The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	71416	81810	5297958	integrase	Enterobacteria_phage(100.0%)	12	70916:70941	81971:81996
70916:70941	attL	TTTGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
VED31920.1|71416_73750_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
VED31922.1|73764_74085_-	P4 phage protein	NA	NA	NA	NA	NA
VED31925.1|74220_74676_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
VED31927.1|74668_74956_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED31929.1|75535_75802_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VED31931.1|76354_77089_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
VED31934.1|77085_77331_+	putative prophage regulatory protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
VED31936.1|77354_77918_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
VED31938.1|78121_79048_-	putative prophage protein	NA	NA	NA	NA	NA
VED31940.1|79056_80493_-	putative prophage ATP/GTP binding protein	NA	NA	NA	NA	NA
VED31941.1|80536_80632_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED31943.1|80628_81810_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	92.7	4.3e-210
81971:81996	attR	TTTGGCGGAAGATCACAGGAGTCGAA	NA	NA	NA	NA
>prophage 2
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	709009	718493	5297958		Caulobacter_phage(33.33%)	11	NA	NA
VED33398.1|709009_710530_+	aerotaxis receptor protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
VED33400.1|710634_711258_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VED33402.1|711534_712299_+	siderophore-interacting protein	NA	NA	NA	NA	NA
VED33404.1|712552_713059_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
VED33406.1|713137_714946_-	RNA polymerase	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.2e-35
VED33408.1|715174_715360_-	DNA primase	NA	NA	NA	NA	NA
VED33410.1|715425_716361_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.3e-39
VED33412.1|716411_716918_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.7	2.5e-26
VED33414.1|717028_717244_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
VED33416.1|717582_717906_+	O-sialoglycoprotein endopeptidase	NA	A0A0R6PI74	Moraxella_phage	66.7	3.4e-32
VED33418.1|717911_718493_+	O-sialoglycoprotein endopeptidase	NA	A0A0R6PI74	Moraxella_phage	55.5	9.9e-51
>prophage 3
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	869794	890424	5297958	transposase	Acinetobacter_phage(60.0%)	23	NA	NA
VED33749.1|869794_870613_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VED33751.1|870752_871904_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	36.6	3.4e-42
VED33753.1|871823_872174_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
VED33755.1|872581_873034_+	putative transferase	NA	NA	NA	NA	NA
VED33757.1|873590_874310_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VED33759.1|875801_876035_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VED33761.1|875985_876306_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VED33763.1|876563_877139_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED33765.1|877785_878007_-	PapI protein	NA	NA	NA	NA	NA
VED33767.1|878990_879542_+	major pilin subunit PapA	NA	NA	NA	NA	NA
VED33769.1|879604_880192_+	minor pilin protein PapH	NA	NA	NA	NA	NA
VED33771.1|880241_882761_+	PapC protein	NA	NA	NA	NA	NA
VED33773.1|882848_883568_+	chaperone protein PapD	NA	NA	NA	NA	NA
VED33775.1|883604_884186_+	protein PapJ	NA	NA	NA	NA	NA
VED33777.1|884195_884732_+	PapK protein	NA	NA	NA	NA	NA
VED33779.1|884758_885286_+	Fimbrial protein	NA	NA	NA	NA	NA
VED33781.1|885360_885861_+	minor pilin subunit PapF	NA	NA	NA	NA	NA
VED33783.1|885904_886915_+	protein PapG	NA	NA	NA	NA	NA
VED33785.1|887228_887729_+	PapX protein	NA	NA	NA	NA	NA
VED33787.1|888043_888394_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
VED33789.1|888313_889465_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VED33791.1|889604_890132_+	IS600 orfB family protein	NA	A0A0P0I4A4	Acinetobacter_phage	41.1	2.7e-31
VED33793.1|890199_890424_+|transposase	ISSd1, transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	50.0	7.5e-15
>prophage 4
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	1619850	1632771	5297958		Escherichia_phage(83.33%)	6	NA	NA
VED34609.1|1619850_1620420_-	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
VED34610.1|1621168_1621798_+	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	99.0	4.1e-119
VED34611.1|1622111_1622735_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	2.8e-115
VED34612.1|1622759_1630673_+	outer membrane autotransporter domain protein	NA	A0A2L1IV38	Escherichia_phage	95.1	0.0e+00
VED34613.1|1630732_1631251_+	putative outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	96.5	1.1e-82
VED34614.1|1631838_1632771_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
>prophage 5
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	1813291	1820638	5297958		Vibrio_phage(28.57%)	10	NA	NA
VED34797.1|1813291_1814299_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
VED34798.1|1814437_1814722_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
VED34799.1|1814982_1815402_-	putative helicase	NA	Q5G7M7	Listonella_phage	36.4	8.0e-10
VED34800.1|1815398_1816103_-	putative helicase	NA	M4Q3N1	Vibrio_phage	46.9	3.6e-47
VED34801.1|1816086_1816608_-	putative helicase	NA	A0A0E3M4B4	Enterobacteria_phage	43.5	3.0e-30
VED34802.1|1816757_1817453_+	16S rRNA pseudouridylate synthase A	NA	NA	NA	NA	NA
VED34803.1|1817480_1818671_+	bicyclomycin resistance protein	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
VED34804.1|1819004_1819349_+	protein	NA	NA	NA	NA	NA
VED34805.1|1819352_1820240_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-18
VED34806.1|1820224_1820638_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	5.1e-09
>prophage 6
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	1880367	1889811	5297958		Enterobacteria_phage(85.71%)	10	NA	NA
VED34866.1|1880367_1881294_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
VED34867.1|1881298_1882030_+	ABC transporter permease	NA	NA	NA	NA	NA
VED34868.1|1882010_1882118_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED34869.1|1882177_1882909_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
VED34870.1|1883130_1884816_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VED34871.1|1884812_1885532_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED34872.1|1885578_1886049_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VED34873.1|1886090_1886552_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VED34874.1|1886676_1888524_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
VED34875.1|1888674_1889811_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	98.0	5.9e-164
>prophage 7
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2088699	2138994	5297958	lysis,capsid,terminase,tail,integrase,head	Escherichia_phage(52.63%)	76	2070500:2070516	2100561:2100577
2070500:2070516	attL	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
VED35054.1|2088699_2089743_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.9	5.6e-44
VED35055.1|2090299_2091097_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VED35056.1|2091332_2091977_-|integrase	site-specific recombinase, phage integrase family	integrase	A0A192Y7M7	Salmonella_phage	62.1	4.6e-65
VED35057.1|2092126_2092360_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
VED35058.1|2092359_2092563_-	putative prophage protein	NA	NA	NA	NA	NA
VED35059.1|2092621_2095093_-	exonuclease from phage origin	NA	K7PLW7	Enterobacteria_phage	59.8	2.5e-58
VED35060.1|2095375_2095564_-	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VED35061.1|2095963_2096128_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED35062.1|2096131_2096350_-	putative prophage protein	NA	NA	NA	NA	NA
VED35063.1|2096379_2096508_-	putative prophage protein	NA	NA	NA	NA	NA
VED35064.1|2096559_2096667_-	putative prophage protein	NA	NA	NA	NA	NA
VED35065.1|2096937_2097228_-	putative plasmid stabilization-like protein from prophage	NA	NA	NA	NA	NA
VED35066.1|2097437_2097647_-	regulator of the C1 family from prophage	NA	NA	NA	NA	NA
VED35067.1|2098046_2098322_+	putative regulator of the C1 family (possibly fragment)	NA	NA	NA	NA	NA
VED35068.1|2098305_2098731_+	putative prophage protein	NA	NA	NA	NA	NA
VED35069.1|2098753_2099665_+	putative prophage replication protein	NA	U5P0A0	Shigella_phage	53.4	2.6e-61
VED35070.1|2099711_2100467_+	putative replication protein	NA	A0A088CBP4	Shigella_phage	82.9	7.7e-112
VED35071.1|2100488_2101259_+	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.1e-80
2100561:2100577	attR	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
VED35072.1|2101274_2101697_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	75.5	3.5e-53
VED35073.1|2101754_2102111_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
VED35074.1|2102206_2102311_+	putative prophage protein	NA	A0A2R2Z308	Escherichia_phage	100.0	2.6e-07
VED35075.1|2102382_2102559_+	putative prophage protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
VED35076.1|2102583_2102730_+	putative prophage protein	NA	NA	NA	NA	NA
VED35077.1|2102921_2103362_+	putative prophage protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
VED35078.1|2103363_2103627_+	phage protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
VED35079.1|2103637_2103805_+	Eaa protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
VED35080.1|2103801_2104146_+	prophage protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
VED35081.1|2104697_2105051_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35082.1|2105112_2105412_-	plasmid stabilisation protein	NA	A0A2R2Z2Y1	Escherichia_phage	91.9	1.2e-47
VED35083.1|2105417_2105675_-	transcriptional regulator	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
VED35084.1|2106090_2107146_+	phage protein	NA	A0A291AWV9	Escherichia_phage	48.4	3.0e-90
