The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	212711	275222	4742976	tRNA,transposase,protease	uncultured_Caudovirales_phage(30.0%)	57	NA	NA
VED24051.1|212711_214208_+|protease	putative protease	protease	NA	NA	NA	NA
VED24052.1|214303_215233_-	ketodeoxygluconokinase	NA	NA	NA	NA	NA
VED24053.1|215464_216232_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
VED24054.1|216301_218362_+	putative outer membrane assembly protein	NA	NA	NA	NA	NA
VED24055.1|218543_219866_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED24056.1|220276_221290_-|tRNA	tRNA-processing ribonuclease	tRNA	NA	NA	NA	NA
VED24057.1|221338_222310_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED24058.1|222757_223360_+	transcriptional regulator	NA	NA	NA	NA	NA
VED24059.1|223410_225060_-	cytoplasmic trehalase	NA	NA	NA	NA	NA
VED24060.1|225463_226861_+	putative cytochrome C peroxidase	NA	NA	NA	NA	NA
VED24061.1|227071_228472_+	glutamate decarboxylase beta	NA	NA	NA	NA	NA
VED24062.1|228841_229666_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VED24063.1|230033_230762_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VED24064.1|231124_234034_-	multidrug resistance protein	NA	NA	NA	NA	NA
VED24065.1|234041_234239_-	multidrug resistance protein	NA	NA	NA	NA	NA
VED24066.1|234263_235421_-	multidrug resistance protein	NA	NA	NA	NA	NA
VED24067.1|235480_235759_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24068.1|235759_236287_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VED24069.1|237085_237658_-	putative acid resistance protein	NA	NA	NA	NA	NA
VED24070.1|237912_238245_+	putative periplasmic acid stress chaperone	NA	NA	NA	NA	NA
VED24071.1|238348_238687_+	acid-resistance protein	NA	NA	NA	NA	NA
VED24072.1|238822_239398_+	magnesium transporter ATPase	NA	G3MA03	Bacillus_virus	38.5	7.4e-14
VED24073.1|239439_239970_-	transcriptional regulator	NA	NA	NA	NA	NA
VED24074.1|240125_240692_-	Slp family outer membrane lipoprotein	NA	NA	NA	NA	NA
VED24075.1|240939_242163_-	yhiS	NA	NA	NA	NA	NA
VED24076.1|242791_243217_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
VED24077.1|243229_244519_-	arsenical pump membrane protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
VED24078.1|244572_244926_-	DNA-binding transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
VED24079.1|245464_245638_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED24080.1|245802_247155_-	glutathione reductase	NA	NA	NA	NA	NA
VED24081.1|247226_248069_-	DNA (exogenous) processing protein	NA	NA	NA	NA	NA
VED24082.1|248271_250314_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
VED24083.1|250321_251074_+	methyltransferase	NA	NA	NA	NA	NA
VED24084.1|251122_252592_-	putative oligopeptide transporter	NA	NA	NA	NA	NA
VED24085.1|252908_253343_-	universal stress protein A	NA	NA	NA	NA	NA
VED24086.1|253733_254069_+	universal stress protein B	NA	NA	NA	NA	NA
VED24087.1|254312_255812_-	low-affinity inorganic phosphate transporter	NA	NA	NA	NA	NA
VED24088.1|256043_257246_+	oxidoreductase with FAD/NAD(P)-binding domain	NA	NA	NA	NA	NA
VED24089.1|257388_258231_+|transposase	Tn7-like transposase TnsA	transposase	NA	NA	NA	NA
VED24090.1|258217_258805_+	Tn7-like transposition protein TnsB	NA	NA	NA	NA	NA
VED24091.1|258888_259677_+	Tn7-like transposition protein TnsB	NA	NA	NA	NA	NA
VED24092.1|259670_260048_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED24093.1|260092_260368_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED24094.1|260490_261120_+	Tn7-like transposition protein TnsB	NA	NA	NA	NA	NA
VED24095.1|261119_262568_+	Tn7-like transposition protein TnsC	NA	NA	NA	NA	NA
VED24096.1|262608_264165_+	TnsD	NA	NA	NA	NA	NA
VED24097.1|264176_265103_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24098.1|265455_265755_+	transcriptional regulator	NA	NA	NA	NA	NA
VED24099.1|266318_267314_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
VED24100.1|267310_268144_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
VED24101.1|269595_269976_-	Uncharacterized protein conserved in bacteria	NA	A0A218MND9	uncultured_virus	60.9	1.2e-15
VED24102.1|270123_270555_-	silver-binding protein SilE	NA	NA	NA	NA	NA
VED24103.1|270799_272281_-	sensor kinase CusS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
VED24104.1|272273_272954_-	DNA-binding transcriptional activator CusR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
VED24105.1|273143_273950_+	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VED24106.1|273946_274087_-|transposase	transposase	transposase	NA	NA	NA	NA
VED24107.1|274109_275222_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
>prophage 2
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	737492	784976	4742976	transposase	Escherichia_phage(20.0%)	57	NA	NA
VED24556.1|737492_737702_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED24557.1|737702_737999_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	5.6e-42
VED24558.1|738243_739389_-	Inner membrane protein yqiK	NA	NA	NA	NA	NA
VED24559.1|739415_740045_-	membrane protein YqiJ	NA	NA	NA	NA	NA
VED24560.1|740313_740514_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
VED24561.1|740556_741621_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VED24562.1|741622_742372_-	putative fimbrial chaperone	NA	NA	NA	NA	NA
VED24563.1|742387_743599_-	outer membrane usher protein	NA	NA	NA	NA	NA
VED24564.1|743624_744605_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
VED24565.1|744713_744902_-	fimbrial protein	NA	NA	NA	NA	NA
VED24566.1|745185_745476_-	YqiC protein	NA	NA	NA	NA	NA
VED24567.1|745849_746503_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
VED24568.1|746764_746935_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24569.1|746992_747766_-	zinc transporter ZupT	NA	NA	NA	NA	NA
VED24570.1|747881_748697_+	putative aromatic ring-opening dioxygenase	NA	NA	NA	NA	NA
VED24571.1|748734_749895_-	glutathionylspermidine synthase	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
VED24572.1|749900_750572_-	putative inner membrane protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
VED24573.1|750719_752201_-	outer membrane channel protein	NA	NA	NA	NA	NA
VED24574.1|752405_753035_+	ADP-ribose pyrophosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
VED24575.1|753035_753458_+	putative dehydrogenase	NA	NA	NA	NA	NA
VED24576.1|753482_754310_+	putative phosphoesterase	NA	NA	NA	NA	NA
VED24577.1|754309_754891_+	esterase	NA	NA	NA	NA	NA
VED24578.1|754919_756812_+	topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
VED24579.1|756859_757174_-	putative monooxygenase	NA	NA	NA	NA	NA
VED24580.1|757204_757573_-	modulator of drug activity B	NA	NA	NA	NA	NA
VED24581.1|757673_757787_-	modulator of drug activity B	NA	NA	NA	NA	NA
VED24582.1|758008_758284_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED24583.1|758328_758706_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED24584.1|759260_760610_-	two-component system sensor kinase	NA	NA	NA	NA	NA
VED24585.1|760606_761266_-	two-component system response regulator	NA	NA	NA	NA	NA
VED24586.1|761417_761810_+	protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
VED24587.1|761862_762345_+	putative regulatory protein	NA	NA	NA	NA	NA
VED24588.1|762549_762846_+	cyanide hydratase	NA	NA	NA	NA	NA
VED24589.1|762847_763243_+	HTH-type transcriptional regulator ygiT	NA	NA	NA	NA	NA
VED24590.1|763375_764983_+	binding protein	NA	NA	NA	NA	NA
VED24591.1|765120_767379_+	topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
VED24592.1|767612_768350_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
VED24593.1|768424_769837_+	SufI protein	NA	NA	NA	NA	NA
VED24594.1|769947_772167_+	radical SAM superfamily protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
VED24595.1|772209_772467_-	putative lipoprotein	NA	NA	NA	NA	NA
VED24596.1|772517_773444_-	Protein of uncharacterised function (DUF3828)	NA	NA	NA	NA	NA
