The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	39119	47832	4857140		Enterobacteria_phage(85.71%)	10	NA	NA
VED71646.1|39119_40157_-	putative virulence protein	NA	Q9JMN3	Wolbachia_phage	42.8	2.0e-70
VED71649.1|40230_40347_-	restriction methylase	NA	NA	NA	NA	NA
VED71652.1|41017_43351_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
VED71655.1|43365_43686_-	P4 phage protein	NA	NA	NA	NA	NA
VED71658.1|43821_44277_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VED71661.1|44269_44557_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.9e-47
VED71664.1|45136_45355_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	2.6e-36
VED71667.1|45954_46689_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.5	1.3e-127
VED71670.1|46685_47186_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VED71673.1|47259_47832_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	8.5e-95
>prophage 2
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	309596	348937	4857140	plate,terminase,tail,protease,tRNA,portal,capsid,integrase	Shigella_phage(50.0%)	58	308821:308837	347987:348003
308821:308837	attL	ATTGCTCCTATGCTCGA	NA	NA	NA	NA
VED72326.1|309596_310031_+	toxin YafO	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
VED72329.1|310057_310330_-	phage protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
VED72332.1|310366_310939_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	5.1e-108
VED72335.1|310938_311250_-	Uncharacterised protein	NA	A0A2H4N7F8	Pectobacterium_phage	42.6	6.3e-12
VED72338.1|311246_311630_-	phage protein	NA	A5LH60	Enterobacteria_phage	70.5	1.3e-27
VED72341.1|311631_311823_-	Uncharacterised protein	NA	G9L660	Escherichia_phage	95.2	5.2e-25
VED72344.1|311824_312406_-	CPS-53 (KpLE1) prophage protein	NA	Q9MCT8	Escherichia_phage	76.3	3.2e-97
VED72347.1|312402_312939_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	1.1e-99
VED72349.1|313066_313891_-	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	99.3	1.7e-149
VED72352.1|313956_314319_-	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VED72355.1|314760_314952_+	Uncharacterised protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
VED72358.1|315462_316095_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED72361.1|316091_316454_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED72364.1|316498_317260_-	DNA-binding/peptidase S24 domain protein	NA	G8C7U1	Escherichia_phage	59.0	3.1e-68
VED72367.1|317309_317573_+	antirepressor protein Cro	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
VED72370.1|317526_318186_+	phage protein	NA	A0A1C9II13	Salmonella_phage	60.3	3.1e-56
VED72373.1|319342_319567_+	Uncharacterised protein	NA	A5LH70	Enterobacteria_phage	98.6	7.5e-39
VED72376.1|319563_320382_+	replication protein from phage	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
VED72379.1|320476_321130_+	putative phage AdoMet-dependent methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	8.7e-128
VED72382.1|321126_321453_+	putative LexA repressor	NA	Q8SBE8	Shigella_phage	99.1	1.2e-53
VED72385.1|321449_321839_+	putative Crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
VED72388.1|321858_322668_+	KilA-N domain protein	NA	Q8SBE6	Shigella_phage	99.6	3.0e-154
VED72391.1|322675_323665_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
VED72394.1|323678_324431_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	Q8SBE4	Shigella_phage	99.6	6.2e-138
VED72397.1|324581_324839_+	phage membrane protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	1.2e-37
VED72400.1|324918_325305_+	phage membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
VED72402.1|325291_325573_+	phage membrane protein	NA	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
VED72405.1|325572_326187_+	phage endolysin	NA	A0A192Y6G4	Salmonella_phage	97.5	4.1e-111
VED72409.1|326183_326576_+	phage lysozyme	NA	A0A192Y6H8	Salmonella_phage	89.2	4.1e-56
VED72412.1|327009_327405_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED72415.1|327546_327897_+	putative phage endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
VED72418.1|328022_328517_+|terminase	phage terminase small subunit	terminase	U5P067	Shigella_phage	98.8	2.5e-87
VED72421.1|328513_330247_+|terminase	phage terminase, large subunit	terminase	U5P0Q5	Shigella_phage	97.7	0.0e+00
VED72424.1|330243_330405_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED72427.1|330394_331621_+|portal	putative phage portal protein	portal	Q8SBI0	Shigella_phage	99.0	1.1e-240
VED72430.1|331613_332216_+|capsid,protease	putative capsid protease	capsid,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
VED72433.1|332226_333456_+|capsid	phage capsid protein	capsid	Q8SBH8	Shigella_phage	99.5	3.4e-226
VED72436.1|333534_333858_+	phage protein	NA	Q8SBH7	Shigella_phage	100.0	3.5e-53
VED72439.1|333854_334265_+	prophage protein	NA	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
VED72442.1|334239_334746_+	prophage protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
VED72445.1|334742_335303_+	phage protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
VED72448.1|335311_335482_+	phage protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
VED72452.1|335465_336962_+|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	5.0e-272
VED72455.1|336961_337318_+	phage protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
VED72458.1|337317_337587_+	phage protein	NA	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
VED72461.1|337728_339561_+|tail	bacteriophage V tail protein	tail	S5FM63	Shigella_phage	98.5	3.9e-303
VED72464.1|339593_340040_-|tRNA	tRNA_anti-like	tRNA	NA	NA	NA	NA
VED72467.1|340150_341479_+	Tail/DNA circulation protein	NA	Q8SBG8	Shigella_phage	98.9	1.6e-245
VED72470.1|341475_342555_+|tail	putative phage tail protein	tail	U5P0H6	Shigella_phage	100.0	5.3e-207
VED72473.1|342554_343103_+|plate	putative phage baseplate protein	plate	U5P081	Shigella_phage	96.7	1.1e-94
VED72476.1|343102_343528_+|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	98.6	4.4e-80
VED72479.1|343514_344573_+|plate	putative phage baseplate protein	plate	U5P424	Shigella_phage	98.6	4.7e-200
VED72482.1|344563_345148_+|tail	putative phage tail protein	tail	O22003	Shigella_phage	100.0	1.1e-113
VED72485.1|345151_345793_+|tail	tail fiber protein	tail	M1FN94	Enterobacteria_phage	63.4	2.5e-63
VED72488.1|345795_346236_+|tail	tail assembly chaperone gp38	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.3e-50
