The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	358	36177	4560086	capsid,tail,head,transposase,plate,terminase,integrase,holin	Erwinia_phage(33.33%)	56	10710:10725	25384:25399
VEF79905.1|358_727_-|tail	phage tail completion protein	tail	O80313	Escherichia_phage	67.5	2.3e-37
VEF79906.1|803_1022_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	60.6	3.9e-16
VEF79907.1|970_1258_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.4	3.7e-14
VEF79908.1|1610_1769_-	putative regulatory protein	NA	NA	NA	NA	NA
VEF79909.1|2261_2444_-|holin	prophage Hp1 family holin	holin	NA	NA	NA	NA
VEF79910.1|2474_2591_-|tail	phage-related tail protein	tail	A0A0F7LCN2	Escherichia_phage	64.7	1.6e-05
VEF79911.1|2678_3152_-|head	phage head completion-stabilization protein	head	M1SNN6	Escherichia_phage	58.7	5.3e-42
VEF79912.1|3486_3912_-|terminase	phage terminase, endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	71.1	5.8e-48
VEF79913.1|3915_5067_-|capsid	phage major capsid protein	capsid	F1BUQ8	Erwinia_phage	75.3	1.3e-150
VEF79914.1|5143_5998_-|capsid	phage capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	61.1	1.1e-90
VEF79915.1|6226_7924_+|terminase	phage terminase, ATPase subunit	terminase	F1BUR2	Erwinia_phage	80.7	1.0e-273
VEF79916.1|7920_8685_+|terminase	phage terminase, ATPase subunit	terminase	O80303	Escherichia_phage	45.0	6.7e-55
VEF79917.1|8681_9719_+|capsid	phage-related capsid packaging protein	capsid	F1BUR7	Erwinia_phage	77.8	3.0e-159
VEF79918.1|9720_10110_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79919.1|10474_10657_-	Uncharacterised protein	NA	NA	NA	NA	NA
10710:10725	attL	ATGCACTTTTTAAGAA	NA	NA	NA	NA
VEF79920.1|10864_11224_-	putative GP46 protein	NA	H9C172	Pectobacterium_phage	44.3	6.2e-19
VEF79921.1|11246_13529_-	phage replication protein	NA	Q858T4	Yersinia_virus	57.1	3.7e-242
VEF79922.1|13515_13788_-	Protein of uncharacterised function (DUF2732)	NA	NA	NA	NA	NA
VEF79923.1|13853_14165_-	gpB bacteriophage P2	NA	NA	NA	NA	NA
VEF79924.1|14176_14362_-	Protein of uncharacterised function (DUF2724)	NA	NA	NA	NA	NA
VEF79925.1|14371_14881_-	regulatory protein CII bacteriophage 186	NA	E5G6L3	Salmonella_phage	53.0	7.1e-45
VEF79926.1|14935_15133_-	putative DNA-binding protein	NA	Q1I116	Pasteurella_virus	39.3	2.8e-05
VEF79927.1|15203_15815_+	CI repressor of phage 186 and others	NA	Q6K1G0	Salmonella_virus	37.3	2.2e-24
VEF79928.1|15855_16740_+	NAD-dependent DNA ligase (contains BRCT domain type II)	NA	NA	NA	NA	NA
VEF79929.1|16764_16941_+	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	79.5	3.9e-11
VEF79930.1|17038_18064_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	64.2	6.3e-117
VEF79931.1|18078_19065_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79932.1|19368_19989_-|integrase	phage integrase family site specific recombinase	integrase	H9C152	Pectobacterium_phage	69.4	6.4e-80
VEF79933.1|20356_21133_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.8	1.4e-20
VEF79934.1|21157_22360_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	71.5	5.8e-77
VEF79935.1|22568_23165_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEF79936.1|23151_23877_+	putative NTP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.5	5.4e-30
VEF79937.1|23965_24076_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79938.1|24539_25487_-|transposase	putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	8.0e-74
25384:25399	attR	TTCTTAAAAAGTGCAT	NA	NA	NA	NA
VEF79939.1|25629_25806_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF79940.1|26247_26568_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79941.1|26557_26764_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79942.1|26905_27073_+	Uncharacterised protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	48.0	1.2e-06
VEF79943.1|27144_27405_+	DinJ-like protein	NA	NA	NA	NA	NA
VEF79944.1|27411_27690_+	mRNA interferase YafQ	NA	NA	NA	NA	NA
VEF79945.1|27742_28006_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEF79946.1|27998_28355_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	43.9	6.3e-16
VEF79947.1|28354_29647_-|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	35.4	1.6e-48
VEF79948.1|29619_29901_-|tail	putative variable tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	70.3	2.7e-30
