The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	736693	763725	4532589	protease,transposase	Shigella_phage(50.0%)	32	NA	NA
VED17423.1|736693_737188_+|protease	hydrogenase 2 maturation protease	protease	NA	NA	NA	NA
VED17425.1|737180_737669_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VED17427.1|737661_738003_+	hydrogenase nickel incorporation protein HybF	NA	NA	NA	NA	NA
VED17429.1|738015_738264_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VED17431.1|738386_739253_-	glutathione S-transferase	NA	NA	NA	NA	NA
VED17433.1|739457_741317_+	bifunctional glutathionylspermidine synthetase/amidase [includes glutathionylspermidine synthase;glutathionylspermidine amidase]	NA	NA	NA	NA	NA
VED17435.1|741608_743054_+	low-affinity inorganic phosphate transporter 2	NA	NA	NA	NA	NA
VED17437.1|743055_743592_+	general secretion pathway protein YghD	NA	NA	NA	NA	NA
VED17439.1|743872_744139_-	ybl125	NA	NA	NA	NA	NA
VED17441.1|744438_745443_-|transposase	IS5075 transposase	transposase	NA	NA	NA	NA
VED17443.1|745511_745802_-	ybl125	NA	NA	NA	NA	NA
VED17445.1|745898_746141_-	Aec78	NA	NA	NA	NA	NA
VED17447.1|746107_746596_-	aec77	NA	NA	NA	NA	NA
VED17449.1|747308_748466_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17451.1|748690_748831_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17453.1|749180_749384_-	salicylate hydroxylase	NA	NA	NA	NA	NA
VED17455.1|749523_750675_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
VED17457.1|750594_750945_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
VED17459.1|751014_751299_+	putative helicase	NA	NA	NA	NA	NA
VED17461.1|751277_751490_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17463.1|751724_753089_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VED17465.1|753196_753562_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED17467.1|753519_754425_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	97.0	4.2e-173
VED17469.1|754438_754540_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17471.1|754663_756037_+	Ribonucleases G and E	NA	NA	NA	NA	NA
VED17473.1|756168_757953_+	KAP family protein	NA	NA	NA	NA	NA
VED17475.1|757952_758705_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17477.1|758686_760006_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED17479.1|760002_760728_+	TatD-related deoxyribonuclease	NA	NA	NA	NA	NA
VED17481.1|761280_761856_-	putative sporulation protein YtaF	NA	NA	NA	NA	NA
VED17483.1|761863_763192_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED17485.1|763326_763725_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	4.9e-41
>prophage 2
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	1017245	1030428	4532589	tRNA	Escherichia_phage(45.45%)	13	NA	NA
VED17949.1|1017245_1018007_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VED17951.1|1018000_1018627_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VED17952.1|1018766_1019906_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED17954.1|1019968_1020532_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	44.0	2.2e-23
VED17955.1|1020601_1020961_+	RNA polymerase sigma factor RpoS	NA	I1ZBD5	Salisaeta_icosahedral_phage	35.4	5.8e-09
VED17956.1|1021054_1022419_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VED17957.1|1022507_1023284_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VED17959.1|1023288_1023927_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VED17960.1|1023923_1025186_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VED17962.1|1025182_1026091_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
VED17964.1|1026286_1027054_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
VED17966.1|1027104_1027761_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
VED17968.1|1027866_1030428_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	1646074	1655519	4532589		Enterobacteria_phage(85.71%)	10	NA	NA
VED18874.1|1646074_1647001_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
VED18875.1|1647005_1647737_+	ABC transporter permease	NA	NA	NA	NA	NA
VED18876.1|1647717_1647825_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED18877.1|1647884_1648616_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VED18878.1|1648837_1650523_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED18879.1|1650519_1651239_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED18880.1|1651285_1651756_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED18881.1|1651796_1652258_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VED18882.1|1652382_1654386_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
VED18883.1|1654382_1655519_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 4
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	1698423	1704346	4532589	protease,tail	Escherichia_phage(33.33%)	7	NA	NA
VED18921.1|1698423_1698852_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.5e-59
VED18922.1|1698996_1699620_+	putative phage protein (D protein)	NA	Q7Y4C6	Escherichia_virus	93.1	1.1e-68
VED18923.1|1699701_1699920_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VED18924.1|1700192_1701554_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.7	1.9e-217
VED18925.1|1701700_1702033_-	protein	NA	NA	NA	NA	NA
VED18926.1|1702223_1702946_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VED18927.1|1702942_1704346_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	1751221	1757898	4532589		Enterobacteria_phage(57.14%)	7	NA	NA
VED18962.1|1751221_1752613_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	32.8	4.8e-19
VED18963.1|1752788_1753685_+	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	41.5	4.5e-42
VED18964.1|1754024_1755107_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
VED18965.1|1755109_1756009_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
VED18966.1|1756061_1756940_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
