The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	1448446	1501311	5457304	head,tail,integrase,terminase,coat	Cronobacter_phage(20.37%)	75	1467381:1467396	1509212:1509227
VED54042.1|1448446_1448905_-	Probable deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
VED54044.1|1449037_1449946_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
VED54046.1|1449955_1450837_-	Uncharacterised protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
VED54048.1|1451204_1451687_-	Tryptophan synthase beta chain like	NA	NA	NA	NA	NA
VED54050.1|1452265_1452925_-	AP2 domain.	NA	A0A2I7R856	Vibrio_phage	49.0	6.4e-38
VED54052.1|1452926_1453145_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	50.7	1.1e-13
VED54054.1|1453361_1454531_-	Modification methylase HhaI	NA	Q858D4	Salmonella_phage	67.8	7.4e-146
VED54056.1|1454527_1455190_-	adenine-specific DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	6.7e-112
VED54058.1|1455165_1455693_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54060.1|1455689_1455995_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54062.1|1455991_1456282_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54064.1|1456265_1457048_-	DNA damage response protein A	NA	A0A1R3Y600	Salmonella_virus	57.6	4.1e-76
VED54066.1|1457044_1457203_-	Uncharacterised protein	NA	A0A1R3Y5R4	Salmonella_virus	57.8	4.5e-06
VED54068.1|1457199_1457397_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54070.1|1457482_1457677_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54072.1|1458104_1458308_+	Uncharacterised protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	5.9e-19
VED54074.1|1458342_1458558_-	Uncharacterised protein	NA	A0A0P0ZDD3	Stx2-converting_phage	71.8	1.6e-22
VED54076.1|1459222_1459411_-	Predicted transcription regulator containing HTH domain	NA	A0A0P0ZCT8	Stx2-converting_phage	93.1	9.7e-24
VED54078.1|1459811_1460303_-	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	81.6	3.0e-72
VED54080.1|1460620_1460848_+	antirepressor protein Cro	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
VED54082.1|1460888_1461110_+	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
VED54084.1|1461195_1461342_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54086.1|1461334_1462234_+	Uncharacterised protein	NA	A0A0N7C1Z7	Escherichia_phage	55.3	8.4e-81
VED54088.1|1462278_1463127_+	DnaB domain-containing protein	NA	K7PMA6	Enterobacterial_phage	62.8	1.6e-94
VED54090.1|1463110_1463689_+	DnaB domain-containing protein	NA	Q8VNP7	Enterobacteria_phage	82.1	3.3e-46
VED54092.1|1463654_1463957_+	Uncharacterized protein conserved in archaea	NA	NA	NA	NA	NA
VED54094.1|1463953_1464205_+	Uncharacterised protein	NA	R9TME7	Aeromonas_phage	56.2	1.6e-05
VED54096.1|1464153_1464363_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54098.1|1464359_1464644_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54100.1|1464740_1465016_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54102.1|1465037_1465580_+	Uncharacterised protein	NA	A0A0S1S1U7	Klebsiella_phage	74.6	1.1e-19
VED54104.1|1465716_1465989_+	Protein of uncharacterised function (DUF551)	NA	NA	NA	NA	NA
VED54106.1|1465988_1466111_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54108.1|1466430_1466688_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	3.2e-25
VED54110.1|1466889_1467345_+	protein YbcN	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
VED54112.1|1467344_1467515_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
1467381:1467396	attL	ATCTTCCGCGTGCCGG	NA	NA	NA	NA
VED54114.1|1467507_1467966_+	bacteriophage lambda NinG family protein	NA	E7C9S3	Salmonella_phage	44.2	3.4e-30
VED54116.1|1468086_1468227_+	Gifsy-1 Prophage protein	NA	NA	NA	NA	NA
VED54118.1|1468223_1468907_+	phage antitermination protein Q	NA	I6PDF8	Cronobacter_phage	53.2	1.4e-59
VED54119.1|1469334_1469505_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54121.1|1470376_1470694_+	Uncharacterised protein	NA	A0A286N2Q5	Klebsiella_phage	98.0	7.3e-48
VED54123.1|1470680_1471130_+	muraminidase	NA	A0A0M4R365	Salmonella_phage	70.5	1.4e-57
VED54125.1|1471142_1471319_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54127.1|1471386_1471902_+	Uncharacterised protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
VED54129.1|1471901_1473374_+|terminase	phage terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	82.3	2.0e-249
VED54131.1|1473386_1474856_+	gp5	NA	F1C5D7	Cronobacter_phage	56.3	4.8e-150
VED54133.1|1474887_1475784_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.9	5.2e-115
VED54135.1|1475776_1475977_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED54137.1|1476054_1477410_+	gp7	NA	F1C5D9	Cronobacter_phage	53.5	4.6e-131
VED54139.1|1477409_1477871_+	Uncharacterised protein	NA	B1GS72	Salmonella_phage	50.3	3.8e-29
VED54141.1|1477867_1478923_+|coat	Phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.8	4.5e-102
VED54144.1|1478954_1479266_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54146.1|1479268_1479649_+	gp11	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
VED54148.1|1479821_1480013_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54150.1|1480187_1480550_+	Uncharacterised protein	NA	F1C5E3	Cronobacter_phage	53.6	1.8e-18
VED54152.1|1480610_1481003_+	Uncharacterised protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
VED54154.1|1481071_1481824_+	putative immunoglobulin domain protein	NA	G0ZNE6	Cronobacter_phage	42.5	5.8e-43
VED54156.1|1481876_1482554_+	Uncharacterised protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
VED54158.1|1482732_1483488_+	KilA-N domain	NA	K7PGT4	Enterobacteria_phage	51.8	2.1e-61
VED54160.1|1483490_1483745_+	Uncharacterised protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
VED54162.1|1483819_1484254_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED54164.1|1484294_1484660_-	Arc-like DNA binding domain	NA	NA	NA	NA	NA
VED54165.1|1484773_1484941_+	Uncharacterised protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
VED54167.1|1485014_1485986_+	Phage anti-repressor protein	NA	A5VW58	Enterobacteria_phage	75.1	1.4e-86
VED54169.1|1486058_1489277_+|tail	tail length tape measure protein	tail	R9TMK1	Aeromonas_phage	52.2	6.2e-219
VED54172.1|1489869_1490346_+	Uncharacterised protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	7.4e-36
VED54174.1|1490345_1490816_+	Uncharacterised protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
VED54176.1|1490812_1491208_+	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	52.8	3.0e-35
VED54178.1|1491194_1493672_+	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	45.6	9.4e-199