VED24597.1|773643_774471_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
VED24598.1|774575_775739_-	putative alcohol dehydrogenase	NA	NA	NA	NA	NA
VED24599.1|775875_776832_+	transcriptional regulator YqhC	NA	NA	NA	NA	NA
VED24600.1|776871_777531_-	inner membrane protein	NA	NA	NA	NA	NA
VED24601.1|777670_778858_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
VED24602.1|779109_779844_+	biopolymer transport protein	NA	NA	NA	NA	NA
VED24603.1|779850_780276_+	biopolymer transport protein	NA	NA	NA	NA	NA
VED24604.1|780547_781432_-	oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
VED24605.1|781622_782117_+	inner membrane protein	NA	NA	NA	NA	NA
VED24606.1|782156_782591_-	putative aldo/keto reductase	NA	NA	NA	NA	NA
VED24607.1|782583_783198_-	putative aldo/keto reductase	NA	NA	NA	NA	NA
VED24608.1|783354_783498_+	hydrolase	NA	NA	NA	NA	NA
VED24609.1|783475_783829_+	hydrolase	NA	NA	NA	NA	NA
VED24610.1|783828_784239_+	yghX	NA	NA	NA	NA	NA
VED24611.1|784278_784656_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED24612.1|784700_784976_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
>prophage 3
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	790585	833648	4742976	transposase,protease	Escherichia_phage(46.15%)	45	NA	NA
VED24618.1|790585_791080_+|protease	hydrogenase 2 maturation protease	protease	NA	NA	NA	NA
VED24619.1|791072_791561_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VED24620.1|791553_791895_+	hydrogenase nickel incorporation protein HybF	NA	NA	NA	NA	NA
VED24621.1|791907_792156_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VED24622.1|792278_793145_-	glutathione S-transferase	NA	NA	NA	NA	NA
VED24623.1|793349_795209_+	bifunctional glutathionylspermidine synthetase/amidase [includes glutathionylspermidine synthase;glutathionylspermidine amidase]	NA	NA	NA	NA	NA
VED24624.1|795537_795915_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED24625.1|795959_796235_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED24626.1|796471_796882_+	type II secretion system lipoprotein	NA	NA	NA	NA	NA
VED24627.1|797040_797859_+	type II secretion protein GspC	NA	NA	NA	NA	NA
VED24628.1|797888_799949_+	type II secretion system protein D	NA	NA	NA	NA	NA
VED24629.1|799948_801442_+	type II secretion system protein E	NA	NA	NA	NA	NA
VED24630.1|801441_802665_+	type II secretion system protein F	NA	NA	NA	NA	NA
VED24631.1|802681_803137_+	general secretion pathway protein G precursor (epsG-like)	NA	NA	NA	NA	NA
VED24632.1|803140_803704_+	type II secretion system protein H	NA	NA	NA	NA	NA
VED24633.1|803700_804072_+	type II secretion system protein I	NA	NA	NA	NA	NA
VED24634.1|804068_804674_+	type II secretion protein GspJ	NA	NA	NA	NA	NA
VED24635.1|804670_805648_+	type II secretion system protein K	NA	NA	NA	NA	NA
VED24636.1|805644_806823_+	type II secretion system protein L	NA	NA	NA	NA	NA
VED24637.1|806824_807361_+	general secretion pathway protein YghD	NA	NA	NA	NA	NA
VED24638.1|808295_809276_-|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	99.4	8.0e-186
VED24639.1|810517_812131_+	polysialic acid transport protein	NA	NA	NA	NA	NA
VED24640.1|812197_812998_+	ABC-type polysaccharide/polyol phosphate export systems permease	NA	NA	NA	NA	NA
VED24641.1|813009_813660_+	polysialic acid transport ATP-binding protein KpsT	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	1.5e-07
VED24642.1|813628_814876_+	Capsule polysaccharide export inner-membrane protein	NA	NA	NA	NA	NA
VED24643.1|815016_817746_+	chromosome segregation protein SMC	NA	A0A0E3FKP5	Synechococcus_phage	35.4	1.4e-06
VED24644.1|817751_820166_+	beta1,3-glucosyltransferase WaaV	NA	NA	NA	NA	NA
VED24645.1|820189_821407_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24646.1|821413_822391_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24647.1|822743_823910_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.8	2.3e-115
VED24648.1|823856_824003_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED24649.1|824103_824481_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24650.1|824480_824579_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24651.1|824682_824937_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24652.1|824962_825451_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24653.1|825710_826982_+	putative carnitine operon oxidoreductase	NA	A0A2L1IV26	Escherichia_phage	100.0	3.3e-06
VED24654.1|826916_827294_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED24655.1|827338_827614_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED24656.1|827750_828353_+	dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol, alpha-3-L-rhamnosyltransferase	NA	NA	NA	NA	NA
VED24657.1|828340_829372_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24658.1|830097_831183_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	A0A1D7XFE8	Escherichia_phage	50.4	2.9e-96
VED24659.1|831182_832070_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	3.1e-27
VED24660.1|832150_832654_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.0e-56
VED24661.1|832601_833030_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.8	1.3e-39
VED24662.1|833096_833648_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	4.7e-50
>prophage 4
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	854370	899328	4742976	integrase,tRNA,transposase	Shigella_phage(28.57%)	50	862067:862084	896516:896533
VED24683.1|854370_854736_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED24684.1|856039_856609_+	malate transporter	NA	NA	NA	NA	NA
VED24685.1|856868_857270_+	ybl85	NA	NA	NA	NA	NA
VED24686.1|857257_857692_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VED24687.1|857691_857928_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED24688.1|858046_858427_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
VED24689.1|858423_858771_+	prophage CP-933O IS protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
VED24690.1|858820_860359_+|transposase	putative transposase ORF 1, IS66 family	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.2	4.8e-294
VED24691.1|861210_861561_+|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	98.9	1.4e-39
VED24692.1|861480_862632_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
862067:862084	attL	AGATGCTGTATATTCAGG	NA	NA	NA	NA
VED24693.1|862948_863356_+|integrase	putative integrase	integrase	Q716C2	Shigella_phage	97.5	4.5e-66
VED24694.1|863574_864651_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VED24695.1|864769_864976_+|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	98.5	3.0e-34
VED24696.1|865137_865917_-	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VED24697.1|865916_866939_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
VED24698.1|866965_867940_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.6	3.2e-54
VED24699.1|868393_869092_-	membrane protein YqgA	NA	NA	NA	NA	NA
VED24700.1|869489_870884_+	Ornithine decarboxylase	NA	NA	NA	NA	NA
VED24701.1|871053_871626_+	Ornithine decarboxylase	NA	NA	NA	NA	NA
VED24702.1|871671_872928_-	nucleoside permease	NA	NA	NA	NA	NA
VED24703.1|873129_874209_-	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
VED24704.1|874273_874549_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
VED24705.1|874576_875629_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
VED24706.1|875789_876509_+|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
VED24707.1|876508_876835_+	protein	NA	NA	NA	NA	NA
VED24708.1|877018_877738_+	protein	NA	NA	NA	NA	NA
VED24709.1|877913_878960_+	L-asparaginase 2	NA	NA	NA	NA	NA
VED24710.1|879076_880084_+	putative alpha helix chain	NA	NA	NA	NA	NA
VED24711.1|880148_881285_-	putative oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
VED24712.1|881277_881871_-	deoxyribonucleotide triphosphate pyrophosphatase	NA	NA	NA	NA	NA
VED24713.1|881878_882169_-	conserved protein, UPF0235 family	NA	NA	NA	NA	NA
