED13149.1|3487265_3488762_+|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.6	4.1e-274
VED13150.1|3488761_3489118_+	phage protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
VED13151.1|3489117_3489387_+	phage protein	NA	S5FNR3	Shigella_phage	100.0	3.5e-43
VED13152.1|3489528_3491361_+|tail	bacteriophage V tail protein	tail	M1FQW0	Enterobacteria_phage	98.4	3.3e-302
VED13153.1|3491807_3493133_+	Tail/DNA circulation protein	NA	Q8SBG8	Shigella_phage	98.9	3.5e-245
VED13154.1|3493132_3494212_+|tail	putative phage tail protein	tail	U5P0H6	Shigella_phage	99.7	6.9e-207
VED13155.1|3494211_3494760_+|plate	putative phage baseplate protein	plate	Q8SBG6	Shigella_phage	98.9	2.5e-96
VED13156.1|3494759_3495185_+|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	99.3	8.8e-81
VED13157.1|3495171_3496230_+|plate	putative phage baseplate protein	plate	Q8SBG4	Shigella_phage	99.1	1.2e-200
VED13158.1|3496220_3496805_+|tail	putative phage tail protein	tail	O22003	Shigella_phage	99.5	5.4e-113
VED13159.1|3496808_3497741_+|tail	putative phage tail protein	tail	U5P0I1	Shigella_phage	95.2	2.1e-50
VED13160.1|3497741_3498146_+|tail	putative phage tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	5.0e-17
VED13161.1|3498444_3499920_-	Uncharacterised protein	NA	NA	NA	NA	NA
3499572:3499587	attR	ATACAGAAAGAACAGG	NA	NA	NA	NA
VED13162.1|3499916_3500834_-	bactoprenol glucosyl transferase; CPS-53 (KpLE1) prophage	NA	I1TED8	Salmonella_phage	89.1	2.8e-156
VED13163.1|3500830_3501193_-	prophage-encoded bactoprenol-linked glucose translocase	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
>prophage 12
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	3619557	3628581	5278208	protease,tRNA	Planktothrix_phage(14.29%)	11	NA	NA
VED13297.1|3619557_3621504_+	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
VED13298.1|3621576_3621801_-	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VED13299.1|3622123_3622444_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VED13300.1|3622474_3623047_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
VED13301.1|3623015_3623276_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	63.4	6.0e-24
VED13302.1|3623259_3623706_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	52.9	2.8e-37
VED13303.1|3623705_3623819_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	NA	NA	NA	NA
VED13304.1|3623842_3624748_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	49.1	2.4e-75
VED13305.1|3625711_3625828_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
VED13306.1|3626077_3626818_-|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VED13307.1|3626859_3628581_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
>prophage 13
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	3980204	4029644	5278208	integrase,tail,lysis,capsid,terminase,head	Escherichia_phage(49.21%)	75	3973042:3973056	4003473:4003487
3973042:3973056	attL	CCCAGCAGCCAGCAG	NA	NA	NA	NA
VED13682.1|3980204_3981410_-|integrase	integrase for prophage CP-933O	integrase	O21940	Phage_21	51.4	6.1e-103
VED13683.1|3981387_3981636_-	phage excisionase	NA	NA	NA	NA	NA
VED13684.1|3981700_3984172_-	exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.0	8.0e-57
VED13685.1|3984251_3984455_-	phage protein	NA	NA	NA	NA	NA
VED13686.1|3984451_3984640_-	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VED13687.1|3986077_3986356_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED13688.1|3986315_3986717_-	Uncharacterised protein	NA	I6PDF6	Cronobacter_phage	78.9	6.5e-09
VED13689.1|3986739_3986958_-	putative prophage protein	NA	NA	NA	NA	NA
VED13690.1|3986987_3987158_-	putative prophage protein	NA	NA	NA	NA	NA
VED13691.1|3987117_3987273_-	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
VED13692.1|3987526_3987988_-	putative regulator of the C1 family from prophage	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
VED13693.1|3988095_3988371_+	putative phage regulatory protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
VED13694.1|3988354_3988780_+	phage regulatory protein	NA	NA	NA	NA	NA
VED13695.1|3988851_3989892_+	putative phage replication protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
VED13696.1|3989923_3990346_+	putative phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
VED13697.1|3990379_3991150_+	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
VED13698.1|3991165_3991558_+	putative phage regulatory protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
VED13699.1|3991554_3991851_+	phage protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
VED13700.1|3991847_3992309_+	phage protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
VED13701.1|3992286_3992643_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
VED13702.1|3992738_3992921_+	putative prophage protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
VED13703.1|3992913_3993090_+	putative prophage protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
VED13704.1|3993086_3993446_+	putative prophage protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
VED13705.1|3993446_3993662_+	prophage protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
VED13706.1|3993663_3993882_+	phage protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
VED13707.1|3993883_3994147_+	phage protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
VED13708.1|3994157_3994325_+	Eaa protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