VED54180.1|1493758_1496293_+	Uncharacterised protein	NA	A0A1I9SEN3	Klebsiella_phage	31.7	1.6e-65
VED54182.1|1496710_1498078_+	Group II intron-encoded protein ltrA	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.1e-31
VED54183.1|1498276_1498516_+	Uncharacterised protein	NA	K7P7N3	Enterobacteria_phage	48.1	3.0e-14
VED54185.1|1498515_1498833_+	umuDC operon protein-like protein	NA	K7PGV5	Enterobacterial_phage	50.0	6.9e-22
VED54187.1|1498866_1500057_-|integrase	putative integrase	integrase	Q716F9	Shigella_phage	85.6	4.8e-193
VED54189.1|1500381_1501311_-	transport	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1509212:1509227	attR	ATCTTCCGCGTGCCGG	NA	NA	NA	NA
>prophage 2
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	1726641	1733546	5457304		Planktothrix_phage(33.33%)	6	NA	NA
VED54701.1|1726641_1727505_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
VED54703.1|1727515_1728289_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
VED54705.1|1728529_1729426_-	Transcription regulator [contains diacylglycerol kinase catalytic domain]	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
VED54707.1|1729668_1731030_-	peptidase U32	NA	Q6DW11	Phage_TP	94.8	1.8e-207
VED54709.1|1731348_1732071_-	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
VED54711.1|1732067_1733546_-	Sensory histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	2025106	2069409	5457304	head,protease,portal,tail,holin,capsid,integrase,terminase	Klebsiella_phage(68.09%)	56	2029199:2029214	2071457:2071472
VED55202.1|2025106_2026750_+	Phosphoenolpyruvate carboxykinase [ATP]	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
VED55204.1|2026799_2027276_-	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
VED55206.1|2027374_2028481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED55208.1|2028603_2029899_+	citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
2029199:2029214	attL	TGATTGTTCCGTTCAT	NA	NA	NA	NA
VED55210.1|2029913_2030720_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
VED55212.1|2030694_2030964_-	transcriptional regulator, LysR family	NA	NA	NA	NA	NA
VED55214.1|2030960_2032214_-|integrase	integrase family protein	integrase	A0A286S1S8	Klebsiella_phage	100.0	1.5e-245
VED55216.1|2032269_2032503_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	100.0	1.6e-39
VED55218.1|2032560_2032773_-	Uncharacterised protein	NA	A0A286S2B6	Klebsiella_phage	100.0	1.2e-33
VED55220.1|2032769_2032994_-	Uncharacterised protein	NA	A0A286S2B3	Klebsiella_phage	94.6	7.5e-31
VED55222.1|2032983_2033691_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	4.7e-111
VED55224.1|2033699_2034278_-	Uncharacterised protein	NA	A0A286S1S7	Klebsiella_phage	98.4	8.2e-106
VED55226.1|2034322_2035150_-	HflC protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
VED55228.1|2035146_2035341_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED55230.1|2035337_2035763_-	Uncharacterised protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
VED55232.1|2035759_2035978_-	Uncharacterised protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
VED55234.1|2035949_2036204_-	Uncharacterised protein	NA	A0A286SGR4	Klebsiella_phage	95.2	3.4e-40
VED55235.1|2036731_2036920_-	Uncharacterised protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
VED55237.1|2036912_2037227_-	Uncharacterised protein	NA	A0A286S1T9	Klebsiella_phage	99.0	3.8e-49
VED55239.1|2037398_2038067_-	P22 repressor protein c2	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
VED55241.1|2038164_2038386_+	putative zinc finger/helix-turn-helix protein, YgiT family	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
VED55243.1|2038962_2040621_+	type III restriction protein res subunit	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
VED55245.1|2040622_2041585_+	P4 alpha zinc-binding domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
VED55247.1|2041581_2042058_+	Uncharacterised protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	8.9e-90
VED55249.1|2042054_2042837_+	Antitermination protein.	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
VED55251.1|2043056_2043605_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED55253.1|2043692_2043809_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED55255.1|2043856_2044249_+|holin	holin	holin	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
VED55257.1|2044238_2044517_+	putative prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
VED55259.1|2044516_2045146_+	lytic enzyme	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
VED55261.1|2045153_2045429_+	Uncharacterised protein	NA	G8C7W1	Escherichia_phage	53.9	6.4e-16
VED55263.1|2046088_2046334_+	Protein of uncharacterised function (DUF2560)	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
VED55265.1|2046912_2047263_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	4.6e-51
VED55267.1|2047420_2047918_+|terminase	Phage terminase small subunit	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
VED55269.1|2047921_2049673_+|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	72.2	8.8e-252
VED55271.1|2049669_2049831_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED55272.1|2049820_2051047_+|portal	HK97 family phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
VED55274.1|2051039_2051639_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
VED55276.1|2051648_2052887_+|capsid	HK97 family phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
VED55278.1|2052964_2053282_+	phage protein DNA packaging protein	NA	A0A1W6JNZ5	Morganella_phage	52.9	2.4e-22
VED55280.1|2053351_2053549_+	Uncharacterised protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
VED55282.1|2053550_2053883_+|head,tail	phage head-tail adaptor	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
VED55284.1|2053875_2054415_+	phage protein, HK97 gp10 family	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
VED55286.1|2054411_2054777_+	Protein of uncharacterised function (DUF3168)	NA	A0A286S1R1	Klebsiella_phage	93.4	1.3e-61
VED55288.1|2054833_2055325_+	Uncharacterised protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
VED55290.1|2055368_2055722_+	Uncharacterised protein	NA	A0A286S1N4	Klebsiella_phage	98.3	2.4e-60
VED55292.1|2055754_2056018_+	Uncharacterised protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
VED55293.1|2056541_2057951_+|tail	prophage tail length tape measure	tail	A0A286S1S3	Klebsiella_phage	97.2	6.0e-243
VED55295.1|2058099_2058978_+|tail	prophage tail length tape measure	tail	A0A286S1S3	Klebsiella_phage	76.2	2.8e-113