VED72491.1|346403_346652_-	DNA damage-inducible protein	NA	K7PLW4	Enterobacteria_phage	98.8	1.8e-38
VED72494.1|346713_347811_-|integrase	phage integrase	integrase	S5MDN5	Escherichia_phage	99.2	6.2e-211
VED72497.1|347899_348937_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
347987:348003	attR	ATTGCTCCTATGCTCGA	NA	NA	NA	NA
>prophage 3
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	1736443	1810335	4857140	plate,terminase,tail,holin,protease,tRNA,portal,capsid	Enterobacteria_phage(64.15%)	73	NA	NA
VED76115.1|1736443_1736764_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	9.1e-14
VED76118.1|1736794_1739071_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.7	1.5e-166
VED76121.1|1741179_1742163_+	CRISPR-associated protein Cas1, YPEST subtype	NA	A0A2D0YFC9	Vibrio_phage	34.9	7.6e-43
VED76124.1|1742159_1745393_+	putative CRISPR-associated helicase	NA	A0A2I7RCU8	Vibrio_phage	29.1	4.7e-65
VED76127.1|1745718_1747026_+	CRISPR-associated protein, Csy1 family	NA	NA	NA	NA	NA
VED76130.1|1747022_1747946_+	CRISPR type I-F/YPEST-associated protein Csy2	NA	NA	NA	NA	NA
VED76133.1|1747956_1748958_+	CRISPR-associated protein, Csy3 family	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
VED76135.1|1748968_1749523_+	CRISPR-associated protein, Csy4 family	NA	NA	NA	NA	NA
VED76138.1|1749908_1750457_+	Paral fimbrial-like protein	NA	NA	NA	NA	NA
VED76141.1|1750510_1751191_+	periplasmic chaperone protein, protein	NA	NA	NA	NA	NA
VED76144.1|1751205_1753692_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VED76147.1|1753703_1754717_+	P pilus assembly protein, pilin FimA	NA	NA	NA	NA	NA
VED76149.1|1755702_1755921_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
VED76152.1|1756205_1756910_-|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VED76155.1|1756954_1758676_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.0	1.9e-20
VED76158.1|1758676_1760443_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	1.1e-23
VED76161.1|1760565_1761531_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	7.2e-62
VED76164.1|1762075_1762570_+	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VED76167.1|1762704_1766817_+	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	1.2e-86
VED76170.1|1766971_1767583_+	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VED76173.1|1767592_1768936_+	putative ATPase	NA	G3MBE0	Bacillus_virus	40.6	6.2e-80
VED76176.1|1769026_1770319_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VED76179.1|1770552_1770933_-	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
VED76182.1|1770932_1771559_-	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
VED76185.1|1771957_1772218_-	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VED76188.1|1772260_1773370_-	Gene late control D protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
VED76191.1|1773527_1774712_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	99.5	4.3e-226
VED76194.1|1774711_1775224_+|tail	Major tail tube protein FII	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
VED76197.1|1775279_1775654_+|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	74.0	4.7e-38
VED76200.1|1775804_1778612_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	94.3	0.0e+00
VED76203.1|1778624_1779113_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
VED76206.1|1779150_1779741_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.3e-86
VED76209.1|1779771_1780161_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	43.5	1.4e-13
VED76213.1|1780163_1780604_+|tail	tail assembly chaperone gp38	tail	A0A0F7LDZ0	Escherichia_phage	62.6	3.9e-47
VED76216.1|1780575_1781178_-|tail	tail fiber assembly	tail	M1SV83	Escherichia_phage	89.5	2.8e-96
VED76219.1|1781177_1782791_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	58.6	6.2e-151
VED76222.1|1782787_1783396_-	Tail protein I	NA	A0A0F7LA36	Escherichia_phage	75.4	5.3e-87
VED76225.1|1783388_1784285_-|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
VED76228.1|1784288_1784639_-|plate	Baseplate assembly protein W	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	6.0e-59
VED76231.1|1784635_1785217_-|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
VED76234.1|1785213_1785849_-|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	98.1	1.3e-112
VED76237.1|1785841_1786309_-|tail	Phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	1.2e-83
VED76240.1|1786446_1786794_-	Uncharacterised protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.5	6.3e-53
VED76243.1|1786850_1787243_-	putative phage PS3	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	4.9e-70
VED76247.1|1787239_1787563_-|holin	putative phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
VED76250.1|1787565_1787766_-	Tail protein X (GpX)	NA	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
VED76253.1|1787765_1788260_-	Head completion/stabilization protein L	NA	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
VED76257.1|1788361_1789162_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	8.7e-122
VED76260.1|1789207_1790260_-|capsid	Major capsid protein precursor (GpN)	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
VED76263.1|1790283_1791120_-	Capsid scaffolding protein O	NA	A0A0A7NRY7	Enterobacteria_phage	97.1	4.1e-146
VED76266.1|1791274_1793026_+	Terminase, ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
VED76270.1|1793025_1794072_+|capsid,portal	portal capsid protein Q (GpQ)	capsid,portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
VED76273.1|1794086_1794611_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76279.1|1795433_1795721_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76282.1|1795787_1796066_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76285.1|1796376_1796691_-	stability/partitioning protein phage encoded (plasmid partition protein) (modular protein)	NA	A0A0A7NPT5	Enterobacteria_phage	51.0	3.5e-18
VED76288.1|1796695_1797655_-	Plasmid segregation protein parM (Protein stbA) (ParA locus 36 kDa protein)	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
VED76291.1|1797731_1800557_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	85.8	0.0e+00
VED76294.1|1800553_1800943_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76297.1|1801616_1802447_-|protease	putative serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
VED76300.1|1802443_1802647_-	Uncharacterised protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