VED35085.1|2107146_2107527_+	Holliday juction resolvase	NA	V5URS4	Shigella_phage	63.6	5.0e-35
VED35086.1|2107523_2108345_+	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	9.3e-79
VED35087.1|2108571_2108769_+	lipoprotein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
VED35088.1|2108919_2109405_+	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	97.5	5.7e-92
VED35089.1|2109482_2109968_+	DNA methylase	NA	S5MDR0	Escherichia_phage	93.8	1.3e-83
VED35090.1|2110688_2110895_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	76.4	3.0e-18
VED35091.1|2111171_2112584_+	phage protein	NA	Q08JA2	Stx2-converting_phage	86.3	8.1e-240
VED35092.1|2112700_2113012_+	phage protein YjhS encoded within prophage CP-933O	NA	Q08JA2	Stx2-converting_phage	100.0	2.4e-51
VED35093.1|2113162_2113543_+|lysis	putative lysis protein S	lysis	Q9ZWW2	Enterobacteria_phage	100.0	1.9e-26
VED35094.1|2113796_2114330_+	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	98.9	2.7e-103
VED35095.1|2114487_2114670_+	putative transmembrane protein	NA	NA	NA	NA	NA
VED35096.1|2114684_2114816_+	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
VED35097.1|2114827_2115286_+	endopeptidase of prophage CP-933N	NA	Q6H9V3	Enterobacteria_phage	86.1	3.1e-63
VED35098.1|2115720_2116269_+	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
VED35099.1|2116240_2118169_+|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	67.7	1.9e-263
VED35100.1|2118152_2118359_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VED35101.1|2118355_2119645_+|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.7	2.8e-146
VED35102.1|2119740_2119950_+|capsid	capsid protein of prophage	capsid	E4WL21	Enterobacteria_phage	55.6	3.6e-11
VED35103.1|2119939_2120164_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	58.8	2.3e-08
VED35104.1|2120121_2121444_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	54.6	4.8e-85
VED35105.1|2121480_2121828_+|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
VED35106.1|2121885_2122140_+|head	major head protein	head	NA	NA	NA	NA
VED35107.1|2122169_2122331_+|head	phage major head protein	head	A0A2I6TCE5	Escherichia_phage	70.3	1.0e-05
VED35108.1|2122285_2122525_+|head	phage major head protein	head	NA	NA	NA	NA
VED35109.1|2122748_2122922_+|head	phage major head protein	head	A0A2I6TCE5	Escherichia_phage	77.1	4.0e-08
VED35110.1|2122971_2123355_+	phage protein	NA	NA	NA	NA	NA
VED35111.1|2123347_2123590_+|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	NA	NA	NA	NA
VED35112.1|2123714_2124290_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
VED35113.1|2124286_2124682_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
VED35114.1|2124689_2125442_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
VED35115.1|2125455_2125887_+|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
VED35116.1|2125913_2126327_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VED35117.1|2126307_2128908_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.7	0.0e+00
VED35118.1|2128904_2129234_+|tail	minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
VED35119.1|2129233_2129932_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
VED35120.1|2129936_2130692_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.6	7.9e-141
VED35121.1|2130675_2131083_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.8e-44
VED35122.1|2131308_2131752_+|tail	putative phage tail component	tail	C6ZCZ5	Enterobacteria_phage	98.4	3.5e-64
VED35123.1|2131748_2133737_+|tail	tail component of prophage	tail	A0A291AWT4	Escherichia_phage	98.0	0.0e+00
VED35124.1|2133681_2134788_+|tail	tail protein (partial) of prophage CP-933X	tail	Q9EYE7	Enterobacteria_phage	98.1	4.6e-206
VED35125.1|2134855_2135455_+	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.5	1.0e-106
VED35126.1|2135604_2136543_+|tail	putative prophage side tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	88.5	5.3e-54
VED35127.1|2136556_2138002_+|tail	putative prophage side tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	55.0	3.4e-132
VED35128.1|2137998_2138280_+	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
VED35129.1|2138289_2138994_+	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	60.6	1.3e-57
>prophage 8
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2147161	2156006	5297958		Enterobacteria_phage(50.0%)	12	NA	NA
VED35140.1|2147161_2147782_-	Outer membrane protein N precursor	NA	Q1MVN1	Enterobacteria_phage	41.5	4.0e-34
VED35141.1|2147732_2147969_-	Outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	66.2	1.6e-23
VED35142.1|2148055_2148277_-	Outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	48.4	7.4e-07
VED35143.1|2148905_2149208_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VED35144.1|2149247_2149508_+	putative phosphohydrolase	NA	NA	NA	NA	NA
VED35145.1|2149515_2149944_+	putative phosphohydrolase	NA	NA	NA	NA	NA
VED35146.1|2150010_2151429_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.4e-101
VED35147.1|2151409_2151880_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	46.9	9.9e-33
VED35148.1|2151868_2152789_-	putative DMT superfamily transporter inner membrane protein	NA	NA	NA	NA	NA
VED35149.1|2152962_2153880_+	putative methyl-independent mismatch repair protein	NA	NA	NA	NA	NA
VED35150.1|2153958_2154141_+	putative small protein	NA	NA	NA	NA	NA
VED35151.1|2154311_2156006_+	cellulose synthesis regulatory protein (signal transduction protein)	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 9
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2191686	2228277	5297958	capsid,holin,terminase,portal,tail,plate	Enterobacteria_phage(81.4%)	49	NA	NA
VED35197.1|2191686_2191827_-	small toxic polypeptide	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
VED35198.1|2192018_2192279_-	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VED35199.1|2192321_2193431_-	Gene late control D protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	2.8e-203
VED35200.1|2193588_2194773_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	97.7	8.4e-222
VED35201.1|2194772_2195285_+|tail	Major tail tube protein FII	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
VED35202.1|2195339_2195705_+|tail	phage tail E family protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
VED35203.1|2195855_2196566_+|tail	tail fiber component of prophage CP-933T	tail	A0A0A7NRZ9	Enterobacteria_phage	99.1	4.1e-99
VED35204.1|2196615_2198664_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	88.3	0.0e+00
VED35205.1|2198676_2199165_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	4.7e-86
VED35206.1|2199191_2199791_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
VED35207.1|2200312_2200957_-|tail	tail fibre assembly protein	tail	M1SV83	Escherichia_phage	81.7	8.4e-75
VED35208.1|2200956_2202552_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	56.1	2.8e-140
VED35209.1|2202548_2203157_-	Tail protein I	NA	A0A0F7LA36	Escherichia_phage	74.9	2.6e-86
VED35210.1|2203149_2204046_-|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
VED35211.1|2204049_2204400_-|plate	Baseplate assembly protein W	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
VED35212.1|2204396_2204978_-|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
VED35213.1|2204974_2205619_-|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	99.5	5.4e-114
VED35214.1|2205602_2206070_-|tail	Phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	96.8	7.2e-84
VED35215.1|2206166_2207975_-	YjhS	NA	H6WZJ9	Escherichia_phage	80.6	2.2e-282
VED35216.1|2207971_2208520_-	Uncharacterised protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	1.3e-63
VED35217.1|2208516_2208909_-	putative phage PS3	NA	A0A0A7NQ86	Enterobacteria_phage	96.2	9.3e-69
VED35218.1|2208905_2209229_-|holin	putative phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	97.2	1.4e-49
VED35219.1|2209231_2209432_-	Tail protein X (GpX)	NA	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
VED35220.1|2209431_2209926_-	Head completion/stabilization protein L	NA	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
VED35221.1|2210029_2210830_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	7.9e-123
VED35222.1|2210875_2211928_-|capsid	Major capsid protein precursor (GpN)	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
VED35223.1|2211951_2212788_-	Capsid scaffolding protein O	NA	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
VED35224.1|2212942_2213080_+	Terminase, ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	100.0	2.9e-17
VED35225.1|2213048_2214695_+	Terminase, ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	97.8	5.8e-306
VED35226.1|2214694_2215741_+|capsid,portal	portal capsid protein Q (GpQ)	capsid,portal	A0A0A7NPT9	Enterobacteria_phage	99.1	4.8e-205
VED35227.1|2216432_2218130_-	Predicted ATP-binding protein involved in virulence	NA	NA	NA	NA	NA
VED35228.1|2218147_2218993_-	putative adenine-specific DNA methyltransferase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	2.8e-09
VED35229.1|2219178_2222004_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
VED35230.1|2222010_2222376_-	Uncharacterised protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
VED35231.1|2222448_2222679_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
VED35232.1|2223001_2223301_-	Uncharacterised protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
VED35233.1|2223297_2223564_-	Uncharacterized protein conserved in archaea	NA	A0A0A7NV47	Enterobacteria_phage	77.0	1.2e-30
VED35234.1|2223560_2223764_-	Uncharacterised protein	NA	A0A0A7NPS8	Enterobacteria_phage	79.1	7.2e-25
VED35235.1|2223787_2224204_-	Prophage protein	NA	NA	NA	NA	NA
VED35236.1|2224295_2224409_-	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
VED35237.1|2224405_2224648_-	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