VED55297.1|2058977_2059457_+	alkanesulfonate ABC transporter permease	NA	A0A286S298	Klebsiella_phage	78.6	1.1e-76
VED55299.1|2059443_2059926_+	Domain of uncharacterised function (DUF1833)	NA	A0A286S2B1	Klebsiella_phage	68.4	6.5e-56
VED55301.1|2059933_2060314_+	COG2116: Formate/nitrite family of transporters	NA	A0A286S2A6	Klebsiella_phage	54.8	5.3e-37
VED55303.1|2060310_2063379_+	Uncharacterised protein	NA	A0A286S259	Klebsiella_phage	69.0	0.0e+00
VED55305.1|2063456_2065031_+	Uncharacterised protein	NA	A0A2H4N7A3	Pectobacterium_phage	48.8	1.2e-106
VED55307.1|2065346_2066156_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED55309.1|2066253_2069409_-	Uncharacterised protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.3e-104
2071457:2071472	attR	TGATTGTTCCGTTCAT	NA	NA	NA	NA
>prophage 4
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	2759988	2770875	5457304		Escherichia_phage(87.5%)	9	NA	NA
VED56129.1|2759988_2763096_+	Beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
VED56130.1|2763150_2764416_+	Lactose permease	NA	NA	NA	NA	NA
VED56131.1|2764446_2765535_-	putative RecF protein	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
VED56132.1|2765621_2765882_-	Uncharacterised protein	NA	A0A077SK33	Escherichia_phage	97.7	2.1e-40
VED56133.1|2766179_2767040_+	Beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
VED56134.1|2767060_2767822_-	DeoR-family trancriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
VED56135.1|2768082_2768985_+	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
VED56136.1|2768996_2770262_+	Predicted pyridoxine biosynthesis protein (probably from glycolaldehide)	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
VED56137.1|2770254_2770875_+	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	2994744	3033822	5457304	protease,portal,tail,capsid,integrase,terminase	Klebsiella_phage(52.5%)	46	3002885:3002898	3030488:3030501
VED56342.1|2994744_2997249_-	Uncharacterised protein	NA	A0A1I9SEN3	Klebsiella_phage	33.1	1.1e-72
VED56343.1|2997327_3000405_-	Uncharacterised protein	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
VED56344.1|3000401_3000782_-	COG2116: Formate/nitrite family of transporters	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
VED56345.1|3000794_3001271_-	Domain of uncharacterised function (DUF1833)	NA	A0A286S2B1	Klebsiella_phage	65.2	1.1e-50
VED56346.1|3001257_3001731_-	Uncharacterised protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
VED56347.1|3001752_3005331_-|tail	Phage tail length tape-measure protein 1	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	63.6	5.6e-253
3002885:3002898	attL	ATTATTTCTTTTTT	NA	NA	NA	NA
VED56348.1|3005730_3006036_-|tail	phage-related minor tail protein	tail	Q9MCS5	Enterobacteria_phage	67.0	3.3e-29
VED56349.1|3006038_3006404_-|tail	Phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.9	1.6e-30
VED56350.1|3006473_3007178_-|tail	phage major tail subunit	tail	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
VED56351.1|3007234_3007582_-	Protein of uncharacterised function (DUF3168)	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
VED56352.1|3007578_3008028_-	phage protein, HK97 gp10 family	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
VED56353.1|3008374_3008701_-	phage protein DNA packaging protein	NA	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
VED56354.1|3008700_3008934_-	Uncharacterised protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
VED56355.1|3008976_3010194_-|capsid	Phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	8.1e-196
VED56356.1|3010203_3011052_-|protease	ATP-dependent protease	protease	K7PH05	Enterobacteria_phage	84.3	1.0e-128
VED56357.1|3011064_3012372_-|portal	Phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	6.6e-212
VED56358.1|3012371_3014114_-|terminase	Phage terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.6e-141
VED56359.1|3014067_3014532_-|terminase	Phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
VED56360.1|3014714_3015056_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
VED56361.1|3015111_3015357_-	Protein of uncharacterised function (DUF2560)	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
VED56362.1|3015582_3015804_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56363.1|3016547_3016748_-	Uncharacterised protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	2.9e-18
VED56364.1|3017255_3017531_-	Uncharacterised protein	NA	A0A286N2Q8	Klebsiella_phage	81.3	2.6e-09
VED56365.1|3017527_3017872_-	Uncharacterised protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
VED56366.1|3017868_3018408_-	Predicted lysozyme (DUF847)	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
VED56367.1|3018404_3018716_-	Uncharacterised protein	NA	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
VED56368.1|3020021_3020279_-	Uncharacterised protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
VED56369.1|3020435_3021251_-	Antitermination protein.	NA	A0A286N2Q2	Klebsiella_phage	77.9	4.4e-113
VED56370.1|3021247_3021724_-	Uncharacterised protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
VED56371.1|3021720_3022683_-	P4 alpha zinc-binding domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	100.0	7.4e-184
VED56372.1|3022684_3024343_-	type III restriction protein res subunit	NA	A0A286N2P9	Klebsiella_phage	99.3	0.0e+00
VED56373.1|3025435_3026110_+	phage repressor	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
VED56374.1|3026273_3026687_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56375.1|3026759_3026867_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56376.1|3026869_3027094_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56377.1|3027094_3027460_+	Uncharacterised protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
VED56378.1|3027452_3027707_+	Uncharacterised protein	NA	A0A286SGR4	Klebsiella_phage	90.5	5.1e-36
VED56379.1|3027678_3027897_+	Uncharacterised protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
VED56380.1|3027893_3028334_+	Uncharacterised protein	NA	A0A286S1S2	Klebsiella_phage	78.8	1.1e-57
VED56381.1|3028314_3028893_+	Uncharacterised protein	NA	A0A286S1S7	Klebsiella_phage	98.4	8.2e-106
VED56382.1|3028905_3029004_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56383.1|3029014_3029206_+	putative excisionase	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
VED56384.1|3029186_3030212_-|integrase	phage integrase family protein	integrase	A0A0M4QX09	Salmonella_phage	83.6	5.8e-171
VED56385.1|3030624_3031113_+|protease	intracellular protease 1	protease	NA	NA	NA	NA
3030488:3030501	attR	AAAAAAGAAATAAT	NA	NA	NA	NA