VED76303.1|1802643_1802862_-	Uncharacterised protein	NA	A0A0A7NRX6	Enterobacteria_phage	63.8	5.2e-13
VED76306.1|1802858_1803062_-	Uncharacterised protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	5.5e-25
VED76309.1|1803085_1803502_-	Prophage protein	NA	NA	NA	NA	NA
VED76312.1|1803594_1803708_-	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
VED76315.1|1803704_1803947_-	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
VED76318.1|1803958_1804237_-	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
VED76321.1|1804247_1804706_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	4.7e-56
VED76324.1|1804933_1805455_-	Cox protein	NA	NA	NA	NA	NA
VED76327.1|1805559_1805901_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
VED76330.1|1805970_1806963_+	Putative Integrase	NA	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
VED76333.1|1807262_1809707_+	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	50.2	1.7e-221
VED76336.1|1809717_1810335_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 4
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	1885405	1947325	4857140	terminase,head,holin,tail,protease,portal,capsid,integrase	Escherichia_phage(38.1%)	73	1900593:1900608	1916493:1916508
VED76501.1|1885405_1887166_-|protease	protease La	protease	NA	NA	NA	NA
VED76504.1|1887353_1887806_+	putative dehydrogenase	NA	NA	NA	NA	NA
VED76506.1|1887880_1888933_-	outer membrane protein A	NA	NA	NA	NA	NA
VED76508.1|1889288_1889798_-	SOS cell division inhibitor	NA	NA	NA	NA	NA
VED76510.1|1890015_1890645_+	putative DNA transformation protein with TfoX domain	NA	NA	NA	NA	NA
VED76513.1|1890607_1892761_-	membrane protein YccS	NA	NA	NA	NA	NA
VED76515.1|1892779_1893226_-	putative inner membrane protein YccF	NA	NA	NA	NA	NA
VED76517.1|1893348_1895403_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	9.0e-22
VED76520.1|1895434_1895893_-	methylglyoxal synthase	NA	NA	NA	NA	NA
VED76523.1|1895988_1896651_-	Uncharacterized protein conserved in bacteria (DUF2057)	NA	NA	NA	NA	NA
VED76526.1|1896823_1897237_+	putative CoA-binding protein	NA	NA	NA	NA	NA
VED76529.1|1897281_1897599_-	DNA-binding protein	NA	NA	NA	NA	NA
VED76532.1|1897656_1898832_-	putative oxidoreductase	NA	NA	NA	NA	NA
VED76535.1|1898941_1899220_+	acylphosphatase	NA	NA	NA	NA	NA
VED76538.1|1899216_1899552_-	Sulfurtransferase tusE	NA	NA	NA	NA	NA
VED76541.1|1899637_1900297_-	putative carrier/transport protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1900593:1900608	attL	ACGCAAAATGGCTGAA	NA	NA	NA	NA
VED76544.1|1900705_1901725_-|integrase	integrase from prophage	integrase	A0A192Y7M7	Salmonella_phage	49.1	2.4e-84
VED76547.1|1902011_1904468_-	Exodeoxyribonuclease VIII from bacteriophage origin	NA	V5UQJ3	Shigella_phage	45.7	3.6e-110
VED76550.1|1904558_1904750_-	phage protein	NA	NA	NA	NA	NA
VED76553.1|1904746_1904935_-	cell division inhibition protein	NA	NA	NA	NA	NA
VED76556.1|1904951_1905245_+	ybl82	NA	NA	NA	NA	NA
VED76559.1|1905234_1905609_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76562.1|1905631_1905850_-	putative prophage protein	NA	NA	NA	NA	NA
VED76565.1|1905942_1906143_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED76568.1|1906554_1906842_-	putative plasmid stabilization-like protein from prophage	NA	NA	NA	NA	NA
VED76571.1|1906841_1907033_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76574.1|1907060_1907462_-	regulatory protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
VED76577.1|1907571_1907844_+	antirepressor protein Cro	NA	H6WRX5	Salmonella_phage	50.0	1.1e-12
VED76580.1|1907827_1908349_+	YdfX	NA	NA	NA	NA	NA
VED76583.1|1908329_1909295_+	ybl78	NA	U5P0A0	Shigella_phage	63.6	1.6e-58
VED76586.1|1909335_1909755_+	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	6.2e-63
VED76589.1|1909751_1910051_+	phage protein	NA	A0A0U2SAZ1	Escherichia_phage	80.8	3.7e-41
VED76592.1|1910037_1910706_+	EA22-like protein; similarities with EA22 from lambda (modular protein involved in blocking host replication)	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	71.8	2.5e-82
VED76596.1|1910665_1911064_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.4e-58
VED76599.1|1911161_1911677_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	60.7	1.3e-33
VED76602.1|1911696_1912245_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76605.1|1912231_1913161_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76608.1|1914664_1915714_+	putative prophage protein	NA	U5P0K4	Shigella_phage	53.4	2.7e-107
VED76611.1|1915726_1916086_+	crossover junction endodeoxyribonuclease rusA	NA	V5URS4	Shigella_phage	63.5	6.6e-37
VED76614.1|1916094_1916637_+	late gene regulator	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
1916493:1916508	attR	ACGCAAAATGGCTGAA	NA	NA	NA	NA
VED76617.1|1916868_1917066_+	lipoprotein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
VED76620.1|1917216_1918263_+	DNA methylase	NA	Q8W637	Enterobacteria_phage	92.8	1.6e-192
VED76623.1|1919159_1919552_+|holin	putative phage holin	holin	Q9MBZ5	Enterobacteria_phage	97.7	3.1e-56
VED76626.1|1919541_1919817_+|holin	putative phage holin	holin	Q9MBZ4	Enterobacteria_phage	96.7	1.6e-43
VED76629.1|1919819_1920197_+	putative phage endolysin	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
VED76632.1|1920441_1920648_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED76635.1|1920709_1921060_+	putative prophage endonuclease	NA	A0A1B5FP94	Escherichia_phage	95.7	5.8e-62
VED76638.1|1921206_1921689_+|terminase	putative prophage terminase, small subunit	terminase	A0A1B5FPA0	Escherichia_phage	96.2	2.8e-83
VED76641.1|1921688_1923446_+|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
VED76644.1|1923457_1923640_+	prophage protein	NA	A0A1B5FP99	Escherichia_phage	78.3	1.8e-19
VED76647.1|1923639_1924881_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.9	1.2e-231
VED76650.1|1924858_1925509_+|head,protease	pro-head protease	head,protease	Q8W628	Enterobacteria_phage	97.2	3.6e-118
VED76653.1|1925522_1926749_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.7	1.2e-183
VED76656.1|1926793_1927111_+	phage protein	NA	A0A1W6JNZ5	Morganella_phage	51.5	1.6e-23
VED76659.1|1927119_1927458_+|head,tail	putative prophage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	92.0	1.5e-51
VED76662.1|1927457_1927904_+	prophage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
VED76665.1|1927900_1928245_+	putative prophage protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.6e-56