VEF79949.1|29897_30440_-|tail	phage tail protein	tail	F1BUP2	Erwinia_phage	75.0	7.3e-80
VEF79950.1|30432_31341_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.5	1.3e-121
VEF79951.1|31340_31697_-|plate	phage baseplate assembly protein W	plate	F1BUP4	Erwinia_phage	60.0	4.4e-33
VEF79952.1|31693_32329_-|plate	baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	3.7e-67
VEF79953.1|32465_32738_+	Protein of uncharacterised function (DUF497)	NA	NA	NA	NA	NA
VEF79954.1|32718_33009_+	Uncharacterized protein conserved in bacteria	NA	K4NZP3	Burkholderia_phage	34.5	8.3e-06
VEF79955.1|33074_34136_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF79956.1|34174_34621_-	Phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	9.4e-33
VEF79957.1|34617_35085_-|tail	P2 phage tail completion R family protein	tail	F1BUP9	Erwinia_phage	55.3	8.3e-40
VEF79958.1|35186_35612_-	putative regulatory protein	NA	E5G6N2	Salmonella_phage	46.1	3.0e-20
VEF79959.1|35615_36011_-	bacteriophage P7-like protein	NA	A9DET4	Yersinia_phage	71.8	9.1e-48
VEF79960.1|35997_36177_-|holin	Phage holin	holin	NA	NA	NA	NA
>prophage 2
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	523202	531034	4560086	tRNA	Tupanvirus(33.33%)	8	NA	NA
VEF80427.1|523202_523499_+	Tfp pilus assembly protein, major pilin PilA	NA	M4ZS56	Bacillus_phage	68.8	6.2e-17
VEF80428.1|523711_524008_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
VEF80429.1|524012_526400_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
VEF80430.1|526414_527398_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
VEF80431.1|527862_528219_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
VEF80432.1|528256_528454_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
VEF80433.1|528550_528901_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.0	6.5e-05
VEF80434.1|529105_531034_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.8e-126
>prophage 3
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	561572	599536	4560086	transposase,tRNA,protease	Sphingobium_phage(25.0%)	36	NA	NA
VEF80466.1|561572_562334_+|transposase	transposase	transposase	NA	NA	NA	NA
VEF80467.1|562272_562575_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF80468.1|563012_563864_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
VEF80469.1|564139_564931_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
VEF80470.1|565117_566284_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
VEF80471.1|566608_567988_+	putative transport protein	NA	NA	NA	NA	NA
VEF80472.1|568159_569041_-	heat shock protein HtpX	NA	NA	NA	NA	NA
VEF80473.1|569337_571413_-|protease	carboxy-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
VEF80474.1|571432_572161_-	putative solute/DNA competence effector	NA	NA	NA	NA	NA
VEF80475.1|572256_572754_-	gaf domain-containing protein	NA	NA	NA	NA	NA
VEF80476.1|573015_574263_+	PqiA family integral membrane protein	NA	NA	NA	NA	NA
VEF80477.1|574231_576862_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEF80478.1|576874_577795_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEF80479.1|577923_579348_+	putative membrane transport protein	NA	NA	NA	NA	NA
VEF80480.1|579674_580211_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEF80481.1|580216_580774_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEF80482.1|580785_581343_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEF80483.1|581389_582139_+	putative chaperone protein	NA	NA	NA	NA	NA
VEF80484.1|582225_584667_+	outer membrane usher protein	NA	NA	NA	NA	NA
VEF80485.1|584697_585708_+	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
VEF80486.1|585930_587454_+	Predicted integral membrane sensor domain	NA	NA	NA	NA	NA
VEF80487.1|587566_587809_+	Protein of uncharacterised function (DUF1480)	NA	NA	NA	NA	NA
VEF80488.1|587926_588358_-	ASCH domain	NA	NA	NA	NA	NA
VEF80489.1|588613_588781_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF80490.1|589038_589272_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF80491.1|589772_590321_-	putative acetyl transferase	NA	NA	NA	NA	NA
VEF80492.1|590389_590968_-	putative transferase	NA	NA	NA	NA	NA
VEF80493.1|591212_592253_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEF80494.1|592414_592657_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF80495.1|592742_592940_+	integral membrane protein	NA	NA	NA	NA	NA