VED24714.1|882165_882732_-	membrane protein YggT	NA	NA	NA	NA	NA
VED24715.1|882749_883454_-	putative amino acid racemase	NA	NA	NA	NA	NA
VED24716.1|883471_884452_+	twitching motility family protein	NA	NA	NA	NA	NA
VED24717.1|884626_885043_-	putative holliday junction resolvase	NA	NA	NA	NA	NA
VED24718.1|885042_885678_-	protein YqgE	NA	NA	NA	NA	NA
VED24719.1|885714_886665_-	glutathione synthetase	NA	NA	NA	NA	NA
VED24720.1|886677_887409_-	16S ribosomal RNA methyltransferase RsmE	NA	NA	NA	NA	NA
VED24721.1|887488_888196_-	endonuclease I	NA	NA	NA	NA	NA
VED24722.1|888290_888746_-	protein SprT	NA	NA	NA	NA	NA
VED24723.1|888864_890259_-	galactose-proton symporter	NA	NA	NA	NA	NA
VED24724.1|890694_891849_-	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
VED24725.1|891904_892156_+	inner membrane protein	NA	NA	NA	NA	NA
VED24726.1|892643_894620_+	arginine decarboxylase	NA	NA	NA	NA	NA
VED24727.1|894765_895497_+	lipoprotein	NA	NA	NA	NA	NA
VED24728.1|895632_896553_+	agmatinase	NA	NA	NA	NA	NA
896516:896533	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
VED24729.1|896605_896824_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	59.7	7.8e-17
VED24730.1|896906_897983_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VED24731.1|898201_898582_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	52.5	3.5e-28
VED24732.1|898806_899328_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	943758	950666	4742976	tRNA,transposase	Bacillus_phage(16.67%)	8	NA	NA
VED24774.1|943758_945492_+	single-stranded DNA-specific exonuclease	NA	A7KV88	Bacillus_phage	28.7	4.1e-60
VED24775.1|945799_946681_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
VED24776.1|946690_948208_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
VED24777.1|948250_948799_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
VED24778.1|948921_949047_-	small predicted membrane protein	NA	NA	NA	NA	NA
VED24779.1|949048_949882_-	purine permease ygfU	NA	Q9KX94	Enterobacteria_phage	29.3	7.9e-17
VED24780.1|949968_950244_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED24781.1|950288_950666_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 6
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	1068128	1081311	4742976	tRNA	Escherichia_phage(50.0%)	12	NA	NA
VED24883.1|1068128_1068890_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VED24884.1|1068883_1069510_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VED24885.1|1069649_1070789_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED24886.1|1070851_1071844_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VED24887.1|1071937_1073302_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VED24888.1|1073390_1074167_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VED24889.1|1074171_1074810_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VED24890.1|1074806_1076069_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VED24891.1|1076065_1076974_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VED24892.1|1077169_1077937_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
VED24893.1|1077987_1078644_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
VED24894.1|1078749_1081311_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 7
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	1681329	1690771	4742976		Enterobacteria_phage(85.71%)	10	NA	NA
VED25552.1|1681329_1682256_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VED25554.1|1682260_1682992_+	ABC transporter permease	NA	NA	NA	NA	NA
VED25556.1|1682972_1683080_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED25558.1|1683139_1683871_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VED25560.1|1684092_1685778_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED25562.1|1685774_1686494_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED25564.1|1686540_1687011_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED25566.1|1687051_1687513_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VED25568.1|1687637_1689638_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
VED25570.1|1689634_1690771_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 8
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	1785341	1792864	4742976		Enterobacteria_phage(42.86%)	7	NA	NA
VED25707.1|1785341_1786736_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
VED25709.1|1786893_1787889_+	UDP-N-acetylglucosamine 4-epimerase (UDP-GlcNAc 4-epimerase)	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
VED25710.1|1788131_1789025_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
VED25711.1|1789396_1790482_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
VED25712.1|1790481_1791381_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	4.1e-27
VED25714.1|1791438_1792317_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	2.3e-107
VED25715.1|1792321_1792864_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.5	4.6e-50
>prophage 9
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	1851459	1868323	4742976	integrase,transposase	Pseudomonas_phage(33.33%)	14	1855293:1855352	1868486:1868565
VED25814.1|1851459_1852098_-|integrase	phage integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
VED25815.1|1852191_1852722_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-30
VED25816.1|1853285_1854203_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VED25817.1|1854304_1855255_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1855293:1855352	attL	TGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCG	NA	NA	NA	NA
VED25819.1|1855561_1857016_+	multidrug efflux system	NA	NA	NA	NA	NA
VED25820.1|1857647_1858364_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED25821.1|1858706_1860161_-	AMP nucleosidase	NA	NA	NA	NA	NA
VED25822.1|1860262_1861579_-	shikimate transporter	NA	NA	NA	NA	NA
VED25824.1|1861893_1862181_+	putative ADP-heptose:LPS heptosyl transferase	NA	NA	NA	NA	NA
VED25825.1|1862191_1862569_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED25826.1|1862613_1862889_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED25828.1|1864865_1865750_+	DNA-binding prophage protein	NA	NA	NA	NA	NA
VED25830.1|1867060_1867699_-|integrase	phage integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
VED25832.1|1867792_1868323_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.7	6.8e-30
1868486:1868565	attR	TGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCG	NA	NA	NA	NA
>prophage 10
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	1874175	1888057	4742976	transposase	Bacillus_phage(20.0%)	15	NA	NA
VED25846.1|1874175_1874958_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
VED25847.1|1874957_1876316_+	two-component sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
VED25849.1|1876423_1877275_-	chaperone protein	NA	NA	NA	NA	NA
VED25851.1|1877288_1878194_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	6.7e-171
VED25853.1|1878151_1878517_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED25855.1|1879203_1879827_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	49.3	5.7e-52
VED25857.1|1879860_1880262_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	48.5	1.5e-26
VED25859.1|1880810_1881194_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VED25861.1|1881233_1881929_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
VED25863.1|1881995_1883414_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
VED25865.1|1883394_1883865_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
VED25867.1|1883853_1884774_-	putative DMT superfamily transporter inner membrane protein	NA	NA	NA	NA	NA
VED25869.1|1884946_1885864_+	putative methyl-independent mismatch repair protein	NA	NA	NA	NA	NA
VED25871.1|1885942_1886125_+	putative small protein	NA	NA	NA	NA	NA
VED25873.1|1886362_1888057_+	cellulose synthesis regulatory protein (signal transduction protein)	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 11