VED13709.1|3994321_3994666_+	prophage protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
VED13710.1|3995278_3995929_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED13711.1|3995909_3996527_+	putative phage DNA-binding protein	NA	NA	NA	NA	NA
VED13712.1|3996492_3997014_+	putative phage DNA-binding protein	NA	NA	NA	NA	NA
VED13713.1|3997124_3997346_+	putative prophage protein	NA	A0A0U2I1S4	Escherichia_phage	63.8	6.7e-16
VED13714.1|3997405_3997678_+	putative prophage protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
VED13715.1|3997679_3998726_+	putative prophage protein	NA	U5P0K4	Shigella_phage	54.8	8.5e-109
VED13716.1|3998738_3999113_+	Holliday juction resolvase	NA	V5URS4	Shigella_phage	62.7	1.1e-34
VED13717.1|3999109_3999931_+	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
VED13718.1|4000157_4000355_+	lipoprotein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
VED13719.1|4000505_4001555_+	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
VED13720.1|4002145_4002481_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
VED13721.1|4002741_4003521_+	phage protein YjhS encoded within prophage CP-933O	NA	H6WZJ9	Escherichia_phage	92.9	3.4e-123
4003473:4003487	attR	CCCAGCAGCCAGCAG	NA	NA	NA	NA
VED13722.1|4003694_4004597_+	phage protein	NA	Q08JA2	Stx2-converting_phage	96.9	2.4e-136
VED13723.1|4004747_4004963_+|lysis	putative lysis protein S	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
VED13724.1|4004967_4005318_+	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
VED13725.1|4005381_4005915_+	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	98.9	2.7e-103
VED13726.1|4006071_4006254_+	putative transmembrane protein	NA	NA	NA	NA	NA
VED13727.1|4006268_4006400_+	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
VED13728.1|4006411_4006870_+	endopeptidase of prophage CP-933N	NA	Q6H9V3	Enterobacteria_phage	86.1	3.1e-63
VED13729.1|4007304_4007469_+	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	72.5	5.9e-09
VED13730.1|4007471_4007765_+	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	91.5	1.3e-27
VED13731.1|4007824_4008043_+	Terminase large subunit (Gp2)	NA	O64317	Escherichia_phage	59.4	3.0e-16
VED13732.1|4008521_4009751_+|terminase	terminase large subunit (Gp2)	terminase	A0A0K2FJ14	Enterobacteria_phage	64.5	4.7e-159
VED13733.1|4009734_4009941_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VED13734.1|4009937_4011530_+|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
VED13735.1|4011519_4011768_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	E4WL22	Enterobacteria_phage	50.0	3.6e-10
VED13736.1|4011764_4013024_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	48.0	6.5e-63
VED13737.1|4013060_4013408_+|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
VED13738.1|4013465_4014494_+|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	61.9	4.3e-113
VED13739.1|4014545_4014929_+	phage protein	NA	NA	NA	NA	NA
VED13740.1|4014921_4015275_+|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
VED13741.1|4015289_4015865_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
VED13742.1|4015861_4016257_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
VED13743.1|4016264_4017017_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
VED13744.1|4017030_4017462_+|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
VED13745.1|4017488_4017902_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VED13746.1|4017882_4018026_+|tail	tail component of prophage	tail	A0A2R9YJM8	Escherichia_phage	63.8	3.2e-11
VED13747.1|4018207_4018624_+|tail	tail component of prophage CP-933X	tail	A0A0K2FI43	Enterobacteria_phage	95.6	1.3e-60
VED13748.1|4018620_4018932_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	3.8e-41
VED13749.1|4019040_4020480_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.0	2.6e-225
VED13750.1|4020476_4020806_+|tail	minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
VED13751.1|4020805_4021504_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
VED13752.1|4021508_4022252_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.4	1.6e-146
VED13753.1|4022248_4022821_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
VED13754.1|4022881_4026361_+	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
VED13755.1|4026428_4027028_+	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.5	1.0e-106
VED13756.1|4027178_4029644_+|tail	putative prophage side tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	1.9e-130
>prophage 14
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	4083242	4119796	5278208	portal,plate,tail,holin,capsid,terminase	Enterobacteria_phage(77.78%)	62	NA	NA
VED13820.1|4083242_4083383_-	small toxic polypeptide	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
VED13821.1|4083574_4083835_-	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VED13822.1|4083877_4084987_-	Gene late control D protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	2.8e-203
VED13823.1|4085144_4086329_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	97.7	8.4e-222
VED13824.1|4086328_4086841_+|tail	Major tail tube protein FII	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
VED13825.1|4086895_4087261_+|tail	phage tail E family protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
VED13826.1|4087411_4088086_+|tail	tail fiber component of prophage CP-933T	tail	A0A0A7NRZ9	Enterobacteria_phage	98.5	1.0e-78
VED13827.1|4088033_4088270_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	96.8	1.9e-24