VED56386.1|3031311_3032844_-	HD domain	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
VED56387.1|3033060_3033822_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	1.4e-20
>prophage 6
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	3234850	3291430	5457304	head,tRNA,protease,portal,tail,capsid,terminase,lysis	Klebsiella_phage(56.25%)	49	NA	NA
VED56585.1|3234850_3235909_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
VED56586.1|3236331_3237759_-|tail	putative tail fiber	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
VED56587.1|3237827_3250532_-|tail	Phage tail fiber protein	tail	Q6UAW1	Klebsiella_phage	47.0	0.0e+00
VED56588.1|3250594_3251206_-|tail	bacteriophage lambda tail assembly I	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
VED56589.1|3251221_3251572_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56590.1|3251603_3252314_-|tail	Phage tail assembly protein	tail	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
VED56591.1|3252315_3253071_-|tail	Phage minor tail protein	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
VED56592.1|3253067_3253406_-|tail	phage minor tail family protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
VED56593.1|3253405_3256741_-|tail	tail length tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.5	0.0e+00
VED56594.1|3256973_3257339_-	Uncharacterised protein	NA	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
VED56595.1|3257396_3257858_-	Uncharacterised protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
VED56596.1|3257889_3258291_-	phage protein, HK97 gp10 family	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
VED56597.1|3258287_3258677_-	Uncharacterised protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.1e-56
VED56598.1|3258657_3258996_-	Uncharacterised protein	NA	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
VED56599.1|3258992_3259310_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.6e-45
VED56600.1|3259290_3259551_-	Uncharacterised protein	NA	Q6UAX5	Klebsiella_phage	62.7	7.4e-22
VED56601.1|3259609_3260896_-|head	peptidase U35, phage prohead HK97	head	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
VED56602.1|3260973_3261894_-|capsid	Phage capsid and scaffold	capsid	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
VED56603.1|3261930_3263190_-|portal	phage portal protein, HK97 family	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
VED56604.1|3263362_3265084_-|terminase	phage terminase	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
VED56605.1|3265083_3265518_-|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
VED56606.1|3265766_3266198_-	Uncharacterised protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
VED56607.1|3266194_3266518_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56608.1|3266815_3266980_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56609.1|3267158_3267383_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56610.1|3267421_3267859_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56611.1|3268807_3269158_-	Uncharacterised protein	NA	A0A0K2FIW3	Enterobacter_phage	37.7	6.0e-11
VED56612.1|3269154_3269652_-	phage lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	4.3e-79
VED56613.1|3269651_3269867_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	87.3	1.0e-29
VED56614.1|3270800_3271319_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56615.1|3271338_3272193_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56616.1|3272221_3272566_-	antitermination Q family protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
VED56617.1|3272578_3273610_-	Putative cytoplasmic protein	NA	S5MW46	Escherichia_phage	49.3	1.8e-95
VED56618.1|3273609_3273813_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56619.1|3273809_3274202_-|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
VED56620.1|3274544_3274778_-	DNA-damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
VED56621.1|3275432_3276794_+	pyrrolo-quinoline quinone repeat-containing protein	NA	NA	NA	NA	NA
VED56622.1|3277137_3278901_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
VED56623.1|3279213_3279654_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56624.1|3280124_3281108_-	Primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
VED56625.1|3281159_3281714_-	bacteriophage regulatory protein CII	NA	NA	NA	NA	NA
VED56626.1|3282033_3282423_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
VED56627.1|3283146_3283269_+	Gifsy-1 prophage protein	NA	NA	NA	NA	NA
VED56628.1|3283475_3283847_+	DNA-binding transcriptional regulator IscR	NA	NA	NA	NA	NA
VED56629.1|3283988_3286127_+	putative exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.9	3.3e-99
VED56630.1|3287650_3288901_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
VED56631.1|3289141_3289792_+	pseudouridine synthase	NA	NA	NA	NA	NA
VED56632.1|3289808_3290267_+	Nudix-like NDP and NTP phosphohydrolase YmfB	NA	NA	NA	NA	NA
VED56633.1|3290263_3291430_+|tRNA	tRNA-specific 2-thiouridylase mnmA	tRNA	NA	NA	NA	NA
>prophage 7
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	3401495	3449796	5457304	head,integrase,terminase,coat	Cronobacter_phage(20.37%)	67	3426443:3426458	3453076:3453091
VED56734.1|3401495_3402155_-	AP2 domain.	NA	A0A2I7R856	Vibrio_phage	49.0	6.4e-38
VED56735.1|3402156_3402375_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	50.7	1.1e-13
VED56736.1|3402591_3403761_-	DNA (cytosine-5-)-methyltransferase	NA	Q858D4	Salmonella_phage	68.8	1.2e-148
VED56737.1|3403757_3404414_-	adenine-specific DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	9.3e-114
VED56738.1|3404410_3404839_-	Uncharacterised protein	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
VED56739.1|3404835_3405516_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.5	6.0e-124
VED56740.1|3405512_3406358_-	RecT protein	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.0e-68
VED56741.1|3406373_3406658_-	Uncharacterised protein	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
VED56742.1|3406937_3407048_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56743.1|3407381_3407585_+	Uncharacterised protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	5.9e-19
VED56744.1|3407619_3408024_-	Uncharacterised protein	NA	A0A0P0ZDD3	Stx2-converting_phage	73.1	4.6e-47
VED56745.1|3408020_3408689_-	XRE family transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	87.3	1.3e-99
VED56746.1|3409089_3409575_-	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	81.4	1.5e-71