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	2238894	2315161	4742976	head,terminase,portal,coat,tail,integrase,lysis,transposase,protease,capsid	Enterobacteria_phage(38.33%)	88	2233245:2233260	2282671:2282686
2233245:2233260	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
VED26574.1|2238894_2239716_-|protease	putative protease	protease	NA	NA	NA	NA
2233245:2233260	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
VED26576.1|2239900_2240299_-	acid shock protein	NA	NA	NA	NA	NA
VED26578.1|2240723_2241977_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED26580.1|2242083_2242977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED26582.1|2243111_2244332_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED26584.1|2244456_2245152_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED26586.1|2245104_2246361_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED26588.1|2246555_2247170_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VED26590.1|2247212_2248067_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED26592.1|2248068_2248686_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VED26594.1|2248696_2251093_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
VED26595.1|2251180_2253607_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-213
VED26597.1|2253805_2254111_-	protein	NA	NA	NA	NA	NA
VED26599.1|2254182_2254929_+	lipoprotein	NA	NA	NA	NA	NA
VED26601.1|2254931_2255492_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED26603.1|2255526_2255868_-	protein	NA	NA	NA	NA	NA
VED26605.1|2256002_2256329_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VED26607.1|2256534_2257125_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	35.9	1.9e-20
VED26609.1|2257108_2257750_+	starvation sensing protein RspA	NA	NA	NA	NA	NA
VED26611.1|2257761_2258781_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VED26612.1|2259134_2260250_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	58.9	2.4e-122
VED26614.1|2260284_2260521_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VED26615.1|2260608_2263080_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VED26617.1|2263172_2263268_-	putative prophage protein	NA	NA	NA	NA	NA
VED26619.1|2263358_2264264_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	6.7e-171
VED26621.1|2264221_2264587_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED26623.1|2264696_2264885_-	division inhibition protein	NA	NA	NA	NA	NA
VED26625.1|2265284_2265449_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED26627.1|2265452_2265671_-	putative prophage protein	NA	NA	NA	NA	NA
VED26629.1|2265700_2265829_-	putative prophage protein	NA	NA	NA	NA	NA
VED26631.1|2265830_2265986_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VED26633.1|2266152_2266560_-	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
VED26635.1|2266643_2266874_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VED26637.1|2266857_2267379_+	YdfX	NA	NA	NA	NA	NA
VED26639.1|2267359_2268325_+	ybl78	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
VED26641.1|2268365_2268788_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VED26643.1|2268784_2269141_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED26645.1|2269530_2271144_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	5.2e-182
2269240:2269255	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
VED26647.1|2271174_2271525_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
2269240:2269255	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
VED26649.1|2271521_2271947_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
VED26651.1|2272833_2273013_+	membrane protein	NA	NA	NA	NA	NA
VED26653.1|2273347_2274661_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED26655.1|2275097_2275430_-	Qin prophage protein	NA	NA	NA	NA	NA
VED26657.1|2275962_2276202_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VED26659.1|2276201_2276489_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED26661.1|2276560_2276716_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED26663.1|2276932_2277184_+	putative prophage protein	NA	NA	NA	NA	NA
VED26665.1|2277530_2278580_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED26667.1|2278593_2279346_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.4	1.8e-132
VED26669.1|2279767_2279980_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED26671.1|2281259_2281466_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VED26673.1|2281470_2281782_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VED26674.1|2281778_2282312_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	92.7	1.4e-96
VED26676.1|2282308_2282806_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
VED26678.1|2284066_2284342_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED26680.1|2284386_2284764_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED26682.1|2284832_2285006_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED26683.1|2285157_2285568_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VED26685.1|2286247_2286793_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
VED26687.1|2286767_2288693_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VED26689.1|2288689_2288896_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED26691.1|2288892_2290494_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
VED26693.1|2290474_2291794_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	98.6	4.0e-233
VED26695.1|2291803_2292136_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
VED26697.1|2292191_2293217_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	99.4	3.9e-191
VED26698.1|2293258_2293657_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
VED26701.1|2293668_2294022_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
VED26703.1|2294033_2294612_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
VED26704.1|2294608_2295004_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED26706.1|2295011_2295752_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
VED26708.1|2295767_2296190_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
VED26710.1|2296171_2296606_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VED26712.1|2296598_2299160_+|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
VED26713.1|2299156_2299486_+|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
VED26715.1|2299485_2300184_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
VED26717.1|2300189_2300933_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VED26719.1|2300929_2301502_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	95.8	4.4e-83
VED26721.1|2301562_2304961_+	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.5	0.0e+00
VED26723.1|2305027_2305627_+	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	98.5	3.3e-110
VED26725.1|2306188_2306926_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED26727.1|2307056_2308715_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	56.9	8.8e-76
VED26729.1|2309387_2309978_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VED26731.1|2310294_2310528_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VED26733.1|2311314_2312598_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VED26735.1|2312686_2314132_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
VED26737.1|2314125_2314503_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED26739.1|2314547_2314823_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED26743.1|2314957_2315161_-	selenium carrying protein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 12
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	2350865	2373792	4742976	integrase,transposase	Shigella_phage(50.0%)	21	2345692:2345706	2377570:2377584
2345692:2345706	attL	CTGCTGGAAGAGATG	NA	NA	NA	NA
VED26810.1|2350865_2352320_+|integrase	Phage integrase	integrase	NA	NA	NA	NA