VED35238.1|2224659_2224938_-	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
VED35239.1|2224948_2225299_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
VED35240.1|2225320_2225524_-	phage regulator DNA-binding protein)	NA	P79674	Haemophilus_phage	45.2	3.1e-07
VED35241.1|2225540_2225747_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35242.1|2225822_2226227_+	regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
VED35243.1|2226242_2226893_+	putative transmembrane protein	NA	NA	NA	NA	NA
VED35244.1|2226922_2227270_+	Protein of uncharacterised function (DUF2511)	NA	NA	NA	NA	NA
VED35245.1|2227275_2228277_+	Integrase	NA	Q94N03	Haemophilus_virus	58.5	4.2e-105
>prophage 10
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2550141	2616999	5297958	lysis,transposase,capsid,portal,terminase,tail,integrase,head,coat,protease	Enterobacteria_phage(42.0%)	83	2576279:2576294	2589939:2589954
VED35612.1|2550141_2550963_-|protease	putative protease	protease	NA	NA	NA	NA
VED35613.1|2551238_2551547_-	acid shock protein	NA	NA	NA	NA	NA
VED35614.1|2551970_2553224_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED35615.1|2553330_2554224_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED35616.1|2554358_2555579_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VED35617.1|2555703_2556399_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VED35618.1|2556351_2557608_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VED35619.1|2557801_2558416_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
VED35620.1|2558458_2559313_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VED35621.1|2559314_2559932_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.6e-75
VED35622.1|2559942_2562339_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	6.3e-208
VED35623.1|2562426_2564853_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
VED35624.1|2565051_2565357_-	protein	NA	NA	NA	NA	NA
VED35625.1|2565428_2566175_+	lipoprotein	NA	NA	NA	NA	NA
VED35626.1|2566174_2566423_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED35627.1|2566382_2566739_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VED35628.1|2566773_2567115_-	protein	NA	NA	NA	NA	NA
VED35629.1|2567249_2567576_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
VED35630.1|2567782_2568997_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VED35631.1|2569008_2570028_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
VED35632.1|2570085_2570196_+	protein, truncated	NA	NA	NA	NA	NA
VED35633.1|2570215_2571496_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VED35634.1|2571530_2571767_-	putative phage excisionase	NA	S4TND0	Salmonella_phage	49.3	2.3e-14
VED35635.1|2571854_2573045_-	Exonuclease RNase T and DNA polymerase III	NA	A0A192Y6E0	Salmonella_phage	56.1	2.0e-58
VED35636.1|2572999_2574328_-	putative exonuclease from phage origin	NA	NA	NA	NA	NA
VED35637.1|2574420_2574612_-	putative prophage protein	NA	NA	NA	NA	NA
VED35638.1|2574608_2574797_-	division inhibition protein	NA	NA	NA	NA	NA
VED35639.1|2575196_2575361_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED35640.1|2575364_2575583_-	putative prophage protein	NA	NA	NA	NA	NA
VED35641.1|2575612_2575741_-	putative prophage protein	NA	NA	NA	NA	NA
VED35642.1|2575742_2575898_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
2576279:2576294	attL	CATGTTGGTGAGCATT	NA	NA	NA	NA
VED35643.1|2576557_2576788_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VED35644.1|2576771_2577293_+	YdfX	NA	NA	NA	NA	NA
VED35645.1|2577273_2577822_+	ybl78	NA	H2DE83	Erwinia_phage	62.7	4.1e-30
VED35646.1|2578281_2578704_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VED35647.1|2578700_2579057_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
VED35648.1|2579666_2579777_+	putative prophage protein	NA	NA	NA	NA	NA
VED35649.1|2580208_2580388_+	membrane protein	NA	NA	NA	NA	NA
VED35650.1|2580722_2582036_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VED35651.1|2582472_2582664_-	Qin prophage protein	NA	NA	NA	NA	NA
VED35652.1|2582670_2582805_-	Qin prophage protein	NA	NA	NA	NA	NA
VED35653.1|2583365_2583578_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	45.6	1.2e-09
VED35654.1|2583577_2583865_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VED35655.1|2583936_2584092_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VED35656.1|2584308_2584560_+	putative prophage protein	NA	NA	NA	NA	NA
VED35657.1|2584906_2585956_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VED35658.1|2585969_2586722_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VED35659.1|2587144_2587357_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VED35660.1|2588474_2588594_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35661.1|2588635_2588842_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VED35662.1|2588846_2589158_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VED35663.1|2589154_2589703_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	94.3	1.5e-96
VED35664.1|2589769_2590024_+	putative Rz1-like lipoprotein, Qin prophage	NA	NA	NA	NA	NA
2589939:2589954	attR	AATGCTCACCAACATG	NA	NA	NA	NA
VED35665.1|2591321_2591495_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VED35666.1|2591646_2592057_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VED35667.1|2592735_2593188_+	DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	3.2e-49
VED35668.1|2593254_2595180_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VED35669.1|2595176_2595383_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED35670.1|2595379_2596981_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
VED35671.1|2596961_2598281_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
VED35672.1|2598290_2598623_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
VED35673.1|2598679_2599705_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
VED35674.1|2599746_2600145_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
VED35675.1|2600156_2600510_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
VED35676.1|2600521_2601100_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
VED35677.1|2601096_2601492_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VED35678.1|2601499_2602240_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
VED35679.1|2602255_2602678_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
VED35680.1|2602659_2603094_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VED35681.1|2603472_2605665_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.2	0.0e+00
VED35682.1|2605661_2605991_+|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VED35683.1|2605990_2606689_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
VED35684.1|2606839_2607439_+|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	100.0	3.8e-122
VED35685.1|2607435_2608008_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VED35686.1|2608068_2609139_+	Host specificity protein J	NA	C6ZCZ5	Enterobacteria_phage	96.9	6.0e-203
VED35687.1|2609144_2609870_+	Host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.3	1.4e-134
VED35688.1|2609838_2610348_+|tail	Putative tail component of prophage	tail	A0A291AWT4	Escherichia_phage	98.2	4.4e-87
VED35689.1|2610344_2610944_+	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	91.0	4.4e-78
VED35690.1|2611712_2612156_+	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	98.6	5.4e-81
VED35691.1|2612220_2615184_+|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
VED35692.1|2615183_2615417_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	98.7	6.6e-38
VED35693.1|2616040_2616448_-	putative DNA-invertase	NA	NA	NA	NA	NA
VED35694.1|2616765_2616999_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 11
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2780840	2854189	5297958	lysis,transposase,tRNA,terminase,tail,coat,integrase	Escherichia_phage(50.85%)	98	2780725:2780741	2853322:2853338
2780725:2780741	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
VED35865.1|2780840_2781116_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED35866.1|2781160_2781538_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED35867.1|2781472_2781703_-	membrane associated CTP-phosphosubstrate transferase	NA	A0A2L1IV26	Escherichia_phage	57.4	2.0e-07
VED35868.1|2781702_2782308_-	phosphatidylglycerophosphate synthase	NA	NA	NA	NA	NA
VED35869.1|2782478_2783168_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VED35870.1|2783253_2784780_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VED35871.1|2784843_2785704_-	putative oxidoreductase	NA	NA	NA	NA	NA
VED35872.1|2785935_2786526_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
VED35873.1|2786507_2786777_-	DNA-binding transcriptional repressor of phenylacetic acid degradation, aryl-CoA responsive	NA	NA	NA	NA	NA
VED35874.1|2786902_2787058_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35875.1|2787039_2787366_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED35876.1|2787373_2787559_-	lipoprotein	NA	NA	NA	NA	NA
VED35877.1|2787555_2789373_-	protein	NA	NA	NA	NA	NA
VED35878.1|2789369_2789576_-	protein	NA	NA	NA	NA	NA
VED35879.1|2789647_2789896_-	protein	NA	NA	NA	NA	NA
VED35880.1|2789922_2790198_-	protein	NA	NA	NA	NA	NA
VED35881.1|2790406_2790499_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
VED35882.1|2790585_2791398_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	45.4	1.9e-60
VED35883.1|2791508_2791931_+	heat-inducible protein	NA	NA	NA	NA	NA
VED35884.1|2791927_2792194_-	protein	NA	NA	NA	NA	NA
VED35885.1|2792467_2793241_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35886.1|2793197_2794028_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35887.1|2794123_2794780_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35888.1|2794776_2795499_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35889.1|2795444_2795606_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35890.1|2795614_2795992_+	pyruvate-flavodoxin oxidoreductase	NA	NA	NA	NA	NA