VED76668.1|1928253_1929009_+|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	95.7	3.6e-117
VED76671.1|1929023_1929395_+|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	98.4	9.4e-63
VED76674.1|1929418_1929697_+	prophage protein	NA	A0A1B5FP87	Escherichia_phage	97.8	6.2e-43
VED76677.1|1929742_1932970_+|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	97.4	0.0e+00
VED76681.1|1932962_1933304_+|tail	prophage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
VED76685.1|1933303_1934002_+|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	97.8	4.0e-131
VED76689.1|1934151_1934751_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	93.5	5.3e-116
VED76693.1|1934747_1935296_+	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.7	6.4e-92
VED76698.1|1935356_1938836_+	Host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.1	0.0e+00
VED76702.1|1938903_1939503_+	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.9e-105
VED76705.1|1939566_1941039_+|tail	tail fiber protein (modular protein)	tail	A0A0P0ZCC1	Stx2-converting_phage	70.4	9.0e-40
VED76709.1|1941167_1942307_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED76713.1|1943103_1944222_+	hydrogenase 1, small subunit	NA	NA	NA	NA	NA
VED76717.1|1944218_1946012_+	hydrogenase-1 large subunit	NA	NA	NA	NA	NA
VED76721.1|1946030_1946741_+	Ni/Fe-hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
VED76725.1|1946737_1947325_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	2078476	2169011	4857140	coat,terminase,head,tail,protease,lysis,tRNA,transposase,portal,capsid,integrase	Enterobacteria_phage(53.33%)	107	2079054:2079070	2164692:2164708
VED77231.1|2078476_2079583_-|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
2079054:2079070	attL	TGCGGTTTTTCCAGTTC	NA	NA	NA	NA
VED77235.1|2079636_2080098_-	putative NUDIX-family hydrolase	NA	NA	NA	NA	NA
VED77239.1|2080107_2080761_-	ribosomal large subunit pseudouridine synthase E (rRNA pseudouridylate synthase E)	NA	NA	NA	NA	NA
VED77242.1|2080932_2082183_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
VED77245.1|2082296_2083439_-|integrase	prophage lambda integrase	integrase	O21929	Phage_21	99.7	8.1e-206
VED77248.1|2083428_2083665_-	excisionase	NA	NA	NA	NA	NA
VED77251.1|2083804_2084044_-	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
VED77254.1|2084091_2084310_-	ybl16	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
VED77257.1|2084408_2084624_-	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
VED77260.1|2084700_2085258_-	DNA N-6-adenine-methyltransferase from phage origin	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
VED77263.1|2085250_2085412_-	phage protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
VED77267.1|2085408_2086089_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.8	5.6e-130
VED77272.1|2086085_2086871_-	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.1e-148
VED77276.1|2086876_2087173_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
VED77280.1|2087248_2087455_-	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	85.1	3.5e-27
VED77284.1|2087935_2088313_-	phage associated protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
VED77288.1|2088290_2089352_-	phage protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
VED77292.1|2089432_2089918_-	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	91.6	1.2e-73
VED77296.1|2090235_2090463_+	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
VED77300.1|2090493_2091033_+	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
VED77304.1|2091029_2092049_+	replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	5.2e-111
VED77307.1|2092045_2092747_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	3.9e-126
VED77313.1|2092743_2093046_+	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VED77317.1|2093113_2093446_+	Multidrug transporter emrE	NA	NA	NA	NA	NA
VED77321.1|2093700_2095227_+	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
VED77325.1|2095691_2096243_+	kinase inhibitor	NA	NA	NA	NA	NA
VED77329.1|2096252_2097050_+	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VED77333.1|2097264_2097720_+	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
VED77338.1|2097719_2097890_+	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
VED77342.1|2097882_2098173_+	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
VED77346.1|2098169_2098532_+	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
VED77350.1|2098531_2098669_+	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	2.4e-08
VED77353.1|2098754_2099132_+	putative antitermination protein Q-like protein; DLP12 prophage	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
VED77356.1|2099276_2100485_-|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VED77359.1|2100610_2101135_-	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	53.5	1.2e-47
VED77362.1|2101327_2102287_+	putative pathogenicity island protein	NA	NA	NA	NA	NA
VED77365.1|2102638_2103370_+	araC-type regulatory protein from bacteriophage origin	NA	NA	NA	NA	NA
VED77368.1|2103558_2103774_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
VED77371.1|2103773_2104271_+	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
VED77374.1|2104267_2104726_+	Putative endopeptidase	NA	K7PJW6	Enterobacteria_phage	79.6	8.1e-56
VED77377.1|2104931_2105420_+	T5orf172 domain	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
VED77380.1|2105724_2105889_-|tRNA	Arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VED77384.1|2105934_2106345_-	phage protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
VED77387.1|2107023_2107569_+	phage DNA packaging protein Nu1	NA	A0A0K2FIG2	Enterobacteria_phage	83.4	1.9e-80
VED77389.1|2107543_2109469_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VED77390.1|2109465_2109672_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VED77393.1|2109668_2111270_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
VED77395.1|2111250_2112582_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	97.9	5.0e-231
VED77397.1|2112591_2112924_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
VED77399.1|2112979_2114005_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	95.9	2.4e-185
VED77402.1|2114046_2114442_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
VED77404.1|2114453_2114807_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
VED77406.1|2114818_2115397_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