VED26812.1|2352303_2353854_+	Integrase	NA	NA	NA	NA	NA
VED26814.1|2353850_2356217_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED26816.1|2356216_2356651_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED26818.1|2356853_2357069_-	transcriptional regulator	NA	NA	NA	NA	NA
VED26820.1|2357283_2357844_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED26822.1|2358248_2358446_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VED26824.1|2358734_2359277_+	ribonuclease T	NA	NA	NA	NA	NA
VED26826.1|2359290_2359788_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED26828.1|2359780_2360494_-	ThiF family protein	NA	NA	NA	NA	NA
VED26829.1|2361937_2362633_-|transposase	IS30 transposase	transposase	NA	NA	NA	NA
VED26832.1|2362763_2363357_+|transposase	transposase ORF B (fragment), IS911	transposase	S5FNT8	Shigella_phage	91.7	4.2e-97
VED26834.1|2363575_2364652_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VED26836.1|2364770_2364977_+	IS911 protein	NA	Q716C2	Shigella_phage	89.6	2.9e-29
VED26838.1|2365204_2366743_+|transposase	putative transposase ORF 1, IS66 family	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.6	8.2e-278
VED26840.1|2366907_2367639_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED26843.1|2367710_2367881_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED26845.1|2368439_2371553_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED26847.1|2371853_2372804_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
VED26848.1|2373173_2373488_+	protein	NA	NA	NA	NA	NA
VED26850.1|2373516_2373792_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
2377570:2377584	attR	CATCTCTTCCAGCAG	NA	NA	NA	NA
>prophage 13
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	2599215	2664677	4742976	head,tail,integrase,lysis,protease	Enterobacteria_phage(30.19%)	84	2619010:2619026	2664864:2664880
VED27234.1|2599215_2600265_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VED27235.1|2600484_2601243_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
VED27236.1|2601239_2601830_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VED27238.1|2601869_2602745_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VED27239.1|2602955_2604851_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED27240.1|2604878_2605499_-	putative RNA binding protein	NA	NA	NA	NA	NA
VED27241.1|2605495_2606377_-	putative phosphoesterase	NA	NA	NA	NA	NA
VED27243.1|2606650_2608213_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VED27244.1|2608212_2609808_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
VED27245.1|2609811_2611170_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
VED27246.1|2611181_2612375_+	tryptophan synthase	NA	NA	NA	NA	NA
VED27248.1|2612374_2613181_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VED27249.1|2613561_2613741_+	protein	NA	NA	NA	NA	NA
VED27251.1|2613826_2614327_+	YciF protein	NA	NA	NA	NA	NA
VED27253.1|2614372_2614879_+	protein YciE	NA	NA	NA	NA	NA
VED27255.1|2614938_2615577_-	outer membrane protein W	NA	NA	NA	NA	NA
VED27257.1|2615933_2616677_+	membrane protein YciC	NA	NA	NA	NA	NA
VED27259.1|2616706_2617246_+	putative intracellular septation protein	NA	NA	NA	NA	NA
VED27261.1|2617350_2617749_+	putative acyl-coA thioester hydrolase	NA	NA	NA	NA	NA
VED27263.1|2617788_2618523_-	transport protein TonB	NA	NA	NA	NA	NA
VED27264.1|2618731_2619028_+	putative cytoplasmic protein YciI	NA	NA	NA	NA	NA
2619010:2619026	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
VED27266.1|2619146_2619695_-	site-specific DNA recombinase	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
VED27268.1|2619886_2620123_+	putative isochorismatase	NA	NA	NA	NA	NA
VED27270.1|2620119_2620230_+	conserved protein, UPF0759 family	NA	NA	NA	NA	NA
VED27272.1|2620717_2621107_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	72.1	1.5e-50
VED27274.1|2621195_2621489_-	ybl63	NA	NA	NA	NA	NA
VED27276.1|2621481_2623818_-	Putative eliminase	NA	A0A2H4YDM8	Escherichia_virus	47.9	1.8e-42
VED27278.1|2623875_2626959_-	Uncharacterised protein	NA	A0A286S259	Klebsiella_phage	53.0	4.0e-308
VED27280.1|2626955_2627336_-	Uncharacterised protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-52
VED27282.1|2627345_2627834_-	Domain of uncharacterised function (DUF1833)	NA	A0A286S2B1	Klebsiella_phage	65.4	4.4e-52
VED27284.1|2627830_2628301_-	Uncharacterised protein	NA	A0A286S298	Klebsiella_phage	56.8	4.6e-54
VED27286.1|2628310_2631685_-|tail	tail component of prophage CP-933X	tail	Q5G8W8	Enterobacteria_phage	76.7	0.0e+00
VED27288.1|2631744_2632125_-	lipoprotein	NA	NA	NA	NA	NA
VED27290.1|2632265_2632739_+	Uncharacterised protein	NA	A0A077K9U2	Edwardsiella_phage	38.1	1.3e-13
VED27292.1|2632783_2633236_-	phage protein	NA	NA	NA	NA	NA
VED27294.1|2633232_2633805_-	phage protein	NA	NA	NA	NA	NA
VED27295.1|2634115_2634814_-	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	54.4	9.1e-67
VED27297.1|2634864_2635617_-|tail	putative tail component of prophage CP-933X	tail	G0ZNE6	Cronobacter_phage	44.9	1.6e-45
VED27299.1|2635685_2636075_-	Uncharacterised protein	NA	G0ZNE4	Cronobacter_phage	56.2	3.8e-38
VED27301.1|2636071_2636512_-	Uncharacterised protein	NA	A0A1V0E5P5	Salmonella_phage	52.5	2.6e-35
VED27303.1|2636514_2636862_-	Uncharacterised protein	NA	G0ZNE2	Cronobacter_phage	66.1	4.1e-36
VED27305.1|2637034_2637415_-	Uncharacterised protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
VED27307.1|2637417_2637783_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27309.1|2637792_2638890_-	Uncharacterised protein	NA	F1C5E1	Cronobacter_phage	77.7	1.0e-160
VED27311.1|2638900_2639335_-	Uncharacterised protein	NA	F1C5E0	Cronobacter_phage	72.2	3.1e-49
VED27313.1|2639338_2640727_-	Uncharacterised protein	NA	F1C5D9	Cronobacter_phage	58.8	1.2e-150
VED27315.1|2640796_2641312_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27317.1|2641351_2642251_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	7.5e-114
VED27319.1|2642282_2643758_-	Protein of uncharacterised function (DUF1073)	NA	F1C5D7	Cronobacter_phage	61.4	1.5e-156
VED27321.1|2643768_2645331_-	Terminase-like family	NA	G8C7P3	Escherichia_phage	92.7	1.3e-302
VED27323.1|2645327_2645978_-	Uncharacterised protein	NA	G8C7P2	Escherichia_phage	99.1	1.2e-113
VED27324.1|2645981_2646200_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27326.1|2646277_2646859_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27328.1|2646927_2647389_-|lysis	Rz lysis protein	lysis	M9NYX9	Enterobacteria_phage	78.4	2.5e-57
VED27330.1|2647385_2647880_-	lysozyme-like protein	NA	M9P0E5	Enterobacteria_phage	97.6	4.1e-90
VED27332.1|2647857_2648082_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	95.9	2.1e-33
VED27334.1|2648429_2648930_-	antitermination protein	NA	G8C7V7	Escherichia_phage	88.4	5.9e-84
VED27336.1|2648926_2649043_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27338.1|2649042_2649255_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27340.1|2649251_2649884_-	structure-specific endonuclease	NA	S4TSR3	Salmonella_phage	53.3	4.7e-54
VED27342.1|2649876_2650545_-	serine/threonine-protein phosphatase	NA	K7P6H8	Enterobacteria_phage	95.0	7.0e-125
VED27344.1|2650541_2650712_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	92.9	1.8e-21
VED27346.1|2650711_2651167_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
VED27347.1|2651379_2651661_-	ea8.5	NA	A0A0K2FIU9	Enterobacteria_phage	50.5	1.2e-20
VED27348.1|2651927_2652143_-	Uncharacterised protein	NA	K7PKY3	Enterobacterial_phage	78.6	1.4e-26
VED27350.1|2652139_2652439_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	68.5	1.0e-30
VED27352.1|2652435_2653140_-	phage protein	NA	A0A0A6Z584	Enterobacter_phage	55.0	1.7e-20
VED27354.1|2653136_2653784_-	Uncharacterised protein	NA	Q1MVG0	Enterobacteria_phage	79.8	2.7e-105
VED27356.1|2653780_2654215_-	Uncharacterised protein	NA	A0A0F6N6A6	Escherichia_phage	42.0	4.1e-09