VED35891.1|2796357_2797491_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
VED35892.1|2797631_2798066_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
VED35893.1|2798651_2799188_+	iron/manganese transport system periplasmic binding protein SitA	NA	NA	NA	NA	NA
VED35894.1|2799135_2799567_+	iron/manganese transport system periplasmic binding protein SitA	NA	NA	NA	NA	NA
VED35895.1|2799566_2800394_+	iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
VED35896.1|2800390_2801227_+	iron ABC transporter permease	NA	NA	NA	NA	NA
VED35897.1|2801245_2801605_+	iron/manganese transport system membrane protein SitD	NA	NA	NA	NA	NA
VED35898.1|2801510_2801903_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35899.1|2802814_2803558_-|tail	L-shaped tail fiber protein	tail	A0A0E3M4A9	Enterobacteria_phage	75.1	9.3e-102
VED35900.1|2803887_2804127_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	54.9	3.0e-14
VED35901.1|2804512_2804791_-|tail	tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	1.5e-25
VED35902.1|2804745_2806503_-|tail	tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	68.8	3.2e-84
VED35903.1|2806567_2807167_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
VED35904.1|2807234_2808203_-	host specificity protein	NA	Q9EYE7	Enterobacteria_phage	72.0	1.8e-134
VED35905.1|2808447_2810631_-|tail	tail component of prophage	tail	A0A291AWT4	Escherichia_phage	98.8	0.0e+00
VED35906.1|2810691_2811156_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	97.4	2.1e-75
VED35907.1|2811236_2811836_-|tail	tail component	tail	A5LH41	Enterobacteria_phage	99.5	1.7e-122
VED35908.1|2811984_2812683_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
VED35909.1|2812682_2813021_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	50.9	1.1e-28
VED35910.1|2813013_2814510_-|tail	putative phage tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	34.1	3.5e-55
VED35911.1|2814652_2814901_-|tail	putative phage tail length tape measure protein	tail	A0A0U5KRL2	unidentified_phage	52.6	2.4e-14
VED35912.1|2815075_2816251_-|tail	putative phage tail length tape measure protein	tail	A0A1V1FCQ8	Vibrio_phage	50.8	5.0e-41
VED35913.1|2816721_2817171_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35914.1|2817231_2818194_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	3.4e-56
VED35915.1|2818220_2818613_-	phage protein	NA	A0A059VK45	Pseudomonas_phage	31.5	2.3e-11
VED35916.1|2818609_2818990_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
VED35917.1|2818990_2819377_-	Uncharacterised protein	NA	A0A0H5ARS2	Pseudomonas_phage	38.1	5.5e-13
VED35918.1|2819373_2819769_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35919.1|2819772_2819964_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35920.1|2820040_2821180_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	74.7	7.4e-159
VED35921.1|2821278_2822043_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
VED35922.1|2822147_2823263_-	phage protein	NA	I6PD76	Cronobacter_phage	53.8	5.1e-112
VED35923.1|2823243_2824650_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
VED35924.1|2824652_2825954_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
VED35925.1|2825934_2827029_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.9	2.0e-113
VED35926.1|2827032_2827242_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35927.1|2827219_2828152_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
VED35928.1|2828144_2828936_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	1.7e-48
VED35929.1|2829073_2829631_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VED35930.1|2829572_2830499_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VED35931.1|2830669_2831134_-|lysis	phage endopeptidase/lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	85.5	1.8e-63
VED35932.1|2831130_2831628_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	7.1e-90
VED35933.1|2831627_2831843_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VED35934.1|2833135_2833672_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
VED35935.1|2833668_2833959_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	2.8e-46
VED35936.1|2833958_2834558_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
VED35937.1|2835434_2836106_-	putative prophage protein	NA	NA	NA	NA	NA
VED35938.1|2836269_2836686_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	8.1e-63
VED35939.1|2836701_2837463_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
VED35940.1|2837485_2838232_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	76.4	1.1e-105
VED35941.1|2838377_2839097_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.8	1.3e-68
VED35942.1|2839109_2839532_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VED35943.1|2839528_2839783_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VED35944.1|2839862_2840537_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	6.8e-19
VED35945.1|2840569_2840704_+	ydaG	NA	NA	NA	NA	NA
VED35946.1|2840715_2840871_+	Rac prophage; predicted protein	NA	NA	NA	NA	NA
VED35947.1|2840883_2841480_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VED35948.1|2841788_2842010_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
VED35949.1|2842009_2842180_+	bacteriophage protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	1.1e-23
VED35950.1|2842206_2842530_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	94.5	6.8e-41
VED35951.1|2842631_2844350_+	putative phage exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	74.7	1.6e-213
VED35952.1|2844361_2844895_+	putative phage exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	100.0	5.6e-93
VED35953.1|2844891_2845620_+	putative phage exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	98.7	4.8e-127
VED35954.1|2845859_2846420_+	putative enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	100.0	5.4e-102
VED35955.1|2847010_2847199_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
VED35956.1|2847298_2847514_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	98.6	1.1e-36
VED35957.1|2847515_2848751_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	4.2e-240
VED35958.1|2848802_2849738_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
VED35959.1|2849933_2851241_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.4e-52
VED35960.1|2851270_2851444_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED35961.1|2851718_2852702_-	zinc transport protein	NA	NA	NA	NA	NA
VED35962.1|2852956_2854189_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2853322:2853338	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 12
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	2916457	2984218	5297958	lysis,capsid,terminase,tail,head,protease	Escherichia_phage(39.68%)	90	NA	NA
VED36029.1|2916457_2917507_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VED36030.1|2917726_2918485_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
VED36031.1|2918481_2919072_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VED36032.1|2919111_2919987_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VED36033.1|2920199_2920892_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED36034.1|2920914_2922102_-	putative inner membrane protein	NA	NA	NA	NA	NA
VED36035.1|2922129_2922750_-	putative RNA binding protein	NA	NA	NA	NA	NA
VED36036.1|2922746_2923628_-	putative phosphoesterase	NA	NA	NA	NA	NA
VED36037.1|2923901_2924159_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VED36038.1|2924330_2925014_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VED36039.1|2925090_2925465_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VED36040.1|2925464_2926106_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0P0IKJ1	Acinetobacter_phage	34.9	1.4e-26
VED36041.1|2926137_2927061_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	40.3	5.4e-51
VED36042.1|2927064_2928423_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
VED36043.1|2928434_2928701_+	tryptophan synthase	NA	NA	NA	NA	NA
VED36044.1|2928735_2929629_+	tryptophan synthase	NA	NA	NA	NA	NA
VED36045.1|2929628_2930435_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VED36046.1|2930815_2930995_+	protein	NA	NA	NA	NA	NA
VED36047.1|2931080_2931581_+	YciF protein	NA	NA	NA	NA	NA
VED36048.1|2931626_2932133_+	protein YciE	NA	NA	NA	NA	NA
VED36049.1|2932621_2932792_-|tail	tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
VED36050.1|2933232_2933901_+	methylase	NA	NA	NA	NA	NA
VED36051.1|2934539_2937554_-|tail	Side tail fiber protein from bacteriophage origin	tail	A0A0K2FIZ6	Escherichia_phage	55.2	5.9e-54
VED36052.1|2937705_2938305_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
VED36053.1|2938372_2939479_-|tail	tail protein (partial) of prophage CP-933X	tail	Q9EYE7	Enterobacteria_phage	99.7	2.2e-208
VED36054.1|2939685_2941851_-|tail	tail:host specificity protein	tail	K7PKJ2	Enterobacteria_phage	98.7	0.0e+00
VED36055.1|2941917_2942172_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED36056.1|2942328_2942565_-|tail	putative phage tail component	tail	A0A2R9YJH6	Escherichia_phage	95.9	9.3e-32
VED36057.1|2942590_2942770_-|tail	tail component of prophage CP-933K	tail	A0A291AWV5	Escherichia_phage	90.5	4.3e-13
VED36058.1|2942735_2943095_-|tail	tail component of prophage CP-933K	tail	A5LH42	Enterobacteria_phage	93.2	1.5e-33
VED36059.1|2943033_2943615_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	92.3	4.3e-102
VED36060.1|2944002_2944323_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.0	4.0e-54
VED36061.1|2944322_2944652_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VED36062.1|2944651_2947222_-|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	85.4	0.0e+00
VED36063.1|2947202_2947616_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VED36064.1|2947642_2948074_-|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