VED77408.1|2115393_2115789_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
VED77411.1|2115796_2116537_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.2e-127
VED77413.1|2116552_2116975_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
VED77415.1|2116956_2117391_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	7.6e-64
VED77418.1|2117383_2120125_+|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	93.3	0.0e+00
VED77420.1|2120124_2120823_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
VED77422.1|2120972_2121572_+|tail	tail component	tail	A5LH41	Enterobacteria_phage	98.0	1.8e-119
VED77424.1|2121568_2122141_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.9	1.3e-82
VED77426.1|2122201_2125684_+	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
VED77428.1|2125742_2127764_+|tail	Putative phage tail fiber protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	5.0e-182
VED77431.1|2127760_2128039_+	putative prophage protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
VED77433.1|2129021_2129771_+	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VED77435.1|2130020_2130974_-|protease	outer membrane protease	protease	NA	NA	NA	NA
VED77438.1|2131524_2131677_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.0	6.2e-21
VED77440.1|2131940_2132483_-	ASCH domain protein	NA	NA	NA	NA	NA
VED77442.1|2132533_2132629_-	Protein of uncharacterised function (DUF1317)	NA	NA	NA	NA	NA
VED77445.1|2132625_2132721_-	DLP12 prophage; exonuclease	NA	A0A0N6WET1	Escherichia_phage	90.3	3.4e-09
VED77448.1|2132738_2132888_-	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	87.8	2.4e-17
VED77451.1|2133083_2133416_+	Multidrug transporter emrE	NA	NA	NA	NA	NA
VED77454.1|2133476_2134520_-	exported protein precursor	NA	NA	NA	NA	NA
VED77457.1|2134881_2135433_+	kinase inhibitor	NA	NA	NA	NA	NA
VED77460.1|2135442_2135583_+	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VED77463.1|2135856_2136177_+	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VED77466.1|2139075_2140185_+	putative NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
VED77469.1|2140185_2141097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VED77472.1|2141325_2141652_+	EthD protein	NA	NA	NA	NA	NA
VED77475.1|2141712_2141823_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED77478.1|2141764_2142481_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VED77481.1|2143895_2145419_+	putative signal transduction protein	NA	NA	NA	NA	NA
VED77484.1|2145589_2145808_+	inner membrane protein that interacts with cell division proteins	NA	NA	NA	NA	NA
VED77487.1|2146115_2146445_-	protein	NA	NA	NA	NA	NA
VED77490.1|2146454_2146739_-	conserved protein, UPF0757 family	NA	NA	NA	NA	NA
VED77494.1|2147249_2147516_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
VED77497.1|2147519_2148332_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
VED77500.1|2148355_2149051_-	septum formation inhibitor	NA	NA	NA	NA	NA
VED77503.1|2149179_2149473_+	putative cytoplasmic protein YcgL	NA	NA	NA	NA	NA
VED77506.1|2149544_2150204_+	putative hydrolase	NA	NA	NA	NA	NA
VED77509.1|2150295_2150742_+	putative cytoplasmic protein YcgN	NA	NA	NA	NA	NA
VED77512.1|2151050_2151164_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED77515.1|2151579_2152365_-	high-affinity zinc uptake system membrane protein	NA	NA	NA	NA	NA
VED77518.1|2152361_2153117_-	high-affinity zinc transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.4	6.1e-16
VED77521.1|2153141_2154128_+	high-affinity zinc transporter periplasmic protein	NA	NA	NA	NA	NA
VED77524.1|2154143_2155466_+	putative peptidoglycan-binding peptidase	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
VED77527.1|2155584_2156556_+	Lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
VED77530.1|2156710_2158153_-	pyruvate kinase	NA	NA	NA	NA	NA
VED77533.1|2158279_2159149_-	putative hex-regulon repressor (RpiR-family transcriptional regulator)	NA	NA	NA	NA	NA
VED77536.1|2159486_2160962_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
VED77539.1|2161196_2163008_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
VED77542.1|2163045_2163687_+	KHG/KDPG aldolase [includes: 4-hydroxy-2-oxoglutarate aldolase; 2 dehydro-3-deoxy-phosphogluconate aldolase]	NA	NA	NA	NA	NA
VED77545.1|2163742_2164921_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
2164692:2164708	attR	TGCGGTTTTTCCAGTTC	NA	NA	NA	NA
VED77548.1|2165062_2165353_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
VED77551.1|2165419_2165776_+	putative lipoprotein	NA	NA	NA	NA	NA
VED77555.1|2166082_2166742_+	inner membrane protein	NA	NA	NA	NA	NA
VED77557.1|2166950_2169011_+|protease	protease II	protease	NA	NA	NA	NA
>prophage 6
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	2542251	2599844	4857140	coat,terminase,tail,protease,lysis,tRNA,transposase,integrase	Escherichia_phage(54.72%)	64	2578825:2578884	2598334:2599650
VED78566.1|2542251_2543205_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VED78569.1|2543629_2544664_+|protease	putative protease	protease	NA	NA	NA	NA
VED78572.1|2544571_2545780_-|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VED78575.1|2546266_2546839_-	cytolethal distending toxin type IV subunit C	NA	A5LH54	Enterobacteria_phage	85.2	8.2e-90
VED78578.1|2546835_2547657_-	cytolethal distending toxin type IV subunit B	NA	A5LH53	Enterobacteria_phage	97.8	9.1e-151
VED78581.1|2547653_2548367_-	cytolethal distending toxin type IV subunit A	NA	A5LH52	Enterobacteria_phage	94.5	1.4e-131
VED78584.1|2548879_2549170_-	ybl63	NA	NA	NA	NA	NA
VED78587.1|2549180_2549885_-	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	3.2e-59
VED78590.1|2549894_2550176_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	7.0e-18
VED78593.1|2550175_2552551_-|tail	tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	70.4	2.1e-171
VED78596.1|2552615_2553215_-	putative prophage-encoded outer membrane protein	NA	Q9EV15	Enterobacteria_phage	88.4	6.6e-98
VED78599.1|2553282_2556681_-	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
VED78602.1|2556741_2557290_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.7	6.4e-92
VED78605.1|2557286_2557886_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	93.5	5.3e-116
VED78608.1|2558035_2558734_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	94.8	3.2e-128
VED78611.1|2558733_2559030_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	54.1	3.6e-25
VED78614.1|2559064_2562298_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	32.9	1.2e-100
