The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134322	Lactobacillus rhamnosus strain NCTC13710 genome assembly, chromosome: 1	2991048	837461	891495	2991048	terminase,portal,tRNA,integrase,head,transposase,tail	Lactobacillus_phage(86.67%)	65	817058:817117	880591:880666
817058:817117	attL	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGA	NA	NA	NA	NA
VEF28965.1|837461_838589_-|integrase	phage-related integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	9.8e-212
VEF28966.1|838696_838960_-	Uncharacterised protein	NA	B4XYT0	Lactobacillus_phage	41.3	8.5e-10
VEF28967.1|839098_839320_+	Uncharacterised protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
VEF28968.1|839602_840712_-	Type I restriction-modification system, specificity subunit S	NA	NA	NA	NA	NA
VEF28969.1|840802_841021_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28970.1|841092_841740_-	phage-related Cro/CI family transcription regulator	NA	B4XYR6	Lactobacillus_phage	43.1	9.7e-39
VEF28971.1|841888_842155_+	Helix-turn-helix	NA	NA	NA	NA	NA
VEF28972.1|842151_842415_+	Putative antirepressor protein	NA	Q6J1W3	Lactobacillus_phage	89.3	2.0e-30
VEF28973.1|842516_843257_+	Phage antirepressor protein	NA	B4XYR8	Lactobacillus_phage	84.8	7.8e-109
VEF28974.1|843257_843518_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28975.1|843510_843816_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28976.1|843890_844247_+	Uncharacterized protein conserved in bacteria	NA	B4XYS0	Lactobacillus_phage	99.2	5.3e-63
VEF28977.1|844246_844339_+	Uncharacterised protein	NA	A0A0P0IZE0	Lactobacillus_phage	86.7	1.5e-09
VEF28978.1|844331_844535_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28979.1|844609_844924_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28980.1|844916_845753_+	Phage replication initiation protein	NA	A0A0P0ICZ8	Lactobacillus_phage	67.5	2.1e-110
VEF28981.1|845749_847012_+	Replicative DNA helicase	NA	A8YQM1	Lactobacillus_phage	97.6	3.9e-233
VEF28982.1|847013_847358_+	Uncharacterised protein	NA	U5U420	Lactobacillus_phage	88.6	1.4e-55
VEF28983.1|847370_847658_+	Uncharacterised protein	NA	U5U4M6	Lactobacillus_phage	93.7	7.8e-41
VEF28984.1|847644_847899_+	Uncharacterised protein	NA	A0A0P0IQP0	Lactobacillus_phage	95.2	1.2e-37
VEF28985.1|847895_848261_+	Putative prophage Lp2 protein 24	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
VEF28986.1|848273_848738_+	Prophage pi3 protein 39	NA	A0A0P0IXF6	Lactobacillus_phage	100.0	9.5e-20
VEF28987.1|848749_848935_+	phage protein	NA	Q6J1V0	Lactobacillus_phage	88.5	1.5e-24
VEF28988.1|848931_849438_+	phage protein	NA	Q8LTB6	Lactobacillus_phage	71.2	1.2e-57
VEF28989.1|849427_849604_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28990.1|849593_849911_+	Uncharacterised protein	NA	C1KFT5	Lactobacillus_virus	50.0	4.2e-19
VEF28991.1|849907_850117_+	Uncharacterised protein	NA	A8YQM9	Lactobacillus_phage	92.8	1.0e-29
VEF28992.1|850461_850890_+	phage transcriptional regulator, ArpU family	NA	NA	NA	NA	NA
VEF28993.1|851424_852090_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF28994.1|852732_853950_+	Uncharacterized protein conserved in bacteria	NA	A8YQN3	Lactobacillus_phage	97.3	5.6e-237
VEF28995.1|853936_854467_+	HNH homing endonuclease	NA	U5U4N5	Lactobacillus_phage	96.6	2.0e-98
VEF28996.1|854470_854794_+	Phage-protein, ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	88.5	2.3e-49
VEF28997.1|854996_855791_+|terminase	phage-related terminase small subunit	terminase	B4XYU4	Lactobacillus_phage	98.5	3.1e-148
VEF28998.1|855991_856447_+|terminase	phage-related terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
VEF28999.1|856468_858181_+|terminase	phage-related terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	98.4	0.0e+00
VEF29000.1|858192_858384_+	Uncharacterised protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
VEF29001.1|858388_859642_+|portal	phage-related portal protein	portal	B4XYP4	Lactobacillus_phage	98.3	6.5e-233
VEF29002.1|859595_860225_+|head	phage-related prohead protein	head	B4XYP5	Lactobacillus_phage	100.0	3.3e-116
VEF29003.1|860266_861469_+|head	phage-related major head protein	head	B4XYP6	Lactobacillus_phage	96.2	1.2e-210
VEF29004.1|861486_861726_+	Bacterial Ig-like domain (group 2)	NA	A0A2D1GPN4	Lactobacillus_phage	96.2	2.1e-31
VEF29005.1|861736_862096_+	DNA packaging protein, phage associated	NA	U5U4K5	Lactobacillus_phage	96.6	3.6e-59