VED13828.1|4088224_4088809_+|tail	tail fiber component of prophage CP-933T	tail	A0A0A7NRZ9	Enterobacteria_phage	74.7	7.4e-70
VED13829.1|4088852_4089311_+|tail	tail fiber component of prophage CP-933T	tail	A0A0A7NRZ9	Enterobacteria_phage	89.9	3.9e-66
VED13830.1|4089298_4090231_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	94.1	9.1e-155
VED13831.1|4090227_4090716_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	4.7e-86
VED13832.1|4090742_4091342_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
VED13833.1|4091896_4092277_-|tail	tail fibre assembly protein	tail	U5P0S4	Shigella_phage	80.9	4.2e-42
VED13834.1|4092215_4092509_-|tail	tail fibre assembly protein	tail	M1SV83	Escherichia_phage	75.6	1.4e-32
VED13835.1|4092508_4093375_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	49.0	1.6e-57
VED13836.1|4093374_4094103_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	98.1	1.4e-81
VED13837.1|4094099_4094708_-	Tail protein I	NA	A0A0F7LA36	Escherichia_phage	74.9	2.6e-86
VED13838.1|4094700_4095597_-|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
VED13839.1|4095600_4095951_-|plate	Baseplate assembly protein W	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
VED13840.1|4095947_4096529_-|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
VED13841.1|4096525_4097170_-|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	99.5	5.4e-114
VED13842.1|4097153_4097621_-|tail	Phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	96.8	7.2e-84
VED13843.1|4097644_4098412_-	phage protein	NA	Q08JA2	Stx2-converting_phage	89.2	1.7e-122
VED13844.1|4098363_4098804_-	YjhS	NA	H6WZJ9	Escherichia_phage	82.5	3.5e-64
VED13845.1|4098866_4099523_-	phage protein YjhS encoded within prophage CP-933O	NA	B6DZ89	Enterobacteria_phage	66.5	6.8e-56
VED13846.1|4099691_4100003_-	Uncharacterised protein	NA	A0A0A7NPY2	Enterobacteria_phage	65.2	1.6e-10
VED13847.1|4100058_4100205_-	putative phage PS3	NA	A0A0A7NQ86	Enterobacteria_phage	97.9	1.1e-22
VED13848.1|4100446_4100770_-|holin	putative phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	86.9	8.0e-42
VED13849.1|4100772_4100970_-	Tail protein X (GpX)	NA	A0A0A7NV57	Enterobacteria_phage	60.6	6.4e-10
VED13850.1|4101025_4101445_-	Head completion/stabilization protein L	NA	A0A0A7NPU2	Enterobacteria_phage	73.1	1.9e-35
VED13851.1|4101565_4101871_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	69.3	1.1e-27
VED13852.1|4101957_4102101_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	100.0	1.3e-20
VED13853.1|4102135_4102363_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	100.0	1.4e-29
VED13854.1|4102408_4103281_-|capsid	Major capsid protein precursor (GpN)	capsid	A0A0A7NQ82	Enterobacteria_phage	93.4	1.7e-155
VED13855.1|4103277_4104312_-	Capsid scaffolding protein O	NA	A0A0A7NRY7	Enterobacteria_phage	96.0	1.4e-127
VED13856.1|4104473_4106225_+	Terminase, ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
VED13857.1|4106224_4106620_+|capsid,portal	portal capsid protein Q (GpQ)	capsid,portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.1e-69
VED13858.1|4106751_4107270_+|capsid,portal	portal capsid protein Q (GpQ)	capsid,portal	A0A0A7NPT9	Enterobacteria_phage	98.8	1.1e-93
VED13859.1|4107960_4109103_-	Predicted ATP-binding protein involved in virulence	NA	NA	NA	NA	NA
VED13860.1|4109152_4109656_-	Predicted ATP-binding protein involved in virulence	NA	NA	NA	NA	NA
VED13861.1|4109673_4110519_-	putative adenine-specific DNA methyltransferase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	2.8e-09
VED13862.1|4110704_4112744_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
VED13863.1|4112821_4113529_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	93.5	8.3e-100
VED13864.1|4113535_4113901_-	Uncharacterised protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
VED13865.1|4113973_4114204_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
VED13866.1|4114526_4114826_-	Uncharacterised protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
VED13867.1|4114822_4115089_-	Uncharacterized protein conserved in archaea	NA	A0A0A7NV47	Enterobacteria_phage	77.0	1.2e-30
VED13868.1|4115085_4115289_-	Uncharacterised protein	NA	A0A0A7NPS8	Enterobacteria_phage	79.1	7.2e-25
VED13869.1|4115311_4115518_-	Prophage protein	NA	NA	NA	NA	NA
VED13870.1|4115514_4115727_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED13871.1|4115818_4115932_-	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
VED13872.1|4115928_4116171_-	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
VED13873.1|4116182_4116449_-	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.0	1.7e-18
VED13874.1|4116472_4116823_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
VED13875.1|4116819_4117047_-	phage regulator DNA-binding protein)	NA	P79674	Haemophilus_phage	45.0	1.0e-06
VED13876.1|4117063_4117270_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED13877.1|4117410_4117656_+	regulator	NA	Q6QID2	Burkholderia_phage	55.6	1.7e-12
VED13878.1|4117766_4118378_+	putative transmembrane protein	NA	NA	NA	NA	NA
VED13879.1|4118442_4118790_+	Protein of uncharacterised function (DUF2511)	NA	NA	NA	NA	NA
VED13880.1|4118795_4119659_+	Integrase	NA	P79671	Haemophilus_phage	55.5	2.3e-83
VED13881.1|4119655_4119796_+	Integrase	NA	A0A218M4I3	Erwinia_phage	82.9	4.4e-13
>prophage 15
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	4148456	4199120	5278208	protease,tail,transposase,tRNA	Escherichia_coli_phage(13.33%)	58	NA	NA