VED27358.1|2654211_2654511_-	Ren protein from phage origin	NA	M1FPD5	Enterobacteria_phage	52.6	1.8e-16
VED27360.1|2654510_2655944_-	P protein; replicative DNA helicase	NA	Q716D2	Shigella_phage	86.7	2.4e-231
VED27362.1|2655933_2656833_-	replication protein O	NA	K7P7U6	Enterobacteria_phage	54.5	2.7e-79
VED27364.1|2656825_2656972_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED27366.1|2657061_2657604_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	91.7	1.5e-88
VED27368.1|2657621_2657855_-	antirepressor protein Cro	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
VED27370.1|2657896_2658649_+	Repressor protein CII	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
VED27372.1|2659004_2659346_+	Uncharacterised protein	NA	G8C7T6	Escherichia_phage	93.8	6.2e-53
VED27374.1|2659989_2660187_+	phage protein	NA	NA	NA	NA	NA
VED27376.1|2660257_2661229_+	phage-like protein	NA	M9P0E1	Enterobacteria_phage	98.8	9.3e-86
VED27378.1|2661236_2661521_+	Uncharacterised protein	NA	G8C7T1	Escherichia_phage	93.6	3.8e-48
VED27380.1|2661539_2662286_+	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
VED27382.1|2662282_2662900_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	58.8	1.1e-60
VED27384.1|2663005_2663248_+	Uncharacterised protein	NA	M9P0E0	Enterobacteria_phage	100.0	4.0e-38
VED27386.1|2663483_2664677_-|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2664864:2664880	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 14
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	2861823	2868078	4742976	transposase	Shigella_phage(33.33%)	9	NA	NA
VED27781.1|2861823_2862201_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED27783.1|2862245_2862521_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED27785.1|2863019_2864378_+	putative diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
VED27787.1|2864418_2865285_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VED27789.1|2865281_2865581_-|transposase	transposase	transposase	NA	NA	NA	NA
VED27791.1|2865666_2865990_+	(acyl-carrier-protein) S-malonyltransferase-like protein	NA	NA	NA	NA	NA
VED27792.1|2865986_2866973_+	inner membrane protein	NA	NA	NA	NA	NA
VED27794.1|2867380_2867656_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED27796.1|2867700_2868078_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 15
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	3153927	3203944	4742976	head,terminase,portal,tRNA,tail,integrase,lysis,coat,capsid	Enterobacteria_phage(57.14%)	70	3177549:3177564	3205652:3205667
VED28263.1|3153927_3154143_-	Transposase IS3/IS911 family protein	NA	U5P4I9	Shigella_phage	88.5	1.4e-18
VED28265.1|3154305_3154659_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.0	2.4e-39
VED28267.1|3154700_3155444_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VED28269.1|3156879_3157584_-	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
VED28271.1|3157593_3157875_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
VED28273.1|3157871_3160244_-|tail	putative side tail fiber protein from prophage	tail	A0A0E3M0V5	Enterobacteria_phage	47.7	6.4e-104
VED28275.1|3160308_3160908_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.0	1.9e-105
VED28277.1|3160975_3164455_-	Host specificity protein J of prophage	NA	A5LH43	Enterobacteria_phage	89.9	0.0e+00
VED28279.1|3164515_3165058_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	84.1	3.7e-76
VED28281.1|3165054_3165798_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	94.3	2.0e-144
VED28283.1|3165803_3166001_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	100.0	2.2e-34
VED28285.1|3165960_3166503_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.6	1.2e-87
VED28287.1|3166502_3166832_-|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	95.4	6.4e-55
VED28289.1|3166828_3169408_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.6	0.0e+00
VED28291.1|3169581_3169836_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	2.4e-41
VED28293.1|3169817_3170240_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	2.5e-72
VED28295.1|3170255_3170996_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	4.1e-126
VED28297.1|3171003_3171399_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED28299.1|3171395_3171974_-|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
VED28301.1|3171985_3172339_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	1.7e-61
VED28303.1|3172350_3172749_-	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	81.8	3.2e-48
VED28305.1|3172790_3173087_-|head	major head protein	head	C6ZCY2	Enterobacteria_phage	100.0	1.5e-50
VED28307.1|3173091_3173817_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.1	8.1e-127
VED28309.1|3173872_3174205_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
VED28311.1|3174214_3175534_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
VED28313.1|3175514_3177116_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.1	5.5e-309
VED28315.1|3177112_3177319_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED28317.1|3177315_3178788_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	97.9	2.0e-289
3177549:3177564	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
VED28319.1|3178735_3179242_-|terminase	phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.8	1.1e-93
VED28321.1|3179216_3179762_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VED28323.1|3180442_3180853_+	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	80.0	1.1e-56
VED28325.1|3180898_3181063_+|tRNA	Arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED28327.1|3181531_3182020_-	T5orf172 domain	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
VED28329.1|3182225_3182684_-	Putative endopeptidase	NA	K7PJW6	Enterobacteria_phage	94.1	1.5e-70
VED28331.1|3182680_3183214_-	prophage lysozyme (endolysin)	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
VED28333.1|3183319_3183592_+	ybl58	NA	NA	NA	NA	NA
VED28335.1|3183557_3183902_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
VED28337.1|3183906_3184122_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	97.2	1.3e-32
VED28339.1|3184711_3185794_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
VED28341.1|3185982_3186366_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
VED28343.1|3186451_3186589_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	2.4e-08
VED28345.1|3186588_3186951_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VED28347.1|3187157_3187499_-	putative protein ninx	NA	Q76H72	Enterobacteria_phage	95.6	1.8e-60
VED28349.1|3187674_3188202_-	DNA N-6-adenine-methyltransferase of bacteriophage	NA	A0A1I9LJP9	Stx_converting_phage	98.9	1.8e-99
VED28351.1|3188198_3188639_-	recombination protein ninB from phage origin	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
VED28353.1|3188712_3189003_-	putative exclusion protein Ren of prophage	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
VED28355.1|3188999_3189701_-	replication protein P of bacteriophage	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
VED28357.1|3189697_3190597_-	replication protein from bacteriophage origin	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	9.3e-173
VED28359.1|3192381_3192597_-	repressor protein	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
VED28361.1|3192714_3193368_+	Repressor protein CI from phage origin	NA	A0A0N7BTS4	Escherichia_phage	100.0	6.2e-126
VED28363.1|3193414_3193957_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED28365.1|3193944_3194721_+	Domain of uncharacterised function DUF1828	NA	NA	NA	NA	NA
VED28367.1|3195158_3195431_+	putative transcription antitermination protein N of prophage	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
VED28369.1|3195447_3196029_-	putative superinfection exclusion protein B of prophage	NA	K7P6T7	Enterobacteria_phage	98.4	1.1e-97
VED28371.1|3196242_3196443_+	restriction alleviation protein	NA	A0A088CQ62	Enterobacteria_phage	98.5	1.2e-32