VED78616.1|2562769_2563219_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED78619.1|2563279_2564242_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.5	1.5e-56
VED78622.1|2564268_2564661_-	phage protein	NA	NA	NA	NA	NA
VED78625.1|2564657_2565038_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.9e-18
VED78628.1|2565038_2565422_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VED78631.1|2565421_2565817_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED78634.1|2565820_2565997_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VED78637.1|2566039_2567179_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	4.4e-159
VED78640.1|2567277_2568042_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
VED78643.1|2568146_2569262_-	phage protein	NA	I6PD76	Cronobacter_phage	55.2	8.4e-115
VED78646.1|2569242_2570649_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	68.8	2.3e-186
VED78649.1|2570651_2571953_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.2e-149
VED78652.1|2571933_2573028_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.9	2.0e-113
VED78655.1|2573031_2573241_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED78658.1|2573218_2574151_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
VED78661.1|2574143_2574935_-	ParB-like nuclease	NA	R4TG31	Halovirus	39.8	1.8e-47
VED78664.1|2575072_2576497_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VED78667.1|2576667_2577132_-|lysis	phage endopeptidase/lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	85.5	1.8e-63
VED78670.1|2577128_2577626_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
VED78673.1|2577625_2577841_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
2578825:2578884	attL	AGAGCCTGTTCAGGATTCTGTGTAAATACCTTTTCTCAGAAGTGGCCGTCCAGGCGGTCA	NA	NA	NA	NA
VED78676.1|2578859_2580068_-|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VED78679.1|2580456_2580993_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
VED78681.1|2580989_2581280_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	2.8e-46
VED78684.1|2581279_2581879_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
VED78687.1|2582738_2583425_-	putative prophage protein	NA	NA	NA	NA	NA
VED78690.1|2583588_2584005_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	8.1e-63
VED78693.1|2584020_2584782_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
VED78696.1|2584804_2585551_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
VED78699.1|2585557_2586415_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.8	1.6e-68
VED78702.1|2586427_2586850_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VED78705.1|2586846_2587101_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VED78708.1|2587180_2587600_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VED78711.1|2587887_2588022_+	ydaG	NA	NA	NA	NA	NA
VED78714.1|2588033_2588189_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	57.4	3.6e-08
VED78717.1|2588185_2588797_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VED78720.1|2589104_2589326_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
VED78723.1|2589325_2589496_+	bacteriophage protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	1.1e-23
VED78726.1|2589570_2589846_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	94.5	7.5e-41
VED78729.1|2589947_2592971_+	putative phage exodeoxyribonuclease	NA	A0A0U2I1R6	Escherichia_phage	85.8	0.0e+00
VED78731.1|2592985_2593690_+	putative enterohemolysin	NA	A0A0U2S5Y9	Escherichia_phage	99.6	1.5e-125
VED78734.1|2593670_2594075_+	Uncharacterised protein	NA	A0A0U2S5Y9	Escherichia_phage	99.3	3.6e-68
VED78737.1|2594325_2594514_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
VED78740.1|2594613_2594829_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VED78742.1|2594830_2596066_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	8.4e-241
VED78745.1|2596117_2597053_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	7.0e-147
VED78748.1|2597149_2598358_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VED78751.1|2598470_2599844_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
2598334:2599650	attR	TGACCGCCTGGACGGCCACTTCTGAGAAAAGGTATTTACACAGAATCCTGAACAGGCTCTACGCAAGCTTATCGGGCTATTCTTGTGCTGGCCGGATAAGACGCAACCAGCGTCGCATCCGGCAATTCAACATTTCGTTATTTTAATAACCGCACCCGGCACGTTTTCCCTTTAATCTTTCCGCCCTGTAACTGTTTCCATGCCTTATGGGCAACAGACTGACGCACTGCGACGTAGACATGTGCTGGATGAACGGCAATTTTGCCAATATCTGTGCTATCCAGACCAATATCCCCCGTCAGCGCCCCCAGCACATCGCCTGGACGCATTTTCGCTTTTTTCCCACCATCAATGCACAACGTCGCCATTTCTGCTTCCAGCGGCACAATGGCGCTGCTGGCTGGTGGCGTTTGCCAGTTAAGTTTTATCTGCAACATGTCAGAAATGATATTCGCCCGCTGCGCCTCTTCCGGAGCACAGAAACTGATCGCCAGACCGCTATTCCCCGCTCGCGCAGTACGCCCGATGCGATGTACATGAACTTCAGGGTCCCACGCCAGCTCAAAGTTCACCACCAGCGCAAGAGATTTGATATCCAGACCACGTGCCGCGACATCGGTCGCCACCAGCACACGTGCGCTACCATTGGCAAAACGAACCAACGTCTGATCGCGGTCGCGTTGTTCCAGATCGCCATGTAACGACAATGCACTTTGCCCTACTTCATTCAGAGCATCACACACAGCCTGGCAATCTTTTTTTGTATTACAGAACACCACACAAGATGATGGCTGATGCAAGCTTAATAACCGCTGCAACAACGAAATTTTGCCTTTGCTGGATGTCTCATAAAATTGTTGTTCAATAGGCGGTAAAGCATCTGACGTATCAATCTCAATCGCTAAAGGATCGCGTTGTACACGACCGCTAATCGCGGCAATTGCGTCCGGCCAGGTTGCAGAAAACAGAAGCGTCTGGCGAGAAGCAGGCGCAAAACGGATGACGTCATCAATTGCGTCGCTAAATCCCATATCCAACATACGGTCGGCTTCATCCATTACCAGCGTATTCAGGGTATCCAGCGATACAGTGCCTTTTTGCAGGTGATCGAGCAAACGACCCGGCGTTGCCACGATGATATGCGGCGCATGTTGCAGCGAATCGCGCTGAATGCTGAACGGCTGGCCGCCGCATAAGGTCAAGATTTTGGTATTCGGCAGAAAACGCGCCAGCCGGCGCAACTCTCCGGCAACCTGATCCGCCAGTTCACGGGTCGGGCACAGCACTAAAGCCTGGGTCTGAAACAGCGACGCATCA	NA	NA	NA	NA
>prophage 7
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	3038253	3047699	4857140		Enterobacteria_phage(85.71%)	10	NA	NA
VED79585.1|3038253_3039390_+	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	93.5	2.6e-156
VED79588.1|3039386_3041459_+	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	86.2	0.0e+00
VED79590.1|3041510_3041972_+	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	97.4	7.8e-75
VED79592.1|3042013_3042484_-	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	96.8	9.7e-81
VED79594.1|3042530_3043250_-	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VED79596.1|3043246_3044932_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	98.9	6.2e-303
VED79598.1|3045157_3045889_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	97.5	1.0e-108
VED79599.1|3045948_3046056_+	putative inner membrane protein	NA	NA	NA	NA	NA
VED79601.1|3046036_3046768_-	ABC transporter permease	NA	NA	NA	NA	NA