VEF80496.1|593825_594035_-|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEF80497.1|594034_594187_-|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEF80498.1|594311_595076_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
VEF80499.1|595317_595878_-	protein yecM	NA	NA	NA	NA	NA
VEF80500.1|596245_597976_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	1.0e-90
VEF80501.1|598099_599536_+|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
>prophage 4
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	1384652	1446543	4560086	transposase,tRNA,protease	uncultured_Mediterranean_phage(25.0%)	59	NA	NA
VEF81209.1|1384652_1386089_-|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
VEF81210.1|1386376_1386739_+	protein containing PTS-regulatory domain	NA	NA	NA	NA	NA
VEF81211.1|1386804_1387980_+	protein containing an Alanine Racemase Domain	NA	NA	NA	NA	NA
VEF81212.1|1387976_1389242_+	putative mutase	NA	NA	NA	NA	NA
VEF81213.1|1389497_1389863_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEF81214.1|1389971_1391255_+	putative transport system permease	NA	NA	NA	NA	NA
VEF81215.1|1391404_1391665_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEF81216.1|1391680_1391824_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VEF81217.1|1391951_1392830_-	periplasmic solute binding protein	NA	NA	NA	NA	NA
VEF81218.1|1392892_1393750_-	putative ABC-transporter membrane protein	NA	NA	NA	NA	NA
VEF81219.1|1393763_1394507_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.1	5.1e-07
VEF81220.1|1394796_1394919_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81221.1|1395239_1395593_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81222.1|1395750_1396119_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEF81223.1|1396165_1396369_+	hemolysin expression-modulating protein	NA	NA	NA	NA	NA
VEF81224.1|1397148_1397511_+	putative 6-O-methylguanine DNA methyltransferase family protein	NA	NA	NA	NA	NA
VEF81225.1|1397562_1398093_-	putative lipoprotein	NA	NA	NA	NA	NA
VEF81226.1|1398353_1399217_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VEF81227.1|1399330_1400623_-	ammonium transporter	NA	NA	NA	NA	NA
VEF81228.1|1400659_1400998_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
VEF81229.1|1401435_1403214_-	putative multidrug transporter membrane\ATP-binding components	NA	W8CYL7	Bacillus_phage	26.8	1.4e-39
VEF81230.1|1403206_1404973_-	putative multidrug transporter membrane\ATP-binding components	NA	W8CYL7	Bacillus_phage	27.9	5.3e-47
VEF81231.1|1405247_1405709_-	transcription regulator AsnC	NA	NA	NA	NA	NA
VEF81232.1|1405835_1406876_+	putative pyridoxal-phosphate dependent protein	NA	NA	NA	NA	NA
VEF81233.1|1407001_1407823_-	putative haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
VEF81234.1|1407926_1409630_+	oligopeptide ABC transporter, periplasmic oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
VEF81235.1|1409743_1410442_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	70.4	1.5e-85
VEF81236.1|1410529_1410937_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
VEF81237.1|1411183_1411606_-	competence protein ComEA	NA	NA	NA	NA	NA
VEF81238.1|1411744_1413631_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
VEF81239.1|1413627_1413744_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81240.1|1413830_1414103_-	transcriptional regulator HU subunit beta	NA	A4JWM7	Burkholderia_virus	59.6	5.9e-22
VEF81241.1|1414320_1416675_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	53.7	1.4e-228
VEF81242.1|1416869_1418141_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.8	8.1e-130
VEF81243.1|1418346_1418970_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.4	4.5e-65
VEF81244.1|1419426_1420731_-	trigger factor	NA	NA	NA	NA	NA
VEF81245.1|1421146_1421479_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
VEF81246.1|1421829_1422408_+	lipoprotein YajG	NA	NA	NA	NA	NA
VEF81247.1|1422485_1423964_+	muropeptide transporter	NA	NA	NA	NA	NA
VEF81248.1|1424228_1425008_+	Nucleoside-specific channel-forming protein, Tsx	NA	NA	NA	NA	NA
VEF81249.1|1425370_1426327_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
VEF81250.1|1426331_1428323_+	cytochrome O ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