VED13917.1|4148456_4150190_-|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
VED13918.1|4150405_4150972_+	Protein yecM	NA	NA	NA	NA	NA
VED13919.1|4150985_4151732_+	copper homeostasis protein	NA	NA	NA	NA	NA
VED13920.1|4152117_4153218_+	cytochrome C-type protein	NA	NA	NA	NA	NA
VED13921.1|4153242_4155672_+	trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
VED13922.1|4155706_4156678_-	putative methyltransferase	NA	NA	NA	NA	NA
VED13923.1|4156674_4157418_-	protein YecO	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
VED13924.1|4157458_4157854_-	inner membrane protein	NA	NA	NA	NA	NA
VED13925.1|4157906_4158341_-	conserved protein, UPF0759 family	NA	Q859D1	Escherichia_coli_phage	96.8	2.4e-09
VED13926.1|4158348_4158726_-	conserved protein, UPF0759 family	NA	Q859D1	Escherichia_coli_phage	94.1	6.5e-43
VED13927.1|4158722_4159079_-	putative isochorismatase	NA	NA	NA	NA	NA
VED13928.1|4159599_4161075_+|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED13929.1|4161214_4161370_+|tRNA	aspartyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED13930.1|4161971_4162109_+	YebC/PmpR family DNA-binding regulatory protein	NA	NA	NA	NA	NA
VED13931.1|4162089_4162452_+	YebC/PmpR family DNA-binding regulatory protein	NA	NA	NA	NA	NA
VED13932.1|4162749_4163271_+	Holliday junction resolvase	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
VED13933.1|4164152_4164527_+	holliday junction ATP-dependent DNA helicase	NA	NA	NA	NA	NA
VED13934.1|4164535_4164766_+	holliday junction ATP-dependent DNA helicase	NA	NA	NA	NA	NA
VED13935.1|4164774_4165785_+	holliday junction ATP-dependent DNA helicase	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
VED13936.1|4165936_4166722_-	high-affinity zinc uptake system membrane protein	NA	NA	NA	NA	NA
VED13937.1|4166728_4167475_-	high-affinity zinc transporter ATPase	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
VED13938.1|4167499_4168486_+	high-affinity zinc transporter periplasmic protein	NA	NA	NA	NA	NA
VED13939.1|4168501_4169824_+	putative peptidoglycan-binding peptidase	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
VED13940.1|4169942_4170914_+	Lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
VED13941.1|4171044_4171389_-	pyruvate kinase	NA	NA	NA	NA	NA
VED13942.1|4171358_4172486_-	pyruvate kinase	NA	NA	NA	NA	NA
VED13943.1|4172613_4173483_-	putative hex-regulon repressor (RpiR-family transcriptional regulator)	NA	NA	NA	NA	NA
VED13944.1|4173505_4173655_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED13945.1|4173820_4175296_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
VED13946.1|4175530_4177342_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
VED13947.1|4177378_4178020_+	KHG/KDPG aldolase [includes: 4-hydroxy-2-oxoglutarate aldolase; 2 dehydro-3-deoxy-phosphogluconate aldolase]	NA	NA	NA	NA	NA
VED13948.1|4178074_4179253_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
VED13949.1|4179386_4179677_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
VED13950.1|4179743_4180100_+	putative lipoprotein	NA	NA	NA	NA	NA
VED13951.1|4180256_4180367_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED13952.1|4180426_4180654_+	inner membrane protein	NA	NA	NA	NA	NA
VED13953.1|4180740_4181088_+	inner membrane protein	NA	NA	NA	NA	NA
VED13954.1|4182171_4182417_-|transposase	putative transposase	transposase	A0A077SLN2	Escherichia_phage	98.3	1.8e-25
VED13955.1|4182483_4182903_+|transposase	putative transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.0	3.6e-10
VED13956.1|4183054_4183195_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED13957.1|4183434_4183761_+|protease	protease II	protease	NA	NA	NA	NA
VED13958.1|4183814_4184132_+|protease	protease II	protease	NA	NA	NA	NA
VED13959.1|4184190_4185108_+|protease	protease II	protease	NA	NA	NA	NA
VED13960.1|4185104_4185767_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
VED13961.1|4185790_4186447_-	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VED13962.1|4186548_4186779_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
VED13963.1|4186917_4187292_+	putative copper resistance protein	NA	NA	NA	NA	NA
VED13964.1|4187295_4188168_+	putative copper resistance protein	NA	NA	NA	NA	NA
VED13965.1|4188180_4188522_+	protein	NA	NA	NA	NA	NA
VED13966.1|4188918_4189575_+	serine/threonine protein phosphatase 1	NA	A0A2D1GLI5	Escherichia_phage	48.6	2.2e-54
VED13967.1|4189575_4189851_-	protein	NA	NA	NA	NA	NA
VED13968.1|4189871_4190108_-	protein	NA	NA	NA	NA	NA
VED13969.1|4190225_4191671_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
VED13970.1|4191744_4194378_-	mce-like protein	NA	NA	NA	NA	NA
VED13971.1|4194346_4195630_-	inner membrane protein	NA	NA	NA	NA	NA
VED13972.1|4195705_4196257_+	putative signal transduction protein	NA	NA	NA	NA	NA
VED13973.1|4196353_4197052_+	ProP effector protein	NA	NA	NA	NA	NA
VED13974.1|4197071_4199120_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 16
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	4441593	4506610	5278208	terminase,portal,integrase,tail,transposase,lysis,coat,capsid,protease,head	Enterobacteria_phage(38.3%)	78	4467714:4467729	4481370:4481385
VED14255.1|4441593_4442415_-|protease	putative protease	protease	NA	NA	NA	NA
VED14256.1|4442690_4442999_-	acid shock protein	NA	NA	NA	NA	NA