VED36065.1|2948087_2948840_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.6	1.8e-132
VED36066.1|2948847_2949243_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
VED36067.1|2949239_2949815_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
VED36068.1|2949830_2950184_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
VED36069.1|2950176_2950560_-	phage protein	NA	NA	NA	NA	NA
VED36070.1|2950611_2951640_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
VED36071.1|2951697_2952045_-|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
VED36072.1|2952081_2953587_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	53.3	4.6e-100
VED36073.1|2953576_2955169_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	60.9	1.4e-184
VED36074.1|2955165_2955372_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VED36075.1|2955355_2957284_-|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
VED36076.1|2957255_2957804_-	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
VED36077.1|2958482_2958893_+	phage protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
VED36078.1|2959200_2959665_-	murein endopeptidase; DLP12 prophage	NA	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
VED36079.1|2959666_2959804_-	phage protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
VED36080.1|2959963_2960497_-	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	93.8	1.2e-95
VED36081.1|2960590_2960869_-	bacteriophage protein	NA	K7PGU6	Enterobacteria_phage	100.0	4.2e-07
VED36082.1|2960873_2961089_-|lysis	putative lysis protein S	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
VED36083.1|2961239_2963093_-	phage protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
VED36084.1|2964367_2965417_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
VED36085.1|2965524_2965764_-	lipoprotein	NA	Q9MC00	Enterobacteria_phage	100.0	7.0e-19
VED36086.1|2965990_2966812_-	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
VED36087.1|2966808_2967183_-	Holliday juction resolvase	NA	V5URS4	Shigella_phage	62.7	1.1e-34
VED36088.1|2967195_2968242_-	putative prophage protein	NA	U5P0K4	Shigella_phage	54.8	8.5e-109
VED36089.1|2968243_2968516_-	putative prophage protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
VED36090.1|2968575_2968749_-	putative prophage protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
VED36091.1|2968905_2970009_-	putative phage DNA-binding protein	NA	NA	NA	NA	NA
VED36092.1|2969989_2970640_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED36093.1|2971252_2971597_-	prophage protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
VED36094.1|2971593_2971761_-	Eaa protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
VED36095.1|2971771_2972035_-	phage protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
VED36096.1|2972283_2972472_-	prophage protein	NA	A0A222YWK2	Escherichia_phage	94.8	6.5e-28
VED36097.1|2972472_2972832_-	putative prophage protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
VED36098.1|2972828_2973005_-	putative prophage protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
VED36099.1|2972997_2973180_-	putative prophage protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
VED36100.1|2973275_2973632_-	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
VED36101.1|2973609_2974071_-	phage protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
VED36102.1|2974067_2974364_-	phage protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
VED36103.1|2974360_2974753_-	putative phage regulatory protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
VED36104.1|2974768_2975539_-	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
VED36105.1|2975572_2975995_-	putative phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	2.8e-71
VED36106.1|2976026_2977067_-	putative phage replication protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
VED36107.1|2977138_2977564_-	phage regulatory protein	NA	NA	NA	NA	NA
VED36108.1|2977547_2977823_-	putative phage regulatory protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
VED36109.1|2977930_2978392_+	putative regulator of the C1 family from prophage	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
VED36110.1|2978645_2978801_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
VED36111.1|2978802_2978931_+	putative prophage protein	NA	NA	NA	NA	NA
VED36112.1|2978960_2979179_+	putative prophage protein	NA	NA	NA	NA	NA
VED36113.1|2979201_2979603_+	Uncharacterised protein	NA	I6PDF6	Cronobacter_phage	78.9	6.5e-09
VED36114.1|2979562_2979841_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED36115.1|2981278_2981467_+	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VED36116.1|2981463_2981667_+	phage protein	NA	NA	NA	NA	NA
VED36117.1|2981746_2982208_+	ExoO exonuclease VIII, ds DNA exonuclease encoded by prophage CP-933O	NA	NA	NA	NA	NA
VED36118.1|2982253_2984218_+	exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.0	6.3e-57
>prophage 13
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	3096260	3112501	5297958	protease,tRNA,capsid,portal,terminase,tail,head	uncultured_Caudovirales_phage(84.62%)	22	NA	NA
VED36232.1|3096260_3097367_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
VED36233.1|3097402_3098044_+	putative lysogenization regulator	NA	NA	NA	NA	NA
VED36234.1|3098047_3099283_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.9	3.2e-99
VED36235.1|3099233_3099419_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
VED36236.1|3099587_3100259_+	two-component response regulator	NA	NA	NA	NA	NA
VED36237.1|3100258_3101719_+	two-component sensor kinase	NA	NA	NA	NA	NA
VED36238.1|3102575_3102857_-	putative prophage protein	NA	NA	NA	NA	NA
VED36239.1|3102870_3103770_-|terminase	prophage terminase, large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	78.9	5.9e-143
VED36240.1|3103778_3104348_-|terminase	prophage terminase, large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	89.5	3.7e-74
VED36241.1|3104515_3104827_-|terminase	putative phage terminase, small subunit	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.4	1.1e-43
VED36242.1|3105759_3105900_-	DNA packaging protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	70.0	2.9e-09
VED36243.1|3105928_3106237_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	39.3	5.1e-06
VED36244.1|3106233_3106377_-|head,portal	putative head portal protein	head,portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.9	1.8e-09
VED36245.1|3106373_3106916_-|head,portal	putative head portal protein	head,portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	88.4	2.8e-79
VED36246.1|3106923_3107412_-|head,portal	putative head portal protein	head,portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	71.5	3.2e-58
VED36247.1|3107483_3108023_-|head,protease	putative head maturation protease of prophage	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.1	1.2e-55
VED36248.1|3108062_3108392_-|capsid,head	putative capsid protein of prophage (major head protein)	capsid,head	A0A2H4JED2	uncultured_Caudovirales_phage	75.2	1.3e-42
VED36249.1|3108384_3109221_-|capsid,head	putative capsid protein of prophage (major head protein)	capsid,head	A0A2H4JED2	uncultured_Caudovirales_phage	59.4	7.8e-81
VED36250.1|3109508_3109781_-	transcriptional activator	NA	NA	NA	NA	NA
VED36251.1|3109791_3110202_-	putative prophage single stranded DNA-binding protein	NA	NA	NA	NA	NA
VED36252.1|3110198_3110456_-	putative prophage protein	NA	NA	NA	NA	NA
VED36253.1|3110746_3112501_-	nucleic acid independent nucleoside triphosphatase; phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	4.1e-92
>prophage 14
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	3480243	3520654	5297958	lysis,capsid,portal,terminase,holin,tail,integrase,head,plate,protease	Enterobacteria_phage(38.46%)	69	3481850:3481865	3526027:3526042
VED36656.1|3480243_3480606_+	prophage-encoded bactoprenol-linked glucose translocase	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
VED36657.1|3480602_3481520_+	bactoprenol glucosyl transferase; CPS-53 (KpLE1) prophage	NA	I1TED8	Salmonella_phage	89.1	2.8e-156
VED36658.1|3481516_3482992_+	Uncharacterised protein	NA	NA	NA	NA	NA
3481850:3481865	attL	CCTGTTCTTTCTGTAT	NA	NA	NA	NA
VED36659.1|3483290_3483695_-|tail	putative phage tail fiber assembly protein	tail	U5P083	Shigella_phage	62.5	5.0e-17
VED36660.1|3483695_3484628_-|tail	putative phage tail protein	tail	U5P0I1	Shigella_phage	95.2	2.1e-50
VED36661.1|3484631_3485216_-|tail	putative phage tail protein	tail	O22003	Shigella_phage	99.5	5.4e-113
VED36662.1|3485206_3486265_-|plate	putative phage baseplate protein	plate	Q8SBG4	Shigella_phage	99.1	1.2e-200
VED36663.1|3486251_3486677_-|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	99.3	8.8e-81
VED36664.1|3486676_3487225_-|plate	putative phage baseplate protein	plate	Q8SBG6	Shigella_phage	98.9	2.5e-96
VED36665.1|3487224_3488304_-|tail	putative phage tail protein	tail	U5P0H6	Shigella_phage	99.7	6.9e-207
VED36666.1|3488303_3489629_-	Tail/DNA circulation protein	NA	Q8SBG8	Shigella_phage	98.9	3.5e-245
VED36667.1|3490075_3491458_-|tail	bacteriophage V tail protein	tail	M1FQW0	Enterobacteria_phage	98.3	5.9e-219
VED36668.1|3491471_3491909_-|tail	bacteriophage V tail protein	tail	Q8SBG9	Shigella_phage	99.3	4.7e-69
VED36669.1|3492050_3492320_-	phage protein	NA	S5FNR3	Shigella_phage	100.0	3.5e-43
VED36670.1|3492319_3492676_-	phage protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
VED36671.1|3492675_3494172_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.6	4.1e-274
VED36672.1|3494155_3494326_-	phage protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
VED36673.1|3494334_3494895_-	phage protein	NA	Q8SBH4	Shigella_phage	98.9	8.8e-105
VED36674.1|3494891_3495398_-	prophage protein	NA	Q8SBH5	Shigella_phage	91.7	9.5e-82