VEF81251.1|1428312_1428927_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VEF81252.1|1428926_1429274_+	cytochrome O ubiquinol oxidase subunit CyoD	NA	NA	NA	NA	NA
VEF81253.1|1429287_1430175_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
VEF81254.1|1430351_1431716_+	putative transporter	NA	NA	NA	NA	NA
VEF81255.1|1431769_1432261_-	putative nucleotide-binding protein	NA	NA	NA	NA	NA
VEF81256.1|1432470_1433382_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
VEF81257.1|1433344_1433935_+	DJ-1 family protein	NA	NA	NA	NA	NA
VEF81258.1|1434304_1435756_-	thiamine biosynthesis protein ThiI	NA	NA	NA	NA	NA
VEF81259.1|1436035_1436290_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
VEF81260.1|1436294_1437215_+	geranyltranstransferase	NA	NA	NA	NA	NA
VEF81261.1|1437268_1439128_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
VEF81262.1|1439525_1440545_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF81263.1|1440833_1441970_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	6.0e-92
VEF81264.1|1442082_1442415_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.3	4.9e-10
VEF81265.1|1442475_1444290_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
VEF81266.1|1444300_1445269_+	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.2	8.0e-45
VEF81267.1|1445523_1446543_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 5
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	1885945	1945427	4560086	capsid,tail,plate,transposase,head,terminase,tRNA,integrase,holin	Erwinia_phage(48.57%)	64	1897060:1897109	1927146:1927195
VEF81668.1|1885945_1887184_+|tRNA	multifunctional tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	44.1	5.5e-83
VEF81669.1|1887422_1888241_-	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
VEF81670.1|1888524_1888884_-	bifunctional dihydroneopterin aldolase/dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
VEF81671.1|1888991_1889645_+	putative glycerol-3-phosphate acyltransferase PlsY	NA	NA	NA	NA	NA
VEF81672.1|1889800_1890814_-	putative DNA-binding/iron metalloprotein/AP endonuclease	NA	A0A0R6PI74	Moraxella_phage	57.7	1.9e-105
VEF81673.1|1891187_1891403_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEF81674.1|1891539_1893288_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.1e-73
VEF81675.1|1893445_1895284_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
VEF81676.1|1895492_1895948_+|transposase	transposase	transposase	NA	NA	NA	NA
VEF81677.1|1896185_1896488_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
1897060:1897109	attL	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
VEF81678.1|1897272_1897491_-	prophage p2 ogr protein	NA	Q37973	Salmonella_virus	72.2	7.0e-26
VEF81679.1|1897597_1898761_-	gene D protein	NA	A0A218M4J7	Erwinia_phage	65.9	5.1e-139
VEF81680.1|1898757_1899243_-|tail	phage-related tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	1.3e-51
VEF81681.1|1899245_1901678_-	phage protein	NA	Q7Y4C8	Escherichia_virus	46.8	3.9e-157
VEF81682.1|1901825_1902137_-|tail	putative phage tail protein	tail	F1BUU0	Erwinia_phage	65.9	1.0e-25
VEF81683.1|1902189_1902705_-|tail	major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	1.1e-66
VEF81684.1|1902718_1903888_-|tail	phage tail sheath monomer	tail	F1BUU3	Erwinia_phage	80.5	6.2e-185
VEF81685.1|1904042_1904225_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81686.1|1904235_1905675_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	71.1	1.0e-80
VEF81687.1|1905671_1906280_-|tail	phage tail fibers	tail	F1BUP2	Erwinia_phage	79.1	5.1e-90
VEF81688.1|1906272_1907181_-|plate	baseplate assembly protein J	plate	F1BUP3	Erwinia_phage	79.5	4.3e-125
VEF81689.1|1907185_1907536_-|plate	phage baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	1.9e-36
VEF81690.1|1907532_1908174_-|plate	baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	63.8	3.5e-73
VEF81691.1|1908274_1909207_-	Reverse transcriptase (RNA-dependent DNA polymerase)	NA	NA	NA	NA	NA
VEF81692.1|1909181_1909499_-	transcriptional regulator	NA	E5E3S9	Burkholderia_phage	47.0	1.6e-15
VEF81693.1|1909530_1909695_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81694.1|1910044_1910494_-|tail	phage tail completion protein	tail	O80313	Escherichia_phage	64.4	6.3e-45