VED14257.1|4443422_4444676_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED14258.1|4444782_4445676_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED14259.1|4445810_4446668_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED14260.1|4446664_4446844_+	transcriptional regulator	NA	NA	NA	NA	NA
VED14261.1|4447394_4447841_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED14262.1|4447876_4448002_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED14263.1|4447998_4448583_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED14264.1|4448537_4449047_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED14265.1|4449240_4449855_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
VED14266.1|4449897_4450752_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED14267.1|4450753_4451371_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.6e-75
VED14268.1|4451381_4451828_-	oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	58.3	1.8e-36
VED14269.1|4451784_4453779_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	47.6	3.5e-164
VED14270.1|4453866_4456293_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
VED14271.1|4456491_4456797_-	protein	NA	NA	NA	NA	NA
VED14272.1|4456868_4457615_+	lipoprotein	NA	NA	NA	NA	NA
VED14273.1|4457617_4458178_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED14274.1|4458212_4458554_-	protein	NA	NA	NA	NA	NA
VED14275.1|4458688_4459015_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
VED14276.1|4459220_4460435_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VED14277.1|4460446_4461466_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
VED14278.1|4461653_4462934_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VED14279.1|4462968_4463205_-	putative phage excisionase	NA	S4TND0	Salmonella_phage	49.3	2.3e-14
VED14280.1|4463292_4465764_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.1	4.2e-58
VED14281.1|4465856_4466048_-	putative prophage protein	NA	NA	NA	NA	NA
VED14282.1|4466044_4466233_-	division inhibition protein	NA	NA	NA	NA	NA
VED14283.1|4466632_4466797_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED14284.1|4466800_4467019_-	putative prophage protein	NA	NA	NA	NA	NA
VED14285.1|4467048_4467219_-	putative prophage protein	NA	NA	NA	NA	NA
VED14286.1|4467178_4467334_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
4467714:4467729	attL	CATGTTGGTGAGCATT	NA	NA	NA	NA
VED14287.1|4467990_4468221_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VED14288.1|4468204_4468726_+	YdfX	NA	NA	NA	NA	NA
VED14289.1|4468706_4469672_+	ybl78	NA	U5P0A0	Shigella_phage	60.6	2.2e-55
VED14290.1|4469712_4470135_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VED14291.1|4470131_4470488_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED14292.1|4471098_4471209_+	putative prophage protein	NA	NA	NA	NA	NA
VED14293.1|4471639_4471819_+	membrane protein	NA	NA	NA	NA	NA
VED14294.1|4472153_4473467_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED14295.1|4473903_4474095_-	Qin prophage protein	NA	NA	NA	NA	NA
VED14296.1|4474101_4474236_-	Qin prophage protein	NA	NA	NA	NA	NA
VED14297.1|4474768_4475008_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VED14298.1|4475007_4475295_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED14299.1|4475366_4475522_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED14300.1|4475738_4475990_+	putative prophage protein	NA	NA	NA	NA	NA
VED14301.1|4476336_4477386_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED14302.1|4477399_4478152_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VED14303.1|4478573_4478786_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED14304.1|4480064_4480271_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VED14305.1|4480275_4480506_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	81.9	2.0e-26
VED14306.1|4480849_4481110_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	97.7	1.3e-47
VED14307.1|4481199_4481505_+	putative prophage protein	NA	NA	NA	NA	NA
4481370:4481385	attR	AATGCTCACCAACATG	NA	NA	NA	NA
VED14308.1|4482754_4482928_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED14309.1|4483079_4483490_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VED14310.1|4484169_4484715_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VED14311.1|4484689_4486615_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VED14312.1|4486611_4486818_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED14313.1|4486814_4488416_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
VED14314.1|4488396_4489716_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
VED14315.1|4489725_4490058_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
VED14316.1|4490113_4491139_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
VED14317.1|4491180_4491579_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
VED14318.1|4491590_4491944_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
VED14319.1|4491955_4492534_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
VED14320.1|4492530_4492926_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED14321.1|4492933_4493674_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
VED14322.1|4493689_4494112_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
VED14323.1|4494093_4494528_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VED14324.1|4494905_4496960_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.6	0.0e+00
VED14325.1|4496911_4497097_+|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	91.8	6.6e-25