VED36675.1|3495372_3495783_-	prophage protein	NA	M1FJ87	Enterobacteria_phage	93.4	9.7e-69
VED36676.1|3495779_3496103_-	phage protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
VED36677.1|3496105_3496306_-	phage protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
VED36678.1|3496355_3497561_-|capsid	major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.7e-223
VED36679.1|3497575_3498226_-|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	98.6	2.4e-117
VED36680.1|3498203_3499445_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.2e-241
VED36681.1|3499444_3499627_-	prophage protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
VED36682.1|3499638_3501372_-|terminase	phage terminase, large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
VED36683.1|3501368_3501863_-|terminase	phage terminase small subunit	terminase	U5P067	Shigella_phage	98.8	1.1e-87
VED36684.1|3501988_3502339_-	putative phage endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	2.3e-63
VED36685.1|3502551_3502803_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED36686.1|3503233_3503671_-|lysis	bacteriophage lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.2	1.6e-69
VED36687.1|3503667_3503859_-	phage endolysin	NA	C6ZR65	Salmonella_phage	96.8	6.0e-29
VED36688.1|3504040_3504142_-	phage endolysin	NA	G5DA94	Enterobacteria_phage	93.1	4.0e-08
VED36689.1|3504125_3504449_-|holin	holin	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
VED36690.1|3505074_3505281_-	phage antiterminator Q protein	NA	M1FPN0	Enterobacteria_phage	100.0	5.1e-26
VED36691.1|3505294_3505480_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED36692.1|3505455_3505563_-	phage antiterminator Q protein	NA	NA	NA	NA	NA
VED36693.1|3505559_3505748_-	prophage protein	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
VED36694.1|3505744_3506107_-	prophage holliday junction resolvase	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
VED36695.1|3506103_3506379_-	prophage protein	NA	F1C5C8	Cronobacter_phage	76.9	1.5e-36
VED36696.1|3506371_3506881_-	putative phage endonuclease	NA	U5PWK7	Bacillus_phage	40.4	2.4e-24
VED36697.1|3506873_3507044_-	phage protein	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
VED36698.1|3507219_3508065_-	prophage protein	NA	I6R0S6	Salmonella_phage	57.0	2.4e-90
VED36699.1|3508061_3508502_-	recombination protein ninB from phage origin	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
VED36700.1|3508482_3508695_-	prophage protein	NA	A0A1V0E5J7	Salmonella_phage	100.0	2.8e-35
VED36701.1|3508681_3508780_-	bacteriophage HK97 gp56	NA	Q9MCP6	Enterobacteria_phage	100.0	7.5e-12
VED36702.1|3508776_3509046_-	prophage protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
VED36703.1|3509042_3510419_-	phage replicative DNA Helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
VED36704.1|3510861_3511239_-	phage replication Protein	NA	A0A0N7KZ97	Stx2-converting_phage	98.4	9.6e-63
VED36705.1|3511225_3511387_-	prophage protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
VED36706.1|3511421_3511700_-	transcriptional activator protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
VED36707.1|3511819_3512035_-	regulatory protein cro (antirepressor)	NA	Q716D6	Shigella_phage	98.6	4.2e-31
VED36708.1|3512138_3512771_+	putative prophage repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
VED36709.1|3512767_3513172_+	prophage protein	NA	Q716D7	Shigella_phage	97.8	1.3e-68
VED36710.1|3513479_3513803_+	prophage protein	NA	A4KWR0	Enterobacteria_phage	98.9	2.4e-46
VED36711.1|3513811_3514282_+	prophage protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	8.2e-88
VED36712.1|3514477_3514750_+	putative host killing protein	NA	A5VWA5	Enterobacteria_phage	100.0	6.5e-21
VED36713.1|3514746_3514854_+	Uncharacterised protein	NA	A0A192Y6P5	Salmonella_phage	78.1	4.4e-05
VED36714.1|3514834_3515143_+	prophage protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
VED36715.1|3515139_3515370_+	RecT family protein	NA	K7PKG9	Enterobacteria_phage	93.2	8.5e-30
VED36716.1|3515385_3516051_+	Putative phage-related DNA recombination protein	NA	K7PKG9	Enterobacteria_phage	99.1	1.1e-122
VED36717.1|3516034_3516409_+	prophage protein	NA	K7P6T5	Enterobacteria_phage	96.8	2.0e-57
VED36718.1|3516530_3516752_+	prophage protein	NA	K7PLT4	Enterobacteria_phage	88.4	6.3e-14
VED36719.1|3517026_3517188_+	prophage protein	NA	A0A077SLK5	Escherichia_phage	92.3	4.7e-11
VED36720.1|3517417_3517657_+	prophage protein	NA	S5M7T0	Escherichia_phage	97.5	1.6e-39
VED36721.1|3518093_3518384_+	prophage protein	NA	S5MC19	Escherichia_phage	100.0	3.2e-50
VED36722.1|3518657_3518837_+	prophage protein	NA	Q9AZ37	Salmonella_phage	100.0	3.3e-29
VED36723.1|3518937_3519282_+	prophage protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
VED36724.1|3519583_3520654_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	4.3e-201
3526027:3526042	attR	CCTGTTCTTTCTGTAT	NA	NA	NA	NA
>prophage 15
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	3824566	3875551	5297958	tRNA,transposase,protease	Bacillus_phage(30.77%)	49	NA	NA
VED37052.1|3824566_3825115_+|tRNA	protein YbaK containing prolyl-tRNA synthetase associated domain	tRNA	NA	NA	NA	NA
VED37053.1|3825081_3826734_-	protein UshA precursor [includes: UDP-sugar hydrolase; 5'-nucleotidase]	NA	NA	NA	NA	NA
VED37054.1|3826951_3828172_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VED37055.1|3828410_3830087_+	putative transport protein	NA	NA	NA	NA	NA
VED37056.1|3830204_3830390_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.9	8.4e-12
VED37057.1|3830434_3830773_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	7.1e-25
VED37058.1|3830997_3831519_-|transposase	transposase	transposase	NA	NA	NA	NA
VED37059.1|3831649_3832954_-	inosine-guanosine kinase	NA	NA	NA	NA	NA
VED37060.1|3833293_3834064_+	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	26.6	5.8e-14
VED37061.1|3834060_3835023_-	ferrochelatase	NA	NA	NA	NA	NA
VED37062.1|3835154_3835799_-	adenylate kinase	NA	NA	NA	NA	NA
VED37063.1|3835979_3837854_-	chaperone (heat shock protein)	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	3.0e-117
VED37064.1|3837963_3838569_-	recombination and repair protein RecR	NA	NA	NA	NA	NA
VED37065.1|3838568_3838898_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED37066.1|3841010_3841562_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
VED37067.1|3841714_3842092_-	inner membrane protein	NA	NA	NA	NA	NA
VED37068.1|3842161_3842689_+	primosomal replication protein N	NA	NA	NA	NA	NA
VED37069.1|3842702_3842864_+	small protein involved in the cell envelope stress response	NA	NA	NA	NA	NA
VED37070.1|3843075_3844827_-	potassium efflux protein	NA	NA	NA	NA	NA
VED37071.1|3844810_3846439_-	potassium efflux protein	NA	NA	NA	NA	NA
VED37072.1|3846566_3847214_-	acrAB operon repressor	NA	NA	NA	NA	NA
VED37073.1|3847355_3848549_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VED37074.1|3848571_3851721_+	acriflavin resistance protein B	NA	S5VTK5	Leptospira_phage	23.8	1.8e-53
VED37075.1|3852266_3852641_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED37076.1|3852666_3852885_+	hemolysin expression-modulating protein	NA	NA	NA	NA	NA
VED37077.1|3853056_3853608_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VED37078.1|3853723_3854194_+	inner membrane protein	NA	NA	NA	NA	NA
VED37079.1|3854357_3855800_+	putative signal transduction protein	NA	NA	NA	NA	NA
VED37080.1|3855747_3855909_+	putative signal transduction protein	NA	NA	NA	NA	NA
VED37081.1|3855950_3856304_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
VED37082.1|3856682_3856994_+	methylated DNA-protein cysteine alkyltransferase	NA	NA	NA	NA	NA
VED37083.1|3857024_3857597_-	putative lipoprotein	NA	NA	NA	NA	NA
VED37084.1|3857813_3858674_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VED37085.1|3858722_3860009_-	ammonia channel precursor (ammonia transporter)	NA	NA	NA	NA	NA
VED37086.1|3860038_3860377_-	glutamine synthetase	NA	NA	NA	NA	NA
VED37087.1|3860557_3862339_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-42
VED37088.1|3862331_3863402_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	36.2	5.0e-40
VED37089.1|3863382_3864105_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
VED37090.1|3864134_3864593_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VED37091.1|3864745_3865564_-	putative hydrolase	NA	NA	NA	NA	NA
VED37092.1|3865663_3867364_+	bacterial extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VED37093.1|3867428_3868124_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
VED37094.1|3868175_3868574_-	thioesterase protein YbaW	NA	NA	NA	NA	NA
VED37095.1|3868667_3869039_-	putative DNA uptake protein	NA	NA	NA	NA	NA
VED37096.1|3869189_3871061_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VED37097.1|3871252_3871525_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
VED37098.1|3871733_3872363_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	61.5	1.0e-61
VED37099.1|3872316_3874089_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	49.4	2.3e-154
VED37100.1|3874276_3875551_-|protease	ATP-dependent specificity component of ClpP serine protease	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
>prophage 16
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	4366147	4411548	5297958	tRNA,transposase,protease	Bacillus_phage(21.43%)	44	NA	NA
VED37609.1|4366147_4368964_-|tRNA	isoleucyl-tRNA synthetase	tRNA	A0A2K9L260	Tupanvirus	26.3	9.3e-78
VED37610.1|4369006_4369948_-	riboflavin biosynthesis protein [includes: riboflavin kinase; FMN adenylyltransferase]	NA	NA	NA	NA	NA
VED37611.1|4370276_4370540_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
VED37612.1|4371009_4372431_+	putative type III effector protein	NA	NA	NA	NA	NA
VED37613.1|4372732_4373266_+	fimbrial protein	NA	NA	NA	NA	NA
VED37614.1|4373586_4373997_+	putative membrane-associated pilin chaperone	NA	NA	NA	NA	NA