VEF81695.1|1910490_1910946_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.3	2.2e-45
VEF81696.1|1911041_1911458_-	putative regulatory protein	NA	F1BUQ1	Erwinia_phage	48.9	5.1e-25
VEF81697.1|1911459_1911966_-	prophage lysozyme; Phage lysin	NA	A0A218M4K3	Erwinia_phage	62.5	2.6e-55
VEF81698.1|1911949_1912159_-|holin	prophage Hp1 family holin	holin	NA	NA	NA	NA
VEF81699.1|1912161_1912365_-|tail	phage-related tail protein	tail	F1BUQ5	Erwinia_phage	65.7	2.4e-20
VEF81700.1|1912364_1912838_-|head	phage head completion-stabilization protein	head	M1SNN6	Escherichia_phage	58.7	5.3e-42
VEF81701.1|1912937_1913597_-|terminase	phage terminase, endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.9	2.8e-81
VEF81702.1|1913600_1914752_-|capsid	phage major capsid protein	capsid	F1BUQ8	Erwinia_phage	75.3	1.3e-150
VEF81703.1|1914828_1915683_-|capsid	phage capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	61.1	1.1e-90
VEF81704.1|1915911_1917609_+|terminase	phage terminase, ATPase subunit	terminase	F1BUR2	Erwinia_phage	80.7	1.0e-273
VEF81705.1|1917605_1918370_+|terminase	phage terminase, ATPase subunit	terminase	O80303	Escherichia_phage	45.0	6.7e-55
VEF81706.1|1918366_1919404_+|capsid	phage-related capsid packaging protein	capsid	F1BUR7	Erwinia_phage	77.8	3.0e-159
VEF81707.1|1919405_1919795_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81708.1|1920177_1920282_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81709.1|1920533_1920893_-	putative GP46 protein	NA	H9C172	Pectobacterium_phage	43.4	1.8e-18
VEF81710.1|1920915_1923195_-	phage replication protein	NA	Q858T4	Yersinia_virus	57.1	1.3e-242
VEF81711.1|1923332_1923638_-	putative relication initiation protein	NA	NA	NA	NA	NA
VEF81712.1|1923637_1923910_-	Protein of uncharacterised function (DUF2732)	NA	A0A1S6L021	Salmonella_phage	54.4	1.6e-06
VEF81713.1|1923975_1924287_-	gpB bacteriophage P2	NA	NA	NA	NA	NA
VEF81714.1|1924298_1924484_-	Protein of uncharacterised function (DUF2724)	NA	NA	NA	NA	NA
VEF81715.1|1924493_1925003_-	regulatory protein CII	NA	A0A1S6L008	Salmonella_phage	51.2	4.6e-44
VEF81716.1|1925034_1925256_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEF81717.1|1925373_1925949_+	CI repressor	NA	A0A218M4J1	Erwinia_phage	41.2	1.7e-31
VEF81718.1|1926018_1927074_+|integrase	putative bacteriophage integrase	integrase	F1BUS9	Erwinia_phage	61.3	1.5e-121
VEF81719.1|1927333_1928665_-	alternate gene name: yzbB	NA	NA	NA	NA	NA
1927146:1927195	attR	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
VEF81720.1|1928717_1929803_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81721.1|1929820_1931692_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
VEF81722.1|1932047_1932908_-	transcriptional regulator	NA	NA	NA	NA	NA
VEF81723.1|1933135_1934044_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
VEF81724.1|1934130_1935498_+	PTS system N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
VEF81725.1|1935560_1936505_-	glutaminase	NA	NA	NA	NA	NA
VEF81726.1|1936574_1938131_-	putative amino acid permease	NA	NA	NA	NA	NA
VEF81727.1|1938205_1939606_-	glutamate decarboxylase	NA	NA	NA	NA	NA
VEF81728.1|1940419_1940992_+	acid-resistance membrane protein	NA	NA	NA	NA	NA
VEF81729.1|1941144_1941951_+	permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
VEF81730.1|1942192_1944214_+	2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
VEF81731.1|1944407_1945427_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 6
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	1987499	2037396	4560086	transposase,protease	uncultured_Mediterranean_phage(15.38%)	48	NA	NA
VEF81770.1|1987499_1989008_-|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	1.1e-21
VEF81771.1|1989091_1989832_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81772.1|1990290_1991190_-	putative tetrapyrrole methylase	NA	M1PLC5	Streptococcus_phage	43.8	3.8e-49
VEF81773.1|1991252_1993214_+	lppc putative lipoprotein	NA	NA	NA	NA	NA
VEF81774.1|1993470_1993824_+	putative endonuclease distantly related to archaeal Holliday junction resolvase	NA	NA	NA	NA	NA
VEF81775.1|1993879_1994470_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.5	1.9e-12
VEF81776.1|1994480_1995056_+	hemolysin	NA	NA	NA	NA	NA
VEF81777.1|1995236_1996256_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF81778.1|1996650_1997376_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