VED14326.1|4497093_4497423_+|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VED14327.1|4497422_4498121_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
VED14328.1|4498126_4498870_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VED14329.1|4498866_4499439_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VED14330.1|4499499_4502913_+|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
VED14331.1|4502982_4503582_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
VED14332.1|4503646_4506610_+|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
>prophage 17
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	4672197	4745500	5278208	terminase,tRNA,integrase,tail,transposase,lysis,coat	Escherichia_phage(53.33%)	85	4672082:4672098	4744633:4744649
4672082:4672098	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
VED14512.1|4672197_4672473_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED14513.1|4672517_4672895_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED14514.1|4672829_4673060_-	membrane associated CTP-phosphosubstrate transferase	NA	A0A2L1IV26	Escherichia_phage	57.4	2.0e-07
VED14515.1|4673059_4673665_-	phosphatidylglycerophosphate synthase	NA	NA	NA	NA	NA
VED14516.1|4673835_4676136_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VED14517.1|4676199_4677060_-	putative oxidoreductase	NA	NA	NA	NA	NA
VED14518.1|4677290_4677881_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
VED14519.1|4677862_4678132_-	DNA-binding transcriptional repressor of phenylacetic acid degradation, aryl-CoA responsive	NA	NA	NA	NA	NA
VED14520.1|4678275_4678413_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14521.1|4678394_4678721_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED14522.1|4678728_4678914_-	lipoprotein	NA	NA	NA	NA	NA
VED14523.1|4678910_4681550_-	protein	NA	NA	NA	NA	NA
VED14524.1|4681757_4682747_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
VED14525.1|4682857_4683280_+	heat-inducible protein	NA	NA	NA	NA	NA
VED14526.1|4683276_4683543_-	protein	NA	NA	NA	NA	NA
VED14527.1|4683816_4687341_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED14528.1|4687706_4688840_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
VED14529.1|4688980_4689415_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
VED14530.1|4690000_4690915_+	iron/manganese transport system periplasmic binding protein SitA	NA	NA	NA	NA	NA
VED14531.1|4690914_4691742_+	iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
VED14532.1|4691738_4692596_+	iron ABC transporter permease	NA	NA	NA	NA	NA
VED14533.1|4692592_4693450_+	iron/manganese transport system membrane protein SitD	NA	NA	NA	NA	NA
VED14534.1|4694137_4695178_-|tail	L-shaped tail fiber protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
VED14535.1|4695187_4695469_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
VED14536.1|4695468_4697844_-|tail	tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
VED14537.1|4697908_4698508_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
VED14538.1|4698575_4699598_-	host specificity protein	NA	Q9EYE7	Enterobacteria_phage	73.6	1.8e-148
VED14539.1|4699787_4701707_-|tail	tail component of prophage	tail	A5LH43	Enterobacteria_phage	98.4	0.0e+00
VED14540.1|4701688_4701970_-|tail	putative phage tail component	tail	A0A291AWT4	Escherichia_phage	98.8	5.1e-37
VED14541.1|4702029_4702494_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	97.4	2.1e-75
VED14542.1|4702574_4703318_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
VED14543.1|4703322_4704021_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
VED14544.1|4704025_4704316_-|tail	putative phage minor tail protein	tail	A0A1B5FPI1	Escherichia_phage	41.7	2.2e-11
VED14545.1|4704350_4707584_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	8.2e-102
VED14546.1|4708055_4708505_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14547.1|4708565_4709528_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	3.4e-56
VED14548.1|4709554_4709947_-	phage protein	NA	A0A059VK45	Pseudomonas_phage	31.5	2.3e-11
VED14549.1|4709943_4710324_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
VED14550.1|4710324_4710711_-	Uncharacterised protein	NA	A0A0H5ARS2	Pseudomonas_phage	38.1	5.5e-13
VED14551.1|4710707_4711103_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14552.1|4711106_4711331_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	52.7	5.6e-10
VED14553.1|4711373_4712513_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	74.7	7.4e-159
VED14554.1|4712610_4713015_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	65.4	5.7e-45
VED14555.1|4713101_4713374_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	61.8	1.0e-18
VED14556.1|4713478_4714501_-	phage protein	NA	I6PD76	Cronobacter_phage	54.6	1.3e-101
VED14557.1|4714500_4714593_-	phage protein	NA	NA	NA	NA	NA
VED14558.1|4714635_4714800_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	58.5	5.3e-10
VED14559.1|4715024_4715249_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	71.0	6.6e-19
VED14560.1|4715582_4715975_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	71.3	5.0e-38
VED14561.1|4716082_4717276_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.5	9.3e-136
VED14562.1|4717288_4718350_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	1.1e-111
VED14563.1|4718353_4718563_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14564.1|4718540_4719473_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