VED37615.1|4374009_4375302_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED37616.1|4375330_4375606_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VED37617.1|4375650_4376028_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VED37618.1|4376067_4376847_+	ybl1	NA	NA	NA	NA	NA
VED37619.1|4376884_4377784_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
VED37620.1|4377849_4379016_-	Na(+)/H(+) antiporter 1	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
VED37621.1|4379857_4380988_-	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
VED37622.1|4381076_4382993_-	chaperone protein DnaK (Heat shock protein 70) (Heat shock 70 kDaprotein) (HSP70)	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
VED37623.1|4383371_4383776_+	protein	NA	NA	NA	NA	NA
VED37624.1|4383801_4384515_+	putative oxidoreductase	NA	NA	NA	NA	NA
VED37625.1|4384663_4385230_+	putative membrane protein YaaH	NA	NA	NA	NA	NA
VED37626.1|4385264_4385852_-	molybdopterin biosynthesis Mog protein	NA	NA	NA	NA	NA
VED37627.1|4385966_4386920_-	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
VED37628.1|4387247_4388630_+	putative transport protein	NA	NA	NA	NA	NA
VED37629.1|4388699_4389476_+	peroxide resistance protein, lowers intracellular iron	NA	NA	NA	NA	NA
VED37630.1|4389558_4390080_+|transposase	transposase	transposase	NA	NA	NA	NA
VED37631.1|4390304_4390907_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	57.3	5.8e-62
VED37632.1|4391064_4391361_-	protein	NA	NA	NA	NA	NA
VED37633.1|4391574_4392861_-	threonine synthase	NA	NA	NA	NA	NA
VED37634.1|4392861_4393794_-	homoserine kinase	NA	NA	NA	NA	NA
VED37635.1|4393795_4396258_-	bifunctional aspartokinase I/homoserine dehydrogenase I	NA	NA	NA	NA	NA
VED37636.1|4396617_4397304_-	RNA methyltransferase	NA	NA	NA	NA	NA
VED37637.1|4397939_4398656_+	aerobic respiration control protein ArcA	NA	NA	NA	NA	NA
VED37638.1|4398713_4400066_-	inner membrane protein	NA	NA	NA	NA	NA
VED37639.1|4400123_4401548_-	two-component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	4.2e-10
VED37640.1|4401547_4402237_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
VED37641.1|4402249_4402723_-	CreA protein	NA	NA	NA	NA	NA
VED37642.1|4402933_4403803_+	right origin-binding protein	NA	NA	NA	NA	NA
VED37643.1|4403799_4404447_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
VED37644.1|4404498_4405020_+	NTPase	NA	NA	NA	NA	NA
VED37645.1|4405104_4405401_-	trp operon repressor	NA	NA	NA	NA	NA
VED37646.1|4405520_4407458_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
VED37647.1|4407668_4409345_+	putative ABC transporter ATP-binding protein YjjK	NA	A0A2K9L3Z8	Tupanvirus	27.3	1.1e-28
VED37648.1|4409643_4409964_-	transcriptional regulator	NA	A0A0C5K935	Enterococcus_phage	49.0	5.3e-22
VED37649.1|4409965_4410319_-	transcriptional regulator	NA	A0A0C5K935	Enterococcus_phage	51.4	5.5e-28
VED37650.1|4410705_4410879_-	transcriptional regulator	NA	NA	NA	NA	NA
VED37651.1|4410899_4411142_-|protease	putative ATP-dependent serine protease	protease	NA	NA	NA	NA
VED37652.1|4411122_4411548_-|protease	putative ATP-dependent serine protease	protease	NA	NA	NA	NA
>prophage 17
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	4470152	4505368	5297958	transposase	Escherichia_phage(21.43%)	46	NA	NA
VED37720.1|4470152_4470428_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.7e-45
VED37721.1|4470472_4470850_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VED37722.1|4472055_4472772_+	N-acetylneuraminic acid outer membrane porin	NA	NA	NA	NA	NA
VED37723.1|4472791_4473898_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VED37724.1|4473962_4474943_+	YjhS protein	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
VED37725.1|4475432_4475591_+	putative restriction endonuclease	NA	NA	NA	NA	NA
VED37726.1|4475903_4476206_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37727.1|4476252_4479633_-	putative restriction enzyme	NA	NA	NA	NA	NA
VED37728.1|4479635_4480031_-	putative DNA modification methylase	NA	NA	NA	NA	NA
VED37729.1|4480038_4480905_-	putative DNA modification methylase	NA	A0A2K5B255	Erysipelothrix_phage	39.5	5.5e-05
VED37730.1|4480946_4481660_-	putative DNA modification methylase	NA	Q1MVP0	Enterobacteria_phage	29.5	2.7e-05
VED37731.1|4481771_4482740_-	putative DNA modification methylase	NA	NA	NA	NA	NA
VED37732.1|4482760_4483879_-	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.9	2.8e-78
VED37733.1|4483862_4485653_-	putative helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	60.0	1.7e-202
VED37734.1|4485916_4486075_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37735.1|4486304_4486460_-	putative restriction methylase	NA	NA	NA	NA	NA
VED37736.1|4486562_4486739_-	Aec78	NA	NA	NA	NA	NA
VED37737.1|4486755_4487148_-	aec77	NA	NA	NA	NA	NA
VED37738.1|4487211_4487577_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VED37739.1|4487534_4488131_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.8	7.4e-102
VED37740.1|4488365_4488584_-	aec77	NA	NA	NA	NA	NA
VED37741.1|4488580_4488955_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VED37742.1|4489044_4489413_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VED37743.1|4489462_4489576_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED37744.1|4489575_4489797_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
VED37745.1|4489859_4490336_-	putative DNA repair protein	NA	NA	NA	NA	NA
VED37746.1|4490351_4490825_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
VED37747.1|4491166_4491739_-	CP4-57 prophage protein	NA	NA	NA	NA	NA
VED37748.1|4491689_4491986_-	CP4-57 prophage protein	NA	NA	NA	NA	NA
VED37749.1|4492371_4493466_-	putative adhesin	NA	NA	NA	NA	NA
VED37750.1|4493428_4495216_-	antigen 43, truncation	NA	NA	NA	NA	NA
VED37751.1|4495589_4495823_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VED37752.1|4495819_4496464_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VED37753.1|4496548_4497466_-	ybl124	NA	NA	NA	NA	NA
VED37754.1|4498669_4499272_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED37755.1|4499366_4499573_-	putative regulatory protein	NA	NA	NA	NA	NA
VED37756.1|4499713_4499980_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37757.1|4500280_4500457_+	putative regulatory protein	NA	NA	NA	NA	NA
VED37758.1|4500802_4501003_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED37759.1|4501201_4501771_+	malate transporter	NA	NA	NA	NA	NA
VED37760.1|4502030_4502432_+	ybl85	NA	NA	NA	NA	NA
VED37761.1|4502419_4502854_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VED37762.1|4502853_4503090_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37763.1|4503208_4503589_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	1.3e-64
VED37764.1|4503585_4503933_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VED37765.1|4503982_4505368_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
>prophage 18
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	4508716	4541556	5297958	transposase,holin	Shigella_phage(35.0%)	47	NA	NA
VED37769.1|4508716_4508926_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VED37770.1|4508926_4509220_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VED37771.1|4509705_4510227_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VED37772.1|4510223_4510883_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED37773.1|4510845_4511178_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VED37774.1|4511264_4513589_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VED37775.1|4513633_4514536_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VED37776.1|4514532_4515531_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VED37777.1|4515527_4516484_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VED37778.1|4516484_4517252_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VED37779.1|4517809_4518067_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VED37780.1|4518149_4518392_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VED37781.1|4518388_4518802_-|transposase	transposase	transposase	Q716C2	Shigella_phage	96.5	5.2e-62
VED37782.1|4519043_4519346_-|transposase	transposase ORF A, IS911	transposase	Q716C1	Shigella_phage	96.5	1.2e-36
VED37783.1|4519552_4520374_+	putative polysaccharide deacetylase	NA	NA	NA	NA	NA
VED37784.1|4520376_4521465_+	glycosyl transferase family protein	NA	NA	NA	NA	NA
VED37785.1|4521469_4522420_+	virulence protein	NA	NA	NA	NA	NA
VED37786.1|4522484_4523429_+	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
VED37787.1|4523609_4524749_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
VED37788.1|4524902_4525601_+|holin	betaine-carnitine-choline transporter family member	holin	NA	NA	NA	NA
VED37789.1|4525753_4526620_+	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	3.1e-08
VED37790.1|4526567_4526903_+	secondary glycine betaine transporter	NA	NA	NA	NA	NA
VED37791.1|4526847_4527006_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37792.1|4526965_4527247_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VED37793.1|4527333_4527630_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VED37794.1|4527708_4528335_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VED37795.1|4528759_4529539_-	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VED37796.1|4529538_4529817_-|transposase	transposase for insertion sequence IS100	transposase	A0A2L1IVA1	Escherichia_phage	98.9	1.3e-48
VED37797.1|4529836_4530283_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	81.6	1.4e-60
VED37798.1|4530279_4530561_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	2.5e-44
VED37799.1|4530732_4531107_+	HTH regulator, TetR family	NA	NA	NA	NA	NA
VED37800.1|4531164_4531269_-	putative alcohol dehydrogenase (partial)	NA	NA	NA	NA	NA
VED37801.1|4531797_4532928_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	66.0	1.0e-147
VED37802.1|4532924_4533410_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.8	3.5e-25