VED18967.1|1756943_1757492_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
VED18968.1|1757505_1757898_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	50.0	6.5e-30
>prophage 6
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	1767723	1834402	4532589	transposase	Acinetobacter_phage(11.76%)	64	NA	NA
VED18977.1|1767723_1768542_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VED18978.1|1768626_1769778_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
VED18979.1|1769734_1770103_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VED18980.1|1770320_1771301_+	regulator of length of O-antigen component of lipopolysaccharide chains	NA	NA	NA	NA	NA
VED18981.1|1771339_1771951_-	histidine biosynthesis bifunctional protein [includes phosphoribosyl-AMP cyclohydrolase;phosphoribosyl-ATP pyrophosphatase]	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	7.8e-14
VED18982.1|1771944_1772721_-	imidazole glycerol phosphate synthase subunit	NA	NA	NA	NA	NA
VED18983.1|1772702_1773440_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
VED18984.1|1773439_1774030_-	imidazole glycerol phosphate synthase subunit	NA	NA	NA	NA	NA
VED18985.1|1774029_1775097_-	imidazole glycerol-phosphate dehydratase/histidinol phosphatase	NA	NA	NA	NA	NA
VED18986.1|1775096_1776167_-	histidinol-phosphate aminotransferase	NA	NA	NA	NA	NA
VED18987.1|1776163_1777468_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
VED18988.1|1777473_1778373_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
VED18989.1|1778851_1779103_+	antitoxin YefM	NA	NA	NA	NA	NA
VED18990.1|1779099_1779354_+	toxin	NA	NA	NA	NA	NA
VED18991.1|1779436_1780261_+	protein YeeZ	NA	NA	NA	NA	NA
VED18992.1|1780285_1781236_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED18993.1|1781502_1782861_+	putative amino acid permease	NA	NA	NA	NA	NA
VED18994.1|1782934_1784362_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
VED18995.1|1784570_1785737_+	penicillin-binding protein 6B	NA	B6DZZ7	Stx2-converting_phage	98.7	2.5e-226
VED18996.1|1785855_1786329_+	DNA gyrase inhibitory protein	NA	NA	NA	NA	NA
VED18997.1|1786526_1787585_+	inner membrane protein	NA	NA	NA	NA	NA
VED18998.1|1787756_1788086_+	putative alpha helix protein	NA	NA	NA	NA	NA
VED18999.1|1788983_1789178_-	CP4-44 prophage	NA	NA	NA	NA	NA
VED19000.1|1789284_1789548_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VED19001.1|1789636_1789885_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VED19002.1|1790077_1790299_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VED19003.1|1790361_1790838_-	putative DNA repair protein	NA	NA	NA	NA	NA
VED19004.1|1790853_1791333_-	anti-restriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
VED19005.1|1791414_1791729_-	CP4-57 prophage protein	NA	NA	NA	NA	NA
VED19006.1|1792019_1792427_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VED19007.1|1793232_1794090_+|transposase	transposase	transposase	NA	NA	NA	NA
VED19008.1|1794741_1795572_-	phosphotriesterase	NA	NA	NA	NA	NA
VED19009.1|1797057_1797600_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VED19010.1|1797596_1798340_+	cobalamin synthase	NA	NA	NA	NA	NA
VED19011.1|1798351_1799431_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VED19012.1|1799492_1800428_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VED19013.1|1800884_1801802_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VED19014.1|1801903_1802854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED19015.1|1803160_1804615_+	multidrug efflux system	NA	NA	NA	NA	NA
VED19016.1|1805243_1805960_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED19017.1|1806302_1807757_-	AMP nucleosidase	NA	NA	NA	NA	NA
VED19018.1|1807858_1809175_-	shikimate transporter	NA	NA	NA	NA	NA
VED19019.1|1809489_1809789_+	putative ADP-heptose:LPS heptosyl transferase	NA	NA	NA	NA	NA
VED19020.1|1809839_1810541_+	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VED19021.1|1810802_1817390_-	adhesin	NA	NA	NA	NA	NA
VED19022.1|1817500_1817905_-	adhesin	NA	NA	NA	NA	NA
VED19023.1|1818364_1819162_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VED19024.1|1819914_1820445_-	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
VED19025.1|1820787_1821438_-	metal ABC transporter substrate binding protein	NA	NA	NA	NA	NA
VED19026.1|1821694_1822330_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
VED19027.1|1822330_1823335_-	putative oxidoreductase	NA	NA	NA	NA	NA
VED19028.1|1823443_1823857_-	transthyretin-like protein	NA	NA	NA	NA	NA
VED19029.1|1823878_1824661_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
VED19030.1|1824660_1826019_+	two-component sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
VED19031.1|1826116_1826968_-	chaperone protein	NA	NA	NA	NA	NA
VED19032.1|1827479_1828298_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VED19033.1|1828437_1829589_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VED19034.1|1829539_1829689_-|transposase	IS600 transposase	transposase	NA	NA	NA	NA
VED19035.1|1829740_1830415_-	Outer membrane protein N precursor	NA	Q1MVN1	Enterobacteria_phage	45.2	7.5e-50
VED19036.1|1830408_1830801_-	Outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	49.5	6.5e-22
VED19037.1|1831428_1831731_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VED19038.1|1831770_1832466_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.9	3.6e-07
VED19039.1|1832532_1833951_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
VED19040.1|1833931_1834402_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
>prophage 7
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	2193271	2239177	4532589	integrase,transposase,tail,lysis,protease	Escherichia_phage(26.92%)	50	2200847:2200862	2229950:2229965
VED19396.1|2193271_2194093_-|protease	putative protease	protease	NA	NA	NA	NA
VED19397.1|2194368_2194677_-	acid shock protein	NA	NA	NA	NA	NA