VED14565.1|4719465_4720257_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	1.7e-48
VED14566.1|4720394_4721819_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VED14567.1|4721989_4722454_-|lysis	phage endopeptidase/lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	85.5	1.8e-63
VED14568.1|4722450_4722948_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	7.1e-90
VED14569.1|4722947_4723163_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VED14570.1|4724455_4724992_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
VED14571.1|4724988_4725279_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	2.8e-46
VED14572.1|4725278_4725878_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
VED14573.1|4726737_4727424_-	putative prophage protein	NA	NA	NA	NA	NA
VED14574.1|4727587_4728004_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	8.1e-63
VED14575.1|4728019_4728781_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
VED14576.1|4728803_4729550_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
VED14577.1|4729687_4730413_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.9	3.5e-69
VED14578.1|4730425_4730848_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VED14579.1|4730844_4731099_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VED14580.1|4731178_4731598_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VED14581.1|4731885_4732020_+	ydaG	NA	NA	NA	NA	NA
VED14582.1|4732031_4732187_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	57.4	3.6e-08
VED14583.1|4732183_4732795_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VED14584.1|4733102_4733324_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
VED14585.1|4733323_4733494_+	bacteriophage protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	1.1e-23
VED14586.1|4733520_4733844_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	94.5	6.8e-41
VED14587.1|4733945_4736969_+	putative phage exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	85.8	0.0e+00
VED14588.1|4736983_4738072_+	putative enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	99.7	6.6e-205
VED14589.1|4738322_4738511_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
VED14590.1|4738610_4738826_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	98.6	1.1e-36
VED14591.1|4738827_4740063_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	4.2e-240
VED14592.1|4740114_4741050_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
VED14593.1|4741178_4742552_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.5e-52
VED14594.1|4742581_4742755_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14595.1|4743029_4744013_-	zinc transport protein	NA	NA	NA	NA	NA
VED14596.1|4744267_4745500_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4744633:4744649	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 18
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	4807755	4869206	5278208	terminase,tail,lysis,capsid,protease,head	Escherichia_phage(42.86%)	79	NA	NA
VED14663.1|4807755_4808805_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VED14664.1|4809024_4809783_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
VED14665.1|4809779_4809977_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VED14666.1|4809954_4810302_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VED14667.1|4810516_4811284_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VED14668.1|4811496_4813398_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED14669.1|4813425_4814046_-	putative RNA binding protein	NA	NA	NA	NA	NA
VED14670.1|4814042_4814924_-	putative phosphoesterase	NA	NA	NA	NA	NA
VED14671.1|4815197_4816760_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VED14672.1|4816759_4818355_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.2e-52
VED14673.1|4818358_4819717_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
VED14674.1|4819728_4820922_+	tryptophan synthase	NA	NA	NA	NA	NA
VED14675.1|4820921_4821728_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VED14676.1|4822108_4822288_+	protein	NA	NA	NA	NA	NA
VED14677.1|4822373_4822874_+	YciF protein	NA	NA	NA	NA	NA
VED14678.1|4822919_4823426_+	protein YciE	NA	NA	NA	NA	NA
VED14679.1|4823914_4824085_-|tail	tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
VED14680.1|4824524_4824947_+	methylase	NA	NA	NA	NA	NA
VED14681.1|4825830_4826463_-|tail	Qin prophage; side tail fiber assembly protein	tail	K7PHC9	Enterobacteria_phage	70.7	8.1e-30
VED14682.1|4827610_4828348_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED14683.1|4828300_4828846_-|tail	tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	89.8	2.5e-56
VED14684.1|4828997_4829597_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
VED14685.1|4829664_4833144_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
VED14686.1|4833210_4833465_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14687.1|4833621_4834164_-|tail	tail component of prophage CP-933K	tail	A0A291AWV5	Escherichia_phage	82.4	1.9e-75
VED14688.1|4834160_4834760_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	94.5	4.8e-117
VED14689.1|4834907_4835606_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.1e-132
VED14690.1|4835605_4835962_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	97.9	1.3e-48
VED14691.1|4836087_4836603_-|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	96.6	5.0e-62
VED14692.1|4836824_4838501_-|tail	tail component of prophage CP-933R	tail	A0A2R9YJM8	Escherichia_phage	84.6	2.8e-247