VED28373.1|3196625_3196994_+	putative single-stranded DNA binding protein of prophage	NA	M1FPD2	Enterobacteria_phage	98.4	1.3e-64
VED28375.1|3197199_3197343_+	Kil protein of bacteriphage BP-933W	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
VED28377.1|3197418_3197715_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
VED28379.1|3197720_3198506_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VED28381.1|3198502_3199183_+	exonuclease	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	1.8e-131
VED28383.1|3199179_3199362_+	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
VED28385.1|3199334_3199526_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	2.8e-26
VED28387.1|3199536_3199818_+	ybl17	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
VED28389.1|3199916_3200138_+	putative C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
VED28391.1|3200134_3200386_+	putative bacteriophage protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	1.3e-31
VED28393.1|3200684_3201299_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED28394.1|3201592_3201712_+	phage protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	79.5	8.0e-08
VED28396.1|3201959_3202388_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED28398.1|3202470_3202638_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
VED28400.1|3202873_3203944_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	3.3e-201
3205652:3205667	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 16
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	3668636	3729981	4742976	transposase,holin	Streptococcus_phage(18.18%)	58	NA	NA
VED29188.1|3668636_3670670_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
VED29190.1|3670798_3671386_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VED29192.1|3671399_3672872_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VED29194.1|3672885_3674556_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
VED29196.1|3674768_3675437_+	inner membrane protein	NA	NA	NA	NA	NA
VED29198.1|3675679_3676375_-	transporter	NA	NA	NA	NA	NA
VED29200.1|3676367_3677795_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VED29202.1|3677805_3678525_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VED29204.1|3679051_3679906_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VED29206.1|3680131_3681457_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
VED29208.1|3681813_3682407_+	inner membrane protein	NA	NA	NA	NA	NA
VED29210.1|3682997_3683849_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VED29212.1|3683805_3683964_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29214.1|3683988_3688245_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VED29215.1|3689006_3689384_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED29217.1|3689428_3689704_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED29219.1|3690136_3690238_+	small predicted membrane protein	NA	NA	NA	NA	NA
VED29221.1|3690597_3690864_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VED29223.1|3690863_3691004_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VED29225.1|3692089_3692632_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VED29227.1|3692706_3693294_+	fimbrillin	NA	NA	NA	NA	NA
VED29229.1|3693351_3694020_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED29231.1|3694045_3696571_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED29233.1|3696560_3698204_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED29235.1|3698172_3698883_+	putative fimbrial protein	NA	NA	NA	NA	NA
VED29237.1|3699772_3700387_-	integral membrane protein	NA	NA	NA	NA	NA
VED29239.1|3700804_3701494_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VED29240.1|3701490_3702447_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VED29241.1|3702443_3704642_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	2.5e-38
VED29243.1|3704651_3705608_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VED29245.1|3705586_3705997_+	transcriptional regulator	NA	NA	NA	NA	NA
VED29247.1|3706313_3707567_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
VED29249.1|3707578_3708682_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VED29251.1|3708969_3710025_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
VED29253.1|3710063_3710465_-	sigma factor-binding protein crl (curlin genes transcriptional activator)	NA	NA	NA	NA	NA
VED29255.1|3710522_3711767_-	esterase	NA	NA	NA	NA	NA
VED29257.1|3711858_3712317_-	xanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
VED29259.1|3712577_3714035_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
VED29261.1|3714091_3714592_-	peptide chain release factor H	NA	NA	NA	NA	NA
VED29263.1|3714560_3714827_-	ykfJ	NA	NA	NA	NA	NA
VED29265.1|3715060_3715435_-	putative acetyltransferase	NA	NA	NA	NA	NA
VED29267.1|3715522_3715921_-	toxin YafO	NA	NA	NA	NA	NA
VED29269.1|3715923_3716217_-	antitoxin of the YafO-YafN toxin-antitoxin system	NA	NA	NA	NA	NA
VED29271.1|3716268_3717324_-	DNA polymerase IV	NA	NA	NA	NA	NA
VED29273.1|3717394_3718030_-	Chemotaxis protein MotB	NA	NA	NA	NA	NA
VED29275.1|3718124_3719864_+	flagellar system protein	NA	NA	NA	NA	NA
VED29277.1|3720087_3720585_-|transposase	RAYT REP element-mobilizing transposase; TnpA(REP)	transposase	NA	NA	NA	NA
VED29279.1|3720760_3721387_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	38.5	7.5e-20
VED29281.1|3721719_3721980_+	antitoxin of YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED29283.1|3721982_3722261_+	toxin of the YafQ-DinJ toxin-antitoxin system	NA	NA	NA	NA	NA
VED29285.1|3722416_3723157_+	membrane protein	NA	NA	NA	NA	NA
VED29287.1|3723127_3723895_-	amidotransferase	NA	NA	NA	NA	NA
VED29289.1|3724100_3724679_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
VED29291.1|3724918_3727363_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VED29293.1|3727405_3727852_-	inhibitor of vertebrate lysozyme precursor	NA	NA	NA	NA	NA
VED29295.1|3728032_3728803_+	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VED29296.1|3728843_3729701_-	H repeat-associated protein	NA	NA	NA	NA	NA
VED29298.1|3729792_3729981_-|transposase	transposase IS4 family protein	transposase	NA	NA	NA	NA
>prophage 17
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	3971769	3985815	4742976	tRNA,transposase	Escherichia_phage(25.0%)	13	NA	NA
VED29685.1|3971769_3974586_-|tRNA	isoleucyl-tRNA synthetase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
VED29687.1|3974628_3975570_-	riboflavin biosynthesis protein [includes: riboflavin kinase; FMN adenylyltransferase]	NA	NA	NA	NA	NA
VED29689.1|3975898_3976162_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
VED29691.1|3976468_3976744_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED29693.1|3976788_3977166_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED29694.1|3977356_3978256_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
VED29696.1|3978321_3979488_-	Na(+)/H(+) antiporter 1	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
VED29698.1|3980303_3981416_+|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VED29700.1|3981438_3981579_+|transposase	transposase	transposase	NA	NA	NA	NA
VED29702.1|3981678_3982809_-	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
VED29704.1|3982897_3984814_-	chaperone protein DnaK (Heat shock protein 70) (Heat shock 70 kDaprotein) (HSP70)	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
VED29706.1|3985117_3985393_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED29708.1|3985437_3985815_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 18
LR134240	Escherichia coli strain NCTC9107 genome assembly, chromosome: 1	4742976	4043696	4137583	4742976	integrase,tRNA,transposase	Escherichia_phage(14.81%)	98	4038442:4038457	4131293:4131308
4038442:4038457	attL	AAAAACTGGCGCGCAG	NA	NA	NA	NA