VED19398.1|2195100_2196354_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED19399.1|2196460_2197354_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED19400.1|2197488_2198709_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED19401.1|2198833_2199529_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED19402.1|2199481_2200738_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2200847:2200862	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VED19403.1|2200932_2201547_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VED19404.1|2201589_2202444_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED19405.1|2202445_2203063_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VED19406.1|2203073_2205470_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VED19407.1|2205557_2207984_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
VED19408.1|2208182_2208488_-	protein	NA	NA	NA	NA	NA
VED19409.1|2208559_2209306_+	lipoprotein	NA	NA	NA	NA	NA
VED19410.1|2209308_2209869_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED19411.1|2209903_2210245_-	protein	NA	NA	NA	NA	NA
VED19412.1|2210379_2210706_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VED19413.1|2210911_2212126_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VED19414.1|2212137_2213157_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VED19415.1|2213344_2214625_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VED19416.1|2214659_2214896_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VED19417.1|2214983_2216615_-	Exonuclease RNase T and DNA polymerase III	NA	A0A192Y6E0	Salmonella_phage	56.7	5.6e-59
VED19418.1|2216653_2217022_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VED19419.1|2216978_2217911_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	NA	NA	NA	NA
VED19420.1|2217834_2218176_-	Exonuclease RNase T and DNA polymerase III	NA	NA	NA	NA	NA
VED19421.1|2218497_2218854_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED19422.1|2220006_2220186_+	membrane protein	NA	NA	NA	NA	NA
VED19423.1|2220520_2221834_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED19424.1|2222270_2222603_-	Qin prophage protein	NA	NA	NA	NA	NA
VED19425.1|2223135_2223375_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VED19426.1|2223374_2223662_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED19427.1|2223733_2223889_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED19428.1|2224105_2224357_+	putative prophage protein	NA	NA	NA	NA	NA
VED19429.1|2224703_2225753_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED19430.1|2225766_2226519_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VED19431.1|2226940_2227153_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED19432.1|2228270_2228390_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED19433.1|2228431_2228638_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VED19434.1|2228642_2228954_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VED19435.1|2228950_2229484_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VED19436.1|2229480_2229978_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2229950:2229965	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VED19437.1|2231226_2231400_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED19438.1|2231551_2231962_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VED19439.1|2232641_2233187_+	DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
VED19440.1|2233183_2233471_+|tail	Putative tail component of prophage	tail	A0A291AWT4	Escherichia_phage	98.9	1.4e-42
VED19441.1|2233467_2233746_+|tail	Prophage tail fiber domain protein	tail	NA	NA	NA	NA
VED19442.1|2234418_2235009_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
VED19443.1|2235325_2235559_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VED19444.1|2236344_2237628_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VED19445.1|2237716_2239177_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 8
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	2579834	2591211	4532589	integrase	Enterobacteria_phage(46.15%)	17	2582438:2582452	2599473:2599487
VED19744.1|2579834_2580779_-	Host specificity protein J of prophage	NA	A5LH43	Enterobacteria_phage	46.1	1.1e-115
VED19745.1|2580766_2581021_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	65.3	4.4e-27
VED19746.1|2581215_2581722_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED19747.1|2581983_2582178_-	antirepressor protein	NA	NA	NA	NA	NA
VED19748.1|2582394_2583921_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
2582438:2582452	attL	ATCGCCTGCTGGGCG	NA	NA	NA	NA
VED19749.1|2584176_2584509_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VED19750.1|2584576_2584879_-	Ren protein from phage origin	NA	M1FPD5	Enterobacteria_phage	96.7	1.0e-43
VED19751.1|2584875_2585577_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
VED19752.1|2585573_2585858_-	phage protein	NA	A0A1I9LJP3	Stx_converting_phage	98.7	2.0e-41
VED19753.1|2585939_2586464_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.4	2.3e-99
VED19754.1|2586460_2586619_+	phage protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
VED19755.1|2586615_2587680_+	DNA thiolation protein; phage protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
VED19756.1|2587833_2588052_+	ybl16	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
VED19757.1|2588099_2588339_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
VED19758.1|2588478_2588715_+	excisionase	NA	NA	NA	NA	NA
VED19759.1|2588704_2589847_+|integrase	prophage lambda integrase	integrase	O21929	Phage_21	99.7	6.9e-205
VED19760.1|2589960_2591211_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2599473:2599487	attR	ATCGCCTGCTGGGCG	NA	NA	NA	NA
>prophage 9
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	2831824	2838699	4532589	tail,capsid	Escherichia_phage(57.14%)	7	NA	NA