VED14693.1|4838481_4838895_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VED14694.1|4838921_4839353_-|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
VED14695.1|4839366_4840119_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-132
VED14696.1|4840126_4840522_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
VED14697.1|4840518_4841094_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
VED14698.1|4841109_4841463_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
VED14699.1|4841455_4841839_-	phage protein	NA	NA	NA	NA	NA
VED14700.1|4841890_4842919_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
VED14701.1|4842976_4843324_-|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
VED14702.1|4843360_4844866_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	53.3	4.6e-100
VED14703.1|4844855_4845269_-|capsid	capsid protein of prophage	capsid	A0A2I6TC89	Escherichia_phage	61.8	9.6e-40
VED14704.1|4845439_4846447_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	57.3	7.4e-102
VED14705.1|4846451_4846649_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED14706.1|4846632_4848561_-|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
VED14707.1|4848532_4849081_-	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
VED14708.1|4849759_4850170_+	phage protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
VED14709.1|4850477_4850942_-	murein endopeptidase; DLP12 prophage	NA	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
VED14710.1|4850943_4851081_-	phage protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
VED14711.1|4851240_4851774_-	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	96.6	2.4e-99
VED14712.1|4852049_4852145_-	bacteriophage protein	NA	K7PGU6	Enterobacteria_phage	100.0	1.1e-07
VED14713.1|4852149_4852365_-|lysis	putative lysis protein S	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
VED14714.1|4852515_4854369_-	phage protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
VED14715.1|4855644_4856694_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
VED14716.1|4856844_4857042_-	lipoprotein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
VED14717.1|4857268_4858090_-	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	9.3e-79
VED14718.1|4858086_4858467_-	Holliday juction resolvase	NA	V5URS4	Shigella_phage	63.6	5.0e-35
VED14719.1|4858467_4859523_-	phage protein	NA	A0A291AWV9	Escherichia_phage	48.4	3.0e-90
VED14720.1|4859938_4860196_+	transcriptional regulator	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
VED14721.1|4860201_4860501_+	plasmid stabilisation protein	NA	A0A2R2Z2Y1	Escherichia_phage	91.9	1.2e-47
VED14722.1|4860562_4860916_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED14723.1|4861467_4861812_-	prophage protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
VED14724.1|4861808_4861976_-	Eaa protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
VED14725.1|4861986_4862250_-	phage protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
VED14726.1|4862251_4862692_-	putative prophage protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
VED14727.1|4862842_4863052_-	putative prophage protein	NA	NA	NA	NA	NA
VED14728.1|4863048_4863225_-	putative prophage protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
VED14729.1|4863217_4863400_-	putative prophage protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
VED14730.1|4863608_4863851_-	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	100.0	5.8e-29
VED14731.1|4863908_4864331_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	75.5	3.5e-53
VED14732.1|4864346_4865117_-	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.1e-80
VED14733.1|4865278_4865491_-	putative replication protein	NA	A0A088CBP4	Shigella_phage	86.2	1.3e-21
VED14734.1|4865557_4865884_-	putative replication protein	NA	A0A088CBP4	Shigella_phage	75.0	1.2e-37
VED14735.1|4865890_4866229_-	putative prophage replication protein	NA	U5P0A0	Shigella_phage	54.2	3.4e-35
VED14736.1|4866602_4866851_-	putative prophage replication protein	NA	U5P0A0	Shigella_phage	67.1	1.6e-21
VED14737.1|4866873_4867191_-	putative prophage protein	NA	NA	NA	NA	NA
VED14738.1|4867187_4867298_-	phage regulatory CII	NA	NA	NA	NA	NA
VED14739.1|4867281_4867557_-	putative regulator of the C1 family (possibly fragment)	NA	NA	NA	NA	NA
VED14740.1|4868174_4868363_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED14741.1|4868840_4869206_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	8.0e-06
>prophage 19
LR134238	Escherichia coli strain NCTC9044 genome assembly, chromosome: 1	5278208	5075741	5085184	5278208		Enterobacteria_phage(85.71%)	10	NA	NA
VED14940.1|5075741_5076878_+	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	98.0	5.9e-164
VED14941.1|5076874_5078875_+	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
VED14942.1|5078999_5079461_+	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VED14943.1|5079502_5079973_-	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED14944.1|5080019_5080739_-	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED14945.1|5080735_5082421_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED14946.1|5082642_5083374_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
VED14947.1|5083433_5083541_+	putative inner membrane protein	NA	NA	NA	NA	NA
VED14948.1|5083521_5084253_-	ABC transporter permease	NA	NA	NA	NA	NA
VED14949.1|5084257_5085184_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