VED29810.1|4043696_4043972_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED29811.1|4044016_4044394_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED29814.1|4044460_4045375_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VED29816.1|4045589_4046951_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED29818.1|4046999_4048655_-	methyl-accepting chemotaxis protein I	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
VED29820.1|4049031_4051182_+	putative carbon starvation protein	NA	NA	NA	NA	NA
VED29822.1|4051231_4051435_+	YjiX protein	NA	NA	NA	NA	NA
VED29824.1|4051445_4052402_+	GTP-binding protein YjiA	NA	NA	NA	NA	NA
VED29826.1|4052435_4052738_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED29828.1|4052724_4053012_-	Protein of uncharacterised function (DUF497)	NA	NA	NA	NA	NA
VED29830.1|4053210_4053420_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED29832.1|4054220_4055453_+	multidrug resistance protein	NA	NA	NA	NA	NA
VED29834.1|4055493_4056774_+	inner membrane protein	NA	NA	NA	NA	NA
VED29837.1|4056889_4058041_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VED29839.1|4058050_4058818_+	ATPase, activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VED29841.1|4058814_4059072_+	Protein of uncharacterised function (DUF3343)	NA	NA	NA	NA	NA
VED29843.1|4059025_4059997_+	SdiA-regulated domain protein	NA	NA	NA	NA	NA
VED29844.1|4060064_4061243_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED29846.1|4061255_4061810_-	RNA 2'-phosphotransferase-like protein	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
VED29848.1|4062059_4062743_+	putative transporter	NA	NA	NA	NA	NA
VED29850.1|4062739_4063201_+	putative transporter	NA	NA	NA	NA	NA
VED29852.1|4063213_4064386_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
VED29854.1|4064450_4065362_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VED29856.1|4065354_4065747_-	DNA replication/recombination/repair protein	NA	NA	NA	NA	NA
VED29858.1|4066530_4067109_+	Protein of uncharacterised function (DUF2686)	NA	NA	NA	NA	NA
VED29860.1|4067346_4068072_-	uxu operon transcriptional regulator	NA	NA	NA	NA	NA
VED29862.1|4068118_4068313_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29864.1|4068334_4069795_-	D-mannonate oxidoreductase, NAD-binding	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
VED29866.1|4069875_4071060_-	mannonate dehydratase	NA	NA	NA	NA	NA
VED29868.1|4071399_4072743_+	high-affinity gluconate transporter	NA	NA	NA	NA	NA
VED29870.1|4072763_4072898_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29872.1|4073141_4073417_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.7e-45
VED29874.1|4073461_4073839_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED29876.1|4075044_4075761_+	N-acetylneuraminic acid outer membrane porin	NA	NA	NA	NA	NA
VED29878.1|4075780_4076887_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VED29880.1|4076951_4077932_+	YjhS protein	NA	H6WZJ9	Escherichia_phage	56.3	3.6e-101
VED29882.1|4078421_4078580_+	putative restriction endonuclease	NA	NA	NA	NA	NA
VED29884.1|4078892_4079195_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29885.1|4079241_4081260_-	putative restriction enzyme	NA	NA	NA	NA	NA
VED29887.1|4081198_4081660_-	putative restriction enzyme	NA	NA	NA	NA	NA
VED29890.1|4081604_4082624_-	putative restriction enzyme	NA	NA	NA	NA	NA
VED29891.1|4082626_4083022_-	putative DNA modification methylase	NA	NA	NA	NA	NA
VED29893.1|4083029_4085732_-	putative DNA modification methylase	NA	Q1MVP0	Enterobacteria_phage	27.3	4.8e-23
VED29895.1|4085752_4088644_-	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.8	2.3e-289
VED29897.1|4088907_4089066_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29899.1|4089295_4089451_-	putative restriction methylase	NA	NA	NA	NA	NA
VED29901.1|4089553_4089730_-	Aec78	NA	NA	NA	NA	NA
VED29903.1|4090202_4090568_+|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	2.1e-59
VED29905.1|4090525_4091215_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	8.5e-126
VED29907.1|4091356_4091575_-	aec77	NA	NA	NA	NA	NA
VED29909.1|4091571_4091946_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VED29911.1|4092035_4092404_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VED29913.1|4092453_4092567_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED29915.1|4092566_4092788_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
VED29917.1|4092850_4093327_-	putative DNA repair protein	NA	NA	NA	NA	NA
VED29919.1|4093342_4093825_-	anti-restriction protein	NA	A9J566	Pseudomonas_phage	32.6	6.8e-13
VED29921.1|4093916_4094735_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.7	2.7e-46
VED29923.1|4094889_4095048_-	putative plasmid-like protein	NA	NA	NA	NA	NA
VED29925.1|4095242_4095989_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VED29927.1|4096003_4097545_-|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VED29929.1|4097659_4098844_-	adhesin	NA	NA	NA	NA	NA
VED29931.1|4098795_4100556_-	antigen 43, truncation	NA	NA	NA	NA	NA
VED29933.1|4100925_4101543_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VED29935.1|4101560_4101797_-	putative GTPase	NA	NA	NA	NA	NA
VED29938.1|4101881_4102799_-	ybl124	NA	NA	NA	NA	NA
VED29940.1|4103355_4103517_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29942.1|4104000_4104603_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED29944.1|4104697_4104904_-	putative regulatory protein	NA	NA	NA	NA	NA
VED29946.1|4105044_4105311_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29948.1|4106030_4106231_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED29950.1|4106430_4107000_+	malate transporter	NA	NA	NA	NA	NA
VED29952.1|4107259_4107661_+	ybl85	NA	NA	NA	NA	NA
VED29954.1|4107648_4108083_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VED29956.1|4108082_4108319_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED29958.1|4108437_4108818_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
VED29960.1|4108814_4109162_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VED29962.1|4109211_4110597_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.9	1.4e-257
VED29964.1|4110835_4112194_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED29966.1|4112926_4113184_-	Biofilm development protein YmgB/AriR	NA	NA	NA	NA	NA
VED29968.1|4113944_4114154_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VED29970.1|4114154_4114448_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	87.9	7.2e-42
VED29972.1|4114933_4115455_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VED29973.1|4115451_4116405_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED29975.1|4116491_4118816_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VED29976.1|4118860_4119763_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VED29978.1|4119759_4120758_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED29979.1|4120754_4121711_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VED29981.1|4121868_4122480_+	Iron(III) dicitrate transport ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.6e-05
VED29983.1|4123037_4123295_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED29985.1|4123702_4124779_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VED29987.1|4124996_4125404_-|integrase	putative integrase	integrase	Q716C2	Shigella_phage	96.6	1.3e-65
VED29989.1|4127419_4128439_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.1e-44
VED29991.1|4128568_4130071_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.3	7.4e-82
VED29993.1|4130189_4131272_-	putative permease	NA	NA	NA	NA	NA
VED29995.1|4131284_4132373_-	putative permease	NA	NA	NA	NA	NA
4131293:4131308	attR	AAAAACTGGCGCGCAG	NA	NA	NA	NA
VED29997.1|4132639_4134151_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VED29999.1|4134245_4134728_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VED30001.1|4134727_4137583_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	4.6e-141