VED56747.1|3409883_3410117_+	antirepressor protein Cro	NA	A0A2H4FNF3	Salmonella_phage	71.8	1.0e-22
VED56748.1|3410156_3410378_+	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
VED56749.1|3410463_3410610_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56750.1|3410602_3411502_+	Uncharacterised protein	NA	A0A0N7C1Z7	Escherichia_phage	55.3	8.4e-81
VED56751.1|3411491_3412922_+	DnaB domain-containing protein	NA	Q9MCT4	Escherichia_phage	66.9	9.9e-185
VED56752.1|3412921_3413224_+	Uncharacterized protein conserved in archaea	NA	NA	NA	NA	NA
VED56753.1|3413220_3413631_+	Uncharacterised protein	NA	R9TME7	Aeromonas_phage	37.4	4.6e-10
VED56754.1|3413627_3413912_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56755.1|3413908_3414307_+	Phage EaD protein	NA	A0A2H4N7C3	Pectobacterium_phage	50.0	3.5e-07
VED56756.1|3414303_3415254_+	Protein of uncharacterised function (DUF551)	NA	A0A0S1S1U7	Klebsiella_phage	74.6	1.5e-19
VED56757.1|3415253_3415376_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56758.1|3415696_3415954_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	3.2e-25
VED56759.1|3416154_3416610_+	protein YbcN	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
VED56760.1|3416609_3416780_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
VED56761.1|3416772_3417354_+	bacteriophage lambda NinG family protein	NA	E7C9S3	Salmonella_phage	43.8	8.7e-39
VED56762.1|3417350_3417491_+	Gifsy-1 Prophage protein	NA	NA	NA	NA	NA
VED56763.1|3417487_3418171_+	phage antitermination protein Q	NA	I6PDF8	Cronobacter_phage	53.2	1.4e-59
VED56764.1|3418598_3418769_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56765.1|3418971_3419178_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56766.1|3419638_3419956_+	Uncharacterised protein	NA	A0A286N2Q5	Klebsiella_phage	98.0	7.3e-48
VED56767.1|3419942_3420392_+	muraminidase	NA	A0A0M4R365	Salmonella_phage	70.5	1.4e-57
VED56768.1|3420405_3420582_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56769.1|3420649_3421165_+	Uncharacterised protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
VED56770.1|3421164_3422637_+|terminase	phage terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	82.3	2.0e-249
VED56771.1|3422649_3424119_+	gp5	NA	F1C5D7	Cronobacter_phage	56.3	4.8e-150
VED56772.1|3424150_3425050_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	1.7e-113
VED56773.1|3425046_3425250_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED56774.1|3425300_3426656_+	gp7	NA	F1C5D9	Cronobacter_phage	53.3	1.0e-130
3426443:3426458	attL	CCAGCTGCAGGCCAAT	NA	NA	NA	NA
VED56775.1|3426655_3427117_+	Uncharacterised protein	NA	B1GS72	Salmonella_phage	50.3	3.8e-29
VED56776.1|3427113_3428169_+|coat	Phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.8	4.5e-102
VED56777.1|3428200_3428512_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56778.1|3428514_3428895_+	gp11	NA	F1C5E2	Cronobacter_phage	55.3	4.1e-29
VED56779.1|3429067_3429430_+	Uncharacterised protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	9.6e-20
VED56780.1|3429432_3429858_+	Uncharacterised protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
VED56781.1|3429854_3430247_+	Uncharacterised protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
VED56782.1|3430315_3431068_+	putative immunoglobulin domain protein	NA	G0ZNE6	Cronobacter_phage	42.5	5.8e-43
VED56783.1|3431120_3431591_+	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	58.2	1.4e-47
VED56784.1|3431574_3431799_+	Uncharacterised protein	NA	F1C5E8	Cronobacter_phage	59.4	5.6e-18
VED56785.1|3431976_3432732_+	KilA-N domain	NA	K7PGT4	Enterobacteria_phage	51.8	2.1e-61
VED56786.1|3432734_3432989_+	Uncharacterised protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
VED56787.1|3433063_3433498_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED56788.1|3433538_3433904_-	Arc-like DNA binding domain	NA	NA	NA	NA	NA
VED56789.1|3434017_3434185_+	Uncharacterised protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
VED56790.1|3434258_3435230_+	Phage anti-repressor protein	NA	A5VW58	Enterobacteria_phage	75.1	1.4e-86
VED56791.1|3435302_3438743_+	phage tape measure protein	NA	Q5G8W8	Enterobacteria_phage	46.0	2.8e-153
VED56792.1|3439335_3439812_+	Uncharacterised protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	7.4e-36
VED56793.1|3439811_3440282_+	Uncharacterised protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
VED56794.1|3440278_3440674_+	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	52.8	3.0e-35
VED56795.1|3440660_3443138_+	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	45.6	9.4e-199
VED56796.1|3443224_3445759_+	Uncharacterised protein	NA	A0A1I9SEN3	Klebsiella_phage	31.2	5.8e-63
VED56797.1|3446449_3447817_+	Group II intron-encoded protein ltrA	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.1e-31
VED56798.1|3448015_3448255_+	Uncharacterised protein	NA	K7P7N3	Enterobacteria_phage	48.1	3.0e-14
VED56799.1|3448254_3448572_+	umuDC operon protein-like protein	NA	K7PGV5	Enterobacterial_phage	50.0	9.0e-22
VED56800.1|3448605_3449796_-|integrase	putative integrase	integrase	Q716F9	Shigella_phage	85.6	4.8e-193
3453076:3453091	attR	ATTGGCCTGCAGCTGG	NA	NA	NA	NA
>prophage 8
LR134254	Klebsiella aerogenes strain NCTC9644 genome assembly, chromosome: 1	5457304	3596905	3606369	5457304	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
VED56925.1|3596905_3598627_+	Transport ATP-binding protein CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
VED56926.1|3598671_3599373_+|tRNA	Leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
VED56927.1|3599726_3599945_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VED56928.1|3600065_3602345_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
VED56929.1|3602375_3602693_-|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
VED56930.1|3603018_3603240_+	cold-shock DNA-binding protein family protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
VED56931.1|3603316_3605257_-	Macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
VED56932.1|3605253_3606369_-	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
LR134256	Klebsiella aerogenes strain NCTC9644 genome assembly, plasmid: 3	20968	725	13189	20968		Escherichia_phage(31.58%)	23	NA	NA
VED58656.1|725_1031_-	DnaB domain-containing protein	NA	K7PMA6	Enterobacterial_phage	69.3	6.2e-28
VED58657.1|1124_1301_-	Uncharacterised protein	NA	Q37929	Escherichia_phage	46.4	1.1e-10
VED58658.1|1357_2023_-	Uncharacterised protein	NA	A0A0N7C1Z7	Escherichia_phage	58.6	4.6e-52
VED58659.1|2015_2162_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58660.1|2247_2469_-	bacteriophage CII family protein	NA	A2SY75	Escherichia_phage	52.0	1.1e-05