VED79603.1|3046772_3047699_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 8
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	3165160	3175653	4857140		Pseudomonas_phage(33.33%)	7	NA	NA
VED79801.1|3165160_3168907_-	adhesin	NA	A0A2L1IV18	Escherichia_phage	28.9	4.5e-19
VED79803.1|3169325_3169523_-	Uncharacterised protein	NA	Q1MVF2	Enterobacteria_phage	75.0	6.4e-10
VED79805.1|3169596_3171882_+	ribonucleoside-diphosphate reductase	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.7	6.7e-284
VED79807.1|3171946_3173077_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	1.1e-175
VED79809.1|3173076_3173331_+	putative ferredoxin	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
VED79811.1|3173684_3174335_-	pH-inducible protein involved in stress response (putative kinase)	NA	NA	NA	NA	NA
VED79813.1|3174576_3175653_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	5.1e-08
>prophage 9
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	3248787	3325653	4857140	coat,terminase,head,holin,tRNA,transposase,portal,integrase	Enterobacteria_phage(58.33%)	95	3284603:3284618	3324077:3324092
VED79954.1|3248787_3249678_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	43.6	1.9e-64
VED79956.1|3249874_3250648_-	histidine/lysine/arginine/ornithine transporter subunit	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
VED79958.1|3250655_3251372_-	histidine transport system permease HisM	NA	NA	NA	NA	NA
VED79960.1|3251368_3252055_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
VED79962.1|3252145_3252928_-	histidine ABC transporter, substrate-binding periplasmic protein	NA	NA	NA	NA	NA
VED79964.1|3253147_3253930_-	lysine-arginine-ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
VED79966.1|3254194_3254764_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
VED79968.1|3254858_3256376_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	5.9e-87
VED79970.1|3256412_3256901_-	colicin V production protein	NA	NA	NA	NA	NA
VED79972.1|3257157_3257820_-	putative peptidoglycan-binding protein	NA	NA	NA	NA	NA
VED79974.1|3257809_3259078_-	bifunctional FolC protein [includes: folylpolyglutamate synthase; dihydrofolate synthase]	NA	NA	NA	NA	NA
VED79976.1|3259147_3260062_-	acetylCoA carboxylase	NA	NA	NA	NA	NA
VED79978.1|3260217_3260877_-	inner membrane protein	NA	NA	NA	NA	NA
VED79980.1|3260904_3261717_-|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
VED79982.1|3261716_3262730_-	putative semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VED79984.1|3262795_3263932_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	1.3e-22
VED79986.1|3264031_3265027_+	cell division protein	NA	NA	NA	NA	NA
VED79988.1|3265023_3266202_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VED79990.1|3266488_3267709_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
VED79992.1|3267867_3269874_+|tRNA	tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC	tRNA	NA	NA	NA	NA
VED79994.1|3270558_3270837_-	protein	NA	NA	NA	NA	NA
VED79996.1|3270869_3271418_-	putative transporting ATPase	NA	NA	NA	NA	NA
VED79998.1|3271417_3272227_-	inner membrane protein	NA	NA	NA	NA	NA
VED80000.1|3272226_3273051_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
VED80002.1|3273054_3274140_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	3.1e-90
VED80004.1|3274376_3275309_-	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
VED80006.1|3275474_3276026_+	Smr protein/MutS2	NA	NA	NA	NA	NA
VED80008.1|3276094_3276580_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
VED80010.1|3276782_3278927_-	fatty acid oxidation complex alpha subunit [includes: enoyl-CoA hydratase; 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase]	NA	NA	NA	NA	NA
VED80012.1|3278926_3280237_-	fatty acid oxidation comple beta subunit (3 -ketoacyl-CoA thiolase)	NA	NA	NA	NA	NA
VED80014.1|3280418_3280703_-	protein YfcZ	NA	NA	NA	NA	NA
VED80016.1|3281074_3282415_+	long-chain fatty acid transport protein	NA	NA	NA	NA	NA
VED80018.1|3282476_3283232_-	lipoprotein	NA	NA	NA	NA	NA
VED80020.1|3283534_3284467_+	transporter protein	NA	E7DYY8	Enterobacteria_phage	97.1	6.3e-164
3284603:3284618	attL	CTGCAGGGGACACCAT	NA	NA	NA	NA
VED80022.1|3284778_3285936_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
VED80024.1|3286268_3286451_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED80026.1|3286575_3287271_+	capsule O-acetyl transferase	NA	NA	NA	NA	NA
VED80028.1|3287360_3289340_-|head	Endo-alpha-sialidase, phage head protein	head	A5VW57	Enterobacteria_phage	88.6	1.0e-75
VED80030.1|3289461_3289722_+	putative transcriptional repressor protein	NA	A0A088CPT2	Enterobacteria_phage	94.0	5.8e-35
VED80032.1|3289739_3291968_-	prophage protein	NA	A0A2D1GLK8	Escherichia_phage	98.3	0.0e+00
VED80034.1|3291967_3293374_-	putative DNA injection protein	NA	I6RSG0	Salmonella_phage	55.4	2.4e-127
VED80036.1|3293383_3294076_-	putative DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
VED80038.1|3294078_3294534_-	Head assembly protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	5.7e-86
VED80040.1|3294533_3295235_-	Packaged DNA stabilization protein from phage	NA	A0A2D1GLK3	Escherichia_phage	97.4	3.3e-117
VED80042.1|3295234_3296653_-	Packaged DNA stabilization protein from phage	NA	Q9AYZ4	Salmonella_phage	99.2	1.0e-274
VED80044.1|3296662_3297124_-	DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	100.0	7.1e-84
VED80046.1|3297104_3297293_-	Uncharacterised protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
VED80048.1|3297334_3298588_-|coat	putative coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.1	2.9e-233
VED80050.1|3298606_3299500_-	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.0	9.1e-128
VED80052.1|3299590_3301789_-|portal	phage portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.2	0.0e+00
VED80054.1|3301790_3303206_-|terminase	phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.4	2.9e-277
VED80056.1|3303202_3303628_-|terminase	terminase small subunit	terminase	Q716H4	Shigella_phage	90.1	3.2e-67
VED80058.1|3303707_3303932_-	Protein of uncharacterised function (DUF2560)	NA	A0A0M4R322	Salmonella_phage	100.0	1.6e-33
VED80060.1|3304053_3304434_-	phage protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
VED80062.1|3304592_3305135_-	phage regulatory protein, Rha family	NA	A0A088CBJ5	Shigella_phage	99.4	4.1e-99
VED80064.1|3305340_3305493_-	bacteriophage protein (Gene 65)	NA	Q716B2	Shigella_phage	96.0	2.4e-20
VED80065.1|3305480_3305948_-	Rz endopeptidase from lambdoid prophage DLP12	NA	Q9AZ06	Salmonella_phage	91.6	2.4e-71