VED19986.1|2831824_2834107_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
VED19987.1|2834425_2834644_-	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VED19988.1|2834725_2835889_-	phage protein D	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
VED19989.1|2835888_2836368_-	gpU phage protein	NA	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
VED19990.1|2836382_2837339_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.7	2.7e-138
VED19991.1|2837395_2837665_+	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
VED19992.1|2837664_2838699_+|capsid	phage capsid protein	capsid	Q858W8	Yersinia_virus	96.5	3.1e-196
>prophage 10
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	2990429	3010406	4532589	lysis,integrase,terminase	Enterobacteria_phage(73.91%)	29	2983534:2983548	3018891:3018905
2983534:2983548	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
VED20129.1|2990429_2990783_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.0	2.4e-39
VED20130.1|2990824_2991568_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VED20131.1|2993653_2994838_-	Phage protein	NA	K7PHC9	Enterobacteria_phage	71.4	2.3e-38
VED20132.1|2994839_2995721_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.6	1.8e-176
VED20133.1|2995875_2996421_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VED20134.1|2997168_2997375_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VED20135.1|2997660_2998071_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
VED20136.1|2998361_2998655_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
VED20137.1|2998686_2999148_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	4.6e-75
VED20138.1|2999144_2999642_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
VED20139.1|2999641_2999857_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VED20140.1|3000444_3001527_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
VED20141.1|3001715_3002099_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VED20142.1|3002321_3002684_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
VED20143.1|3002680_3002971_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
VED20144.1|3002963_3003134_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VED20145.1|3003133_3003589_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	1.4e-60
VED20146.1|3003779_3004232_-	17 kDa surface antigen	NA	NA	NA	NA	NA
VED20147.1|3004228_3004789_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED20148.1|3005045_3005237_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED20149.1|3005543_3006068_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.4	6.8e-99
VED20150.1|3006064_3006247_+	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
VED20151.1|3006378_3006600_+	putative C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
VED20152.1|3006596_3006848_+	putative bacteriophage protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	1.3e-31
VED20153.1|3007146_3007761_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED20154.1|3008054_3008174_+	phage protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	79.5	8.0e-08
VED20155.1|3008421_3008850_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED20156.1|3008932_3009100_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
VED20157.1|3009335_3010406_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	3.3e-201
3018891:3018905	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 11
LR134239	Escherichia coli strain NCTC9100 genome assembly, chromosome: 1	4532589	3902086	3923212	4532589	integrase,transposase	Shigella_phage(36.36%)	23	3915986:3916013	3923300:3923327
VED21469.1|3902086_3902296_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VED21471.1|3903075_3903597_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VED21473.1|3903593_3904547_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED21474.1|3904633_3906958_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VED21476.1|3907002_3907905_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VED21478.1|3907901_3908900_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED21480.1|3908896_3909853_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VED21482.1|3909853_3910621_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VED21484.1|3911178_3911436_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED21487.1|3911518_3911761_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VED21489.1|3911757_3912171_-|transposase	transposase ORF B (fragment), IS911	transposase	Q716C2	Shigella_phage	95.6	1.5e-61
VED21491.1|3912487_3913639_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
VED21493.1|3913558_3913909_-|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
VED21495.1|3914009_3914582_+	lysogenic conversion protein from Bacteriophage P2-EC53	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
VED21497.1|3914630_3915455_-	Uncharacterised protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
3915986:3916013	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
VED21499.1|3916492_3917050_-	transcriptional regulator	NA	NA	NA	NA	NA
VED21501.1|3917197_3917692_+	putative transmembrane protein	NA	NA	NA	NA	NA
VED21503.1|3917752_3918598_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED21505.1|3918611_3919172_-	resolvase	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
VED21507.1|3919364_3919457_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED21509.1|3919501_3919831_+	Uncharacterized protein conserved in bacteria	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
VED21511.1|3920836_3921169_+	nipsnap family protein	NA	NA	NA	NA	NA
VED21512.1|3921301_3923212_-|integrase	phage integrase site specific recombinase	integrase	NA	NA	NA	NA
3923300:3923327	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