VED58661.1|2508_2742_-	antirepressor protein Cro	NA	A0A2H4FNF3	Salmonella_phage	71.8	1.0e-22
VED58662.1|3048_3534_+	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	81.4	1.5e-71
VED58663.1|3934_4603_+	XRE family transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	87.3	1.3e-99
VED58664.1|4599_5004_+	Uncharacterised protein	NA	A0A0P0ZDD3	Stx2-converting_phage	73.1	4.6e-47
VED58665.1|5574_5685_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58666.1|5964_6249_+	Uncharacterised protein	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
VED58667.1|6374_6803_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	58.7	2.0e-40
VED58668.1|6843_7140_+	RecT protein	NA	A0A0M4RD39	Salmonella_phage	47.2	7.4e-10
VED58669.1|7102_7783_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.5	6.0e-124
VED58670.1|7779_8208_+	Uncharacterised protein	NA	M9NYX4	Enterobacteria_phage	80.3	1.3e-63
VED58671.1|8353_8812_+	adenine-specific DNA methyltransferase	NA	G8C7S6	Escherichia_phage	83.8	1.3e-58
VED58672.1|8852_9224_+	Uncharacterised protein	NA	E7EKU9	Edwardsiella_phage	66.0	3.1e-05
VED58673.1|9582_9864_+	Uncharacterised protein	NA	E7EKU9	Edwardsiella_phage	40.2	1.2e-06
VED58674.1|10228_10447_+	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	50.7	1.1e-13
VED58675.1|10448_11108_+	AP2 domain.	NA	A0A2I7QQK3	Vibrio_phage	40.0	9.9e-39
VED58676.1|10980_11508_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58677.1|11688_12171_+	Tryptophan synthase beta chain like	NA	NA	NA	NA	NA
VED58678.1|12538_13189_+	Uncharacterised protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.1e-05
>prophage 1
LR134257	Klebsiella aerogenes strain NCTC9644 genome assembly, plasmid: 4	224165	5000	124020	224165	transposase,integrase	Escherichia_phage(14.0%)	116	41253:41280	130622:130649
VED58699.1|5000_5504_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.6	2.2e-91
VED58700.1|5781_6342_+|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	83.0	7.5e-72
VED58701.1|6474_6786_+	mRNA interferase HigB	NA	NA	NA	NA	NA
VED58702.1|6782_7202_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
VED58703.1|7393_8317_+|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
VED58704.1|8550_9045_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58705.1|9086_12056_-|transposase	TnpA transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
VED58706.1|12058_12616_-	Resolvase for Tn21	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
VED58707.1|12745_13822_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
VED58708.1|13818_16224_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
VED58709.1|16309_16744_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VED58710.1|17039_18440_-	two-component system, OmpR family, heavy metal sensor histidine kinase CusS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
VED58711.1|18436_19117_-	two component heavy metal response transcriptional regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
VED58712.1|19171_20101_-	copper resistance protein D	NA	NA	NA	NA	NA
VED58713.1|20105_20486_-	copper resistance protein C	NA	NA	NA	NA	NA
VED58714.1|20525_21422_-	Uncharacterized protein involved in copper resistance	NA	NA	NA	NA	NA
VED58715.1|21421_23239_-	copper-resistance protein, CopA family	NA	NA	NA	NA	NA
VED58716.1|23472_23922_+	copper-binding protein PcoE	NA	NA	NA	NA	NA
VED58717.1|24210_24948_+	putative peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
VED58718.1|24981_25179_-	Protein of uncharacterised function (DUF2933).	NA	NA	NA	NA	NA
VED58719.1|25219_27667_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
VED58720.1|27793_28234_-	Predicted metal-binding protein	NA	NA	NA	NA	NA
VED58721.1|28320_31467_-	cation efflux system protein SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
VED58722.1|31477_32770_-	copper/silver efflux system membrane fusion protein CusB	NA	NA	NA	NA	NA
VED58723.1|32883_33246_-	copper/silver efflux system protein CusF	NA	NA	NA	NA	NA
VED58724.1|33274_34660_-	Copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VED58725.1|34849_35530_+	transcriptional regulatory protein CusR	NA	W8CYM9	Bacillus_phage	35.3	3.0e-30
VED58726.1|35522_35867_+	sensor kinase CusS	NA	NA	NA	NA	NA
VED58727.1|35925_36993_+	sensor kinase CusS	NA	W8CYF6	Bacillus_phage	30.1	7.5e-28
VED58728.1|37243_37675_+	silver binding protein precursor SilE	NA	NA	NA	NA	NA
VED58729.1|37818_38169_+	Uncharacterized protein conserved in bacteria	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
VED58730.1|38555_39464_-	HNH endonuclease	NA	NA	NA	NA	NA
VED58731.1|40100_41075_+	FOG: GGDEF domain	NA	NA	NA	NA	NA
41253:41280	attL	AGATCCGAAAAAAGGTAGTTCCGGATCT	NA	NA	NA	NA
VED58732.1|41914_42820_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58733.1|42816_43596_+	Resolvase	NA	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
VED58734.1|43740_44670_-	Transposase	NA	Q2A0A7	Sodalis_phage	52.4	5.6e-72
VED58735.1|45119_46592_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58736.1|47478_47607_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58737.1|47826_48693_+	Chromosome (plasmid) partitioning protein ParA, Sporulation initiation inhibitor protein Soj	NA	NA	NA	NA	NA
VED58738.1|48692_49724_+	Chromosome (plasmid) partitioning protein ParB, Stage 0 sporulation protein J	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
VED58739.1|50530_51154_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58740.1|51196_51724_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58741.1|52507_53290_-	ISPsy4, transposition helper protein	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
VED58742.1|53286_53919_-	Transposase and inactivated derivatives	NA	A0A2L1IVA1	Escherichia_phage	90.0	1.5e-113
VED58743.1|53925_54309_-	Transposase and inactivated derivatives	NA	A0A2L1IVA1	Escherichia_phage	92.1	1.3e-59
VED58744.1|55936_56053_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58745.1|56040_56577_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58746.1|57434_57803_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
VED58747.1|57787_58075_+|integrase	integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	56.0	1.3e-19
VED58748.1|58896_59907_-	initiator RepB protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
VED58749.1|60636_61803_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
VED58750.1|61802_62774_+	plasmid-partitioning protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
VED58751.1|63979_64126_-	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.0	2.6e-08