VED37803.1|4533440_4533737_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.3	2.2e-30
VED37804.1|4533854_4534217_-|transposase	IS66 transposase	transposase	Q6H9S5	Enterobacteria_phage	81.7	5.1e-29
VED37805.1|4534231_4535209_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	94.4	5.4e-166
VED37806.1|4535248_4535533_-	Insertion element IS2A protein	NA	Q76S41	Shigella_phage	100.0	7.7e-41
VED37807.1|4536500_4536842_-	transcriptional regulator	NA	NA	NA	NA	NA
VED37808.1|4536807_4537284_-	transcriptional regulator	NA	NA	NA	NA	NA
VED37809.1|4537588_4538038_+	Deoxyribokinase	NA	NA	NA	NA	NA
VED37810.1|4537985_4538510_+	Deoxyribokinase	NA	NA	NA	NA	NA
VED37811.1|4538537_4538924_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED37812.1|4538874_4539093_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED37813.1|4539080_4539854_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED37814.1|4539865_4540879_+	Deoxyribose specific mutarotase	NA	NA	NA	NA	NA
VED37815.1|4541301_4541556_+|transposase	putative transposase (partial)	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 19
LR134246	Escherichia coli strain NCTC9702 genome assembly, chromosome: 1	5297958	4654024	4749668	5297958	protease,tRNA,transposase,integrase	Enterobacteria_phage(16.13%)	100	4679522:4679537	4722883:4722898
VED37937.1|4654024_4654216_-|tRNA	tRNA delta(2)-isopentenylpyrophosphate transferase	tRNA	NA	NA	NA	NA
VED37938.1|4654199_4654976_-|tRNA	tRNA delta-2-isopentenylpyrophosphate (IPP) transferase	tRNA	NA	NA	NA	NA
VED37939.1|4654968_4656816_-	DNA mismatch repair protein	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
VED37940.1|4656825_4658163_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
VED37941.1|4658181_4658643_-	putative hydrolase	NA	NA	NA	NA	NA
VED37942.1|4658614_4660147_-	putative carbohydrate kinase	NA	NA	NA	NA	NA
VED37943.1|4660160_4661300_+	electron transport protein YjeS	NA	NA	NA	NA	NA
VED37944.1|4662199_4662814_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.9e-28
VED37945.1|4662839_4663892_+	ribosome-associated GTPase	NA	NA	NA	NA	NA
VED37946.1|4663988_4664957_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
VED37947.1|4664978_4668302_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
VED37948.1|4668330_4668633_-	inner membrane protein	NA	NA	NA	NA	NA
VED37949.1|4668742_4670200_-	transporter	NA	NA	NA	NA	NA
VED37950.1|4670463_4671441_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
VED37951.1|4671873_4672266_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED37952.1|4672697_4673573_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
VED37953.1|4673565_4674300_+	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
VED37954.1|4674310_4674529_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
VED37955.1|4674719_4675079_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
VED37956.1|4675108_4676134_+	beta-lactamase	NA	NA	NA	NA	NA
VED37957.1|4676364_4676898_+	outer membrane lipoprotein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
VED37958.1|4676894_4677212_-	quaternary ammonium compound-resistance protein	NA	NA	NA	NA	NA
VED37959.1|4677386_4677533_-	entericidin B	NA	NA	NA	NA	NA
VED37960.1|4677643_4677769_-	entericidin A	NA	NA	NA	NA	NA
VED37961.1|4677820_4678387_-	elongation factor P (EF-P)	NA	NA	NA	NA	NA
VED37962.1|4678428_4679457_+	radical SAM superfamily protein	NA	NA	NA	NA	NA
4679522:4679537	attL	TGTTATTACTTTTTAT	NA	NA	NA	NA
VED37963.1|4679691_4680561_+	protein	NA	NA	NA	NA	NA
VED37964.1|4680610_4680964_-	putative lipoprotein	NA	NA	NA	NA	NA
VED37965.1|4681101_4682748_-	chaperonin Cpn60	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
VED37966.1|4682791_4682968_-	10 kDa chaperonin (Protein Cpn10) (groES protein)	NA	NA	NA	NA	NA
VED37967.1|4682922_4683084_-	10 kDa chaperonin (Protein Cpn10) (groES protein)	NA	NA	NA	NA	NA
VED37968.1|4683358_4684732_+	inner membrane protein YjeH	NA	NA	NA	NA	NA
VED37969.1|4684728_4685109_-	protein FxsA (suppressor of F exclusion of phage T7)	NA	NA	NA	NA	NA
VED37970.1|4685445_4685661_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
VED37971.1|4685711_4686719_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
VED37972.1|4687091_4688300_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
VED37973.1|4688414_4688753_+	divalent cation tolerance protein	NA	NA	NA	NA	NA
VED37974.1|4688728_4690426_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VED37975.1|4690536_4691037_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VED37976.1|4691413_4691635_+|integrase	Prophage integrase	integrase	E5AGD0	Erwinia_phage	58.7	2.5e-15
VED37977.1|4691925_4692219_+|integrase	Prophage integrase	integrase	Q7M297	Enterobacteria_phage	39.6	8.9e-16
VED37978.1|4692307_4692643_+|integrase	Prophage integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	46.1	1.7e-15
VED37979.1|4694635_4695229_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED37980.1|4695639_4696371_+	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	55.9	1.1e-62
VED37981.1|4696493_4696781_+	Helicase	NA	NA	NA	NA	NA
VED37982.1|4696972_4697353_+	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	63.1	1.5e-39
VED37983.1|4697357_4698491_+	Helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	26.6	3.2e-29
VED37984.1|4698516_4699497_+	ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
VED37985.1|4699506_4701894_+|protease	putative serine protease	protease	NA	NA	NA	NA
VED37986.1|4701903_4702389_+	DNA methylase N-4/N-6	NA	A0A0M7Q8J6	Escherichia_phage	60.9	3.1e-45
VED37987.1|4702388_4703021_+	DNA methylase N-4/N-6	NA	B3RH19	Escherichia_phage	71.7	3.8e-19
VED37988.1|4703017_4703530_+	DNA methylase N-4/N-6	NA	A0A0K1LNZ9	Escherichia_phage	71.4	1.2e-07
VED37989.1|4703870_4706402_+	PstII restriction-modification enzyme Res subunit	NA	NA	NA	NA	NA
VED37990.1|4706490_4706784_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED37991.1|4706853_4707204_+|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
VED37992.1|4707123_4708275_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VED37993.1|4708591_4708999_+|integrase	putative integrase	integrase	Q716C2	Shigella_phage	96.6	2.9e-65
VED37994.1|4709217_4710294_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VED37995.1|4710412_4710619_+|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	98.5	3.0e-34
VED37996.1|4711079_4715198_+|protease	serine protease (autotransporter)	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
VED37997.1|4715348_4715567_-	IS encoded protein	NA	NA	NA	NA	NA
VED37998.1|4715629_4716061_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	2.1e-77
VED37999.1|4716169_4716604_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
VED38000.1|4716600_4716951_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
VED38001.1|4716981_4718550_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.9	5.6e-141
VED38002.1|4718659_4719793_-|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VED38003.1|4720374_4720638_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.6	3.6e-24
VED38004.1|4720776_4721610_-|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VED38005.1|4721560_4721911_-|transposase	transposase	transposase	NA	NA	NA	NA
VED38006.1|4721974_4722160_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	72.4	2.6e-21
VED38007.1|4723226_4723901_-	ImpA domain protein	NA	NA	NA	NA	NA
4722883:4722898	attR	ATAAAAAGTAATAACA	NA	NA	NA	NA
VED38008.1|4723947_4724445_-	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VED38009.1|4724900_4725431_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED38010.1|4726025_4726235_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED38011.1|4726390_4726510_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED38012.1|4726493_4726643_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38013.1|4727199_4727544_-|transposase	IS629, transposase orfB, truncation	transposase	Q6H9S6	Enterobacteria_phage	94.5	3.7e-53
VED38014.1|4728934_4729768_-	putative type VI secretion protein	NA	H6X3M6	Enterobacteria_phage	39.9	9.3e-34
VED38015.1|4729791_4731156_-	putative type VI secretion protein	NA	A0A2I7SAX5	Vibrio_phage	41.6	1.3e-61
VED38016.1|4731159_4732578_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38017.1|4732577_4733057_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38018.1|4733230_4733845_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38019.1|4733925_4734561_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38020.1|4734566_4735157_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38021.1|4735153_4735468_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38022.1|4735495_4736908_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38023.1|4736926_4737478_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38024.1|4737485_4738562_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38025.1|4738565_4738865_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38026.1|4738874_4739342_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38027.1|4739352_4741335_-	putative type VI secretion protein	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
VED38028.1|4741347_4742280_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38029.1|4742270_4744073_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38030.1|4744065_4744488_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38031.1|4744497_4745004_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38032.1|4745013_4746492_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38033.1|4746494_4746971_-	putative type VI secretion protein	NA	NA	NA	NA	NA
VED38034.1|4747367_4747676_+|transposase	transposase (fragment), IS630 family	transposase	NA	NA	NA	NA
VED38035.1|4748871_4749078_-	polyketide synthase pksM (fragment)	NA	NA	NA	NA	NA
VED38036.1|4749470_4749668_+|transposase	putative transposase	transposase	NA	NA	NA	NA