VEF29006.1|862085_862415_+|head,tail	Putative head-tail joining protein	head,tail	P94213	Lactobacillus_phage	98.2	6.8e-57
VEF29007.1|862414_862801_+	Phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
VEF29008.1|862800_863187_+|head,tail	phage-related head-to-tail joining protein	head,tail	U5U3W4	Lactobacillus_phage	97.7	1.4e-69
VEF29009.1|863220_863835_+|tail	phage-related major tail protein	tail	U5U3Z7	Lactobacillus_phage	97.1	1.4e-108
VEF29010.1|863937_864351_+	Uncharacterised protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
VEF29011.1|864473_869366_+|tail	Phage tail length tape-measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	90.8	0.0e+00
VEF29012.1|869365_870079_+	Prophage Lp1 protein 51	NA	A0A1B2APY0	Phage_Wrath	40.0	2.6e-45
VEF29013.1|870080_871553_+	prophage protein	NA	A0A286QMQ0	Streptococcus_phage	25.4	4.6e-36
VEF29014.1|871552_874666_+	CotH protein	NA	NA	NA	NA	NA
VEF29015.1|874807_875101_+	phage protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
VEF29016.1|875090_875504_+	Holin	NA	A0A0P0IDC6	Lactobacillus_phage	95.8	7.1e-43
VEF29017.1|875518_875791_+	Uncharacterised protein	NA	C1KFI4	Lactobacillus_virus	67.8	4.8e-32
VEF29018.1|875802_876987_+	Putative endolysin	NA	A0A0P0HRN9	Lactobacillus_phage	89.6	6.0e-204
VEF29019.1|877134_877491_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29020.1|877913_878930_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
VEF29021.1|878959_879319_-	Unchracterized conserved protein	NA	NA	NA	NA	NA
VEF29022.1|880818_881472_-	Uncharacterised protein	NA	NA	NA	NA	NA
880591:880666	attR	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGCCCTGTATCCTCCAT	NA	NA	NA	NA
VEF29023.1|883364_884858_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF29024.1|885034_885505_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEF29025.1|885726_886941_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF29026.1|886953_887205_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VEF29027.1|887201_887927_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29028.1|887991_888663_-	phosphoesterase	NA	NA	NA	NA	NA
VEF29029.1|889083_891495_+|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
>prophage 2
LR134322	Lactobacillus rhamnosus strain NCTC13710 genome assembly, chromosome: 1	2991048	1046947	1059518	2991048	terminase,portal,integrase,head,protease,tail	uncultured_Caudovirales_phage(28.57%)	18	1040463:1040476	1049169:1049182
1040463:1040476	attL	GGTTTATGCCGGTG	NA	NA	NA	NA
VEF29176.1|1046947_1048096_-|integrase	site-specific recombinase, prophage lsa1 integrase	integrase	A0A097BYJ7	Leuconostoc_phage	29.3	6.0e-31
VEF29177.1|1048203_1048863_-	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEF29178.1|1049031_1049301_+	Helix-turn-helix domain	NA	NA	NA	NA	NA
1049169:1049182	attR	GGTTTATGCCGGTG	NA	NA	NA	NA
VEF29179.1|1049368_1049590_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29180.1|1049582_1049717_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29181.1|1049700_1049892_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29182.1|1049936_1050212_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29183.1|1050208_1050397_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29184.1|1050380_1051208_+	prophage Lp3 protein 7-like protein	NA	Q854C1	Mycobacterium_phage	31.8	3.4e-12
VEF29185.1|1051200_1052625_+	prophage Lp3 protein 8, helicase-like protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	1.1e-63
VEF29186.1|1052888_1053230_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29187.1|1053811_1054282_+|terminase	prophage Lp3 protein 14, terminase small subunit-like protein	terminase	NA	NA	NA	NA
VEF29188.1|1054278_1055982_+|terminase	Phage terminase-like protein	terminase	E9LUI0	Lactobacillus_phage	40.2	6.0e-120
VEF29189.1|1055947_1056127_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF29190.1|1056131_1057316_+|portal	prophage Lp3 protein 17, portal protein-like protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.5	3.7e-60
VEF29191.1|1057302_1058847_+|head,protease	phage-related prohead protease	head,protease	A0A2H4J9X8	uncultured_Caudovirales_phage	31.0	3.8e-33
VEF29192.1|1058902_1059193_+	phage protein	NA	NA	NA	NA	NA
VEF29193.1|1059236_1059518_+|head,tail	phage head-tail adaptor	head,tail	I7AUE6	Enterococcus_phage	39.7	1.7e-08