VED58752.1|64358_64799_+	Transposase	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
VED58753.1|64795_65146_+	Transposase and inactivated derivatives	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
VED58754.1|65176_66769_+	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
VED58755.1|66854_67028_+|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	94.5	1.4e-21
VED58756.1|67037_68006_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
VED58757.1|68248_68386_+|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	91.1	4.6e-15
VED58758.1|68592_69249_+|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	84.9	3.4e-108
VED58759.1|69269_69713_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58760.1|69722_70130_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58761.1|70172_71132_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
VED58762.1|71128_71599_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58763.1|71883_72207_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58764.1|72358_72676_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58765.1|72741_73878_-	Site-specific recombinase XerD	NA	NA	NA	NA	NA
VED58766.1|74464_74605_-|transposase	putative transposase	transposase	Q9MCT5	Escherichia_phage	100.0	1.3e-17
VED58767.1|74989_75388_-|transposase	putative transposase	transposase	Q1MVF0	Enterobacteria_phage	95.5	2.3e-67
VED58768.1|75992_76529_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58769.1|76662_77517_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58770.1|77677_78562_-	initiator RepB protein	NA	J9Q7H0	Salmonella_phage	42.8	4.4e-50
VED58771.1|79777_80260_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58772.1|80502_80817_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58773.1|81425_82826_-	protein YjiR	NA	NA	NA	NA	NA
VED58774.1|83192_83675_+	MSMEG_0572 family protein	NA	NA	NA	NA	NA
VED58775.1|83688_84690_+	N-carbamoylputrescine amidase	NA	NA	NA	NA	NA
VED58776.1|84649_85759_+	ribosomal RNA large subunit methyltransferase N	NA	NA	NA	NA	NA
VED58777.1|85769_86333_+	putative N-acetyltransferase, MSMEG_0567 N-terminal domain family	NA	NA	NA	NA	NA
VED58778.1|86329_87292_+	Phosphoribosylformylglycinamidine synthase 2	NA	NA	NA	NA	NA
VED58779.1|87303_87594_+	MSMEG_0570 family protein	NA	NA	NA	NA	NA
VED58780.1|87611_88877_+	monooxygenase, putative	NA	NA	NA	NA	NA
VED58781.1|88857_90357_+	propionate/CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	31.1	1.8e-35
VED58782.1|91387_91600_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58783.1|91693_91972_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED58784.1|92519_92924_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VED58785.1|93000_93147_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58786.1|93199_93682_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58787.1|94060_95560_-	protein kinase	NA	NA	NA	NA	NA
VED58788.1|95587_97321_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58789.1|97320_98361_-	tellurium resistance protein	NA	NA	NA	NA	NA
VED58790.1|98453_99092_-	tellurium resistance protein	NA	NA	NA	NA	NA
VED58791.1|99092_99734_-	tellurium resistance protein terX	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
VED58792.1|99758_100397_-	tellurium resistance protein TerY	NA	NA	NA	NA	NA
VED58793.1|100876_101335_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
VED58794.1|101337_102561_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58795.1|102571_103528_-	Citrate lyase beta subunit	NA	NA	NA	NA	NA
VED58796.1|103527_104607_-	ATP-binding protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
VED58797.1|104608_105382_-	mannosyl-3-phosphoglycerate phosphatase family	NA	NA	NA	NA	NA
VED58798.1|105374_106517_-	Protein of uncharacterised function (DUF3706)	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
VED58799.1|106528_107587_-	carbamoyl phosphate synthase-like protein	NA	NA	NA	NA	NA
VED58800.1|107897_108482_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
VED58801.1|108478_109630_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
VED58802.1|109652_110108_+	tellurite resistance protein TerB	NA	NA	NA	NA	NA
VED58803.1|110131_111172_+	Tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
VED58804.1|111210_111789_+	Tellurium resistance protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
VED58805.1|111875_112451_+	Tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
VED58806.1|112535_113777_+	Tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
VED58807.1|114113_114761_-	HAD family hydrolase	NA	NA	NA	NA	NA
VED58808.1|115262_116087_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	88.6	1.5e-140
VED58809.1|116492_117353_-	protein YcjY	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
VED58810.1|117515_118076_-	resolvase domain-containing protein	NA	A0A0F7LA37	Escherichia_phage	39.2	1.0e-20
VED58811.1|118194_121134_-|transposase	transposase Tn3 family protein	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
VED58812.1|121165_121693_-	Cupin	NA	NA	NA	NA	NA
VED58813.1|121805_122819_+	alcohol dehydrogenase protein	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
VED58814.1|123024_124020_-	Transposase	NA	A0A1S7J231	Thermus_phage	28.7	3.1e-20
130622:130649	attR	AGATCCGGAACTACCTTTTTTCGGATCT	NA	NA	NA	NA
>prophage 2
LR134257	Klebsiella aerogenes strain NCTC9644 genome assembly, plasmid: 4	224165	163404	222502	224165	transposase,tRNA	Shigella_phage(25.0%)	58	NA	NA
VED58856.1|163404_163677_+|transposase	IS1 transposase orfA	transposase	A0A0U2RK18	Escherichia_phage	83.3	1.0e-34
VED58857.1|164439_165093_-	putative SAM-dependent methyltransferases	NA	NA	NA	NA	NA
VED58858.1|165680_166268_+	Bacterial regulatory proteins, luxR family	NA	NA	NA	NA	NA
VED58859.1|166648_167200_+	colanic acid capsular biosynthesis activation protein A	NA	NA	NA	NA	NA
VED58860.1|167272_168175_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
VED58861.1|168317_168539_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58862.1|168600_170775_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
VED58863.1|171234_172464_-	Enterochelin esterase and related enzymes	NA	NA	NA	NA	NA
VED58864.1|172568_176213_-	putative ABC transporter	NA	W8CYL7	Bacillus_phage	29.5	7.2e-46
VED58865.1|176355_177471_-	Glycosyltransferase IroB	NA	NA	NA	NA	NA
VED58866.1|177820_178465_-	Predicted transcriptional regulators	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
VED58867.1|178449_179682_-	PP-loop domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