VED80067.1|3305944_3306421_-	phage endolysin	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
VED80069.1|3306404_3306728_-|holin	holin	holin	G5DA93	Enterobacteria_phage	99.1	3.8e-52
VED80071.1|3307284_3307908_-	late gene regulator	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
VED80073.1|3307904_3308570_-	Serine/threonine-protein phosphatase	NA	K7P7K6	Enterobacteria_phage	99.1	3.8e-131
VED80075.1|3308547_3308754_-	Protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
VED80077.1|3308750_3309362_-	bacteriophage Lambda NinG protein	NA	K7PHM2	Enterobacterial_phage	99.5	4.6e-99
VED80079.1|3309354_3309531_-	NinF family protein	NA	Q76H71	Enterobacteria_phage	98.3	1.9e-26
VED80081.1|3309530_3309890_-	protein ninX	NA	G8EYI2	Enterobacteria_phage	94.1	1.0e-61
VED80083.1|3310065_3310593_-	DNA N-6-adenine-methyltransferase of bacteriophage	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
VED80085.1|3310589_3311030_-	recombination protein ninB from phage origin	NA	M1FPM8	Enterobacteria_phage	98.6	2.2e-79
VED80087.1|3311106_3312543_-	P protein; replicative DNA helicase	NA	K7PGR8	Enterobacteria_phage	99.6	1.1e-273
VED80089.1|3312532_3313489_-	replication protein O	NA	G5DA89	Enterobacteria_phage	92.8	1.9e-155
VED80091.1|3313475_3313637_-	prophage protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
VED80093.1|3313671_3313950_-	transcriptional activator protein	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
VED80095.1|3314059_3314260_-	Regulatory protein cro	NA	A4KWT7	Enterobacteria_phage	98.5	5.6e-30
VED80097.1|3314360_3315074_+	Repressor protein CI	NA	A4KWV9	Enterobacteria_phage	95.8	7.2e-128
VED80099.1|3315146_3316049_+	Serine dehydrogenase proteinase	NA	NA	NA	NA	NA
VED80101.1|3316049_3316220_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED80103.1|3316735_3316855_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED80105.1|3316895_3317201_+	transcription antitermination protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
VED80107.1|3317213_3317495_+	Uncharacterised protein	NA	NA	NA	NA	NA
VED80109.1|3317550_3318174_+	Uncharacterised protein	NA	A4KWT2	Enterobacteria_phage	97.1	1.2e-107
VED80111.1|3318347_3319316_+	phage-like protein	NA	K7P7J7	Enterobacteria_phage	99.4	1.3e-55
VED80113.1|3319340_3319472_+	regulatory protein CIII	NA	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
VED80115.1|3319456_3319609_+	putative host killing protein	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
VED80117.1|3319684_3319855_+	Uncharacterised protein	NA	A5VWA7	Enterobacteria_phage	98.2	7.2e-26
VED80119.1|3319865_3320471_+	DNA single-strand annealing protein; essential recombination function protein Erf	NA	Q9MCQ9	Enterobacteria_phage	99.0	6.0e-107
VED80121.1|3320470_3320854_+	bacteriophage HK97 gp40	NA	A0A2I6PID1	Escherichia_phage	99.2	1.1e-66
VED80123.1|3320877_3321174_+	Anti-RecBCD protein 2	NA	A5VWB0	Enterobacteria_phage	98.0	8.6e-51
VED80125.1|3321184_3321352_+	prophage protein	NA	K7PJY9	Enterobacterial_phage	96.4	4.3e-23
VED80127.1|3321348_3322032_+	EA22-like protein; similarities with EA22 from lambda (modular protein involved in blocking host replication)	NA	K7P881	Enterobacteria_phage	52.3	6.6e-46
VED80129.1|3322033_3322297_+	phage protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
VED80131.1|3322307_3322955_+	prophage protein (fragment)	NA	S4TSR6	Salmonella_phage	55.6	6.3e-54
VED80133.1|3323141_3323309_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	3.7e-27
VED80135.1|3323335_3323680_+	prophage protein	NA	A0A0P0ZB93	Stx2-converting_phage	96.5	2.5e-57
VED80137.1|3323802_3324003_+	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
VED80139.1|3324104_3324347_-	inner membrane protein	NA	NA	NA	NA	NA
3324077:3324092	attR	CTGCAGGGGACACCAT	NA	NA	NA	NA
VED80141.1|3324732_3325653_+	lipid A biosynthesis lauroyl (or palmitoleoyl) acyltransferase	NA	A0A1W6JP29	Morganella_phage	54.4	8.3e-76
>prophage 10
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	3559843	3569997	4857140	integrase	Enterobacteria_phage(87.5%)	11	3550341:3550354	3569933:3569946
3550341:3550354	attL	CTCTTTCAGCGTCA	NA	NA	NA	NA
VED80531.1|3559843_3561040_+|integrase	integrase family protein	integrase	A0A1B5FPC6	Escherichia_phage	49.6	6.3e-108
VED80533.1|3561036_3562740_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED80535.1|3563218_3563791_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	8.5e-95
VED80537.1|3563864_3564365_-	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VED80539.1|3564361_3565096_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.2e-129
VED80541.1|3565695_3565914_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	2.6e-36
VED80543.1|3566267_3566465_+	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
VED80545.1|3566457_3566745_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VED80547.1|3566737_3567193_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VED80549.1|3567328_3567649_+	P4 phage protein	NA	NA	NA	NA	NA
VED80551.1|3567663_3569997_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
3569933:3569946	attR	TGACGCTGAAAGAG	NA	NA	NA	NA
>prophage 11
LR134270	Escherichia coli strain NCTC8196 genome assembly, chromosome: 1	4857140	3643668	3657576	4857140	tRNA	Escherichia_phage(40.0%)	13	NA	NA
VED80687.1|3643668_3646230_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.3	2.1e-28
VED80689.1|3646271_3646805_-	Uncharacterised protein	NA	NA	NA	NA	NA
VED80691.1|3646897_3647554_+	serine/threonine-specific protein phosphatase 2	NA	Q8HA16	Enterobacteria_phage	43.7	4.7e-49
VED80693.1|3647604_3648372_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.1	3.3e-70
VED80695.1|3648567_3649476_+	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.2	1.5e-117
VED80697.1|3649472_3650735_+|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.9	2.6e-136
VED80699.1|3650731_3651370_+	aldolase	NA	A0A077SK32	Escherichia_phage	76.0	5.7e-84
VED80701.1|3651374_3652151_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VED80703.1|3652239_3653604_+	inner membrane permease YgbN	NA	NA	NA	NA	NA
VED80705.1|3653707_3654853_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	7.0e-32
VED80707.1|3654915_3656055_-	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VED80709.1|3656194_3656821_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	3.3e-36
VED80711.1|3656814_3657576_-	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	9.0e-60