VED58868.1|179671_180031_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58869.1|180138_180330_-|transposase	IS911 transposase orfB	transposase	NA	NA	NA	NA
VED58870.1|180569_181091_+	ECF subfamily RNA polymerase sigma-24 subunit	NA	NA	NA	NA	NA
VED58871.1|181087_181609_+	FecR anti-FecI sigma factor	NA	NA	NA	NA	NA
VED58872.1|182127_184254_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
VED58873.1|185551_185995_+	TIGR02293 family toxin-antitoxin system antitoxin component	NA	NA	NA	NA	NA
VED58874.1|185991_186462_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VED58875.1|186804_187308_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.6	2.2e-91
VED58876.1|188693_189344_-	Protein of uncharacterised function (DUF1173)	NA	NA	NA	NA	NA
VED58877.1|189820_190315_+	ParB	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
VED58878.1|190651_191050_+	global DNA-binding transcriptional dual regulator H-NS	NA	NA	NA	NA	NA
VED58879.1|191367_192207_-	Methylglyoxal reductase, acetol producing / 2,5-diketo-D-gluconate reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
VED58880.1|192203_192683_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VED58881.1|193683_195459_-	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VED58882.1|195477_197004_-	Dipeptide-binding ABC transporter, periplasmic substrate-binding component (TC 3.A.1.5.2); Putative hemin-binding lipoprotein	NA	NA	NA	NA	NA
VED58883.1|197014_198259_-	membrane protein	NA	NA	NA	NA	NA
VED58884.1|198285_199119_-	nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
VED58885.1|199115_199925_-	oligopeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	2.8e-11
VED58886.1|200153_200828_-	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
VED58887.1|201229_201376_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58888.1|201409_201535_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58889.1|201538_202024_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58890.1|202120_202690_+	Transposase and inactivated derivatives	NA	NA	NA	NA	NA
VED58891.1|203482_203983_-	transcriptional regulator	NA	NA	NA	NA	NA
VED58892.1|204127_204529_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
VED58893.1|204565_205786_+	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	NA	NA	NA	NA	NA
VED58894.1|205845_206052_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED58895.1|206054_207704_-	Ferrous iron transport protein B	NA	NA	NA	NA	NA
VED58896.1|207714_208845_-	Thioredoxin reductase	NA	NA	NA	NA	NA
VED58897.1|208915_209188_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED58898.1|209239_210226_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	F1C979	Terra1_virus	34.8	1.4e-44
VED58899.1|210207_210297_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED58900.1|210376_210829_-	Peroxide operon regulator	NA	NA	NA	NA	NA
VED58901.1|210926_212126_+	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	NA	NA	NA	NA	NA
VED58902.1|212196_212619_+	C4-type zinc finger protein, DksA/TraR family	NA	NA	NA	NA	NA
VED58903.1|212682_213618_+	GTP cyclohydrolase I type 2	NA	NA	NA	NA	NA
VED58904.1|213607_214168_+	Carbonic anhydrase, gamma class	NA	NA	NA	NA	NA
VED58905.1|214297_215164_+	NADPH dependent preQ0 reductase	NA	A0A140B3P3	Vibrio_phage	25.2	1.4e-11
VED58906.1|215180_216005_-	Protein of uncharacterised function (DUF1460)	NA	NA	NA	NA	NA
VED58907.1|216434_217436_+|tRNA	Threonyl-tRNA synthetase	tRNA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
VED58908.1|217428_218280_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58909.1|218276_219623_+	Dihydroorotase	NA	NA	NA	NA	NA
VED58910.1|219686_220709_+	Porphobilinogen synthase	NA	NA	NA	NA	NA
VED58911.1|221274_221541_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	86.4	3.0e-39
VED58912.1|221534_222089_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	81.4	8.5e-76
VED58913.1|222136_222502_-|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	95.0	2.9e-56
>prophage 1
LR134258	Klebsiella aerogenes strain NCTC9644 genome assembly, plasmid: 5	30387	29	22674	30387	tail,capsid,terminase,protease,portal,head	Klebsiella_phage(62.5%)	25	NA	NA
VED58916.1|29_527_+|terminase	Phage terminase small subunit	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
VED58917.1|530_1322_+|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	80.0	2.2e-117
VED58918.1|1266_2283_+|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	68.2	2.9e-130
VED58919.1|2279_2441_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED58920.1|2430_3657_+|portal	HK97 family phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
VED58921.1|3649_4249_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
VED58922.1|4258_5131_+|capsid	HK97 family phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.9	2.6e-95
VED58923.1|5186_5498_+|capsid	HK97 family phage major capsid protein	capsid	Q8SBH8	Shigella_phage	78.6	5.9e-42
VED58924.1|5966_6164_+	Uncharacterised protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
VED58925.1|6165_6498_+|head,tail	phage head-tail adaptor	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
VED58926.1|6490_7030_+	phage protein, HK97 gp10 family	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
VED58927.1|7026_7392_+	Protein of uncharacterised function (DUF3168)	NA	A0A286S1R1	Klebsiella_phage	93.4	1.3e-61
VED58928.1|7448_7700_+	Uncharacterised protein	NA	A0A286S1Q8	Klebsiella_phage	98.8	1.3e-39
VED58929.1|7984_8338_+	Uncharacterised protein	NA	A0A286S1N4	Klebsiella_phage	98.3	2.4e-60
VED58930.1|8370_8634_+	Uncharacterised protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
VED58931.1|9159_9705_+|tail	prophage tail length tape measure	tail	A0A286S1S3	Klebsiella_phage	99.4	3.7e-84
VED58932.1|9718_11596_+|tail	prophage tail length tape measure	tail	A0A286S1S3	Klebsiella_phage	84.3	3.4e-286
VED58933.1|12064_12547_+	Domain of uncharacterised function (DUF1833)	NA	A0A286S2B1	Klebsiella_phage	68.4	6.5e-56
VED58934.1|12711_12936_+	COG2116: Formate/nitrite family of transporters	NA	A0A286S2A6	Klebsiella_phage	62.3	1.4e-16
VED58935.1|12932_16001_+	Uncharacterised protein	NA	A0A286S259	Klebsiella_phage	69.0	0.0e+00
VED58936.1|16078_17170_+	Uncharacterised protein	NA	A0A286S1P0	Klebsiella_phage	82.8	6.4e-51
VED58937.1|17153_19235_+	Uncharacterised protein	NA	A0A1I9SEN3	Klebsiella_phage	37.4	6.6e-97
VED58938.1|19332_20142_-	Uncharacterised protein	NA	A0A2H4N7C5	Pectobacterium_phage	42.9	1.4e-50
VED58939.1|20141_22031_-	Uncharacterised protein	NA	A0A2H4N7A3	Pectobacterium_phage	51.5	1.4e-149
VED58940.1|22122_22674_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	100.0	3.7e-95