VEF81779.1|1997372_1998026_-	isoprenoid biosynthesis protein with amidotransferase-like domain	NA	NA	NA	NA	NA
VEF81780.1|1998266_2000603_-	aerobic respiration control sensor protein ArcB	NA	A0A1V0SGX0	Hokovirus	32.4	5.8e-41
VEF81781.1|2000695_2001598_-	putative radical SAM protein	NA	NA	NA	NA	NA
VEF81782.1|2002294_2006755_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
VEF81783.1|2006764_2008183_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
VEF81784.1|2008636_2009122_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81785.1|2009363_2009879_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.8	9.8e-26
VEF81786.1|2009884_2010526_-	stringent starvation protein A	NA	NA	NA	NA	NA
VEF81787.1|2010920_2011313_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
VEF81788.1|2011327_2011756_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
VEF81789.1|2012088_2013216_-	ATPase	NA	NA	NA	NA	NA
VEF81790.1|2013439_2013844_+	cytochrome d ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VEF81791.1|2014305_2015679_+|protease	protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	3.0e-21
VEF81792.1|2015767_2016856_+|protease	serine endoprotease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
VEF81793.1|2016933_2018202_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VEF81794.1|2018323_2018578_-	BolA-like protein	NA	NA	NA	NA	NA
VEF81795.1|2018752_2019094_-	putative anti-sigma B factor antagonist	NA	NA	NA	NA	NA
VEF81796.1|2019096_2019723_-	ABC transporter, auxiliary component YrbC	NA	NA	NA	NA	NA
VEF81797.1|2019735_2020296_-	ABC transporter, periplasmic component YrbD	NA	NA	NA	NA	NA
VEF81798.1|2020300_2021083_-	ABC transporter, permease component YrbE	NA	NA	NA	NA	NA
VEF81799.1|2021097_2021901_-	putative ABC transporter ATP-binding protein YrbF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
VEF81800.1|2022344_2023319_+	putative calcium/sodium:proton antiporter	NA	NA	NA	NA	NA
VEF81801.1|2023349_2024336_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.4e-38
VEF81802.1|2024349_2024913_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	80.0	5.3e-57
VEF81803.1|2024909_2025473_+	protein YrbK clustered with lipopolysaccharide transporters	NA	NA	NA	NA	NA
VEF81804.1|2025456_2026002_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
VEF81805.1|2026008_2026734_+	putative ABC transporter ATP-binding protein YhbG	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.3e-22
VEF81806.1|2026937_2028371_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
VEF81807.1|2028394_2028682_+	putative sigma(54) modulation protein	NA	NA	NA	NA	NA
VEF81808.1|2028852_2029335_+	PTS system nitrogen-specific IIA component, PtsN	NA	NA	NA	NA	NA
VEF81809.1|2029413_2030265_+	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
VEF81810.1|2030265_2030538_+	phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system (Npr)	NA	NA	NA	NA	NA
VEF81811.1|2031315_2031444_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81812.1|2031659_2032595_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.1e-50
VEF81813.1|2032606_2033071_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
VEF81814.1|2033564_2033951_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
VEF81815.1|2034218_2035655_+	Domain of uncharacterised function (DUF404)	NA	NA	NA	NA	NA
VEF81816.1|2035648_2036578_+	Bacterial domain of uncharacterised function (DUF403)	NA	NA	NA	NA	NA
VEF81817.1|2036574_2037396_+|protease	protein containing transglutaminase-like domain,putative cysteine protease	protease	NA	NA	NA	NA
>prophage 7
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	2188391	2261563	4560086	transposase	uncultured_Mediterranean_phage(20.0%)	57	NA	NA
VEF81937.1|2188391_2188607_-|transposase	transposase for insertion sequence element IS1328	transposase	NA	NA	NA	NA
VEF81938.1|2188564_2188756_-|transposase	IS3 family transposase, orfA	transposase	NA	NA	NA	NA
VEF81939.1|2194650_2194770_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF81940.1|2195317_2196907_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.9e-68
VEF81941.1|2196932_2198228_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
VEF81942.1|2198305_2198959_-	lipoprotein	NA	NA	NA	NA	NA
VEF81943.1|2199011_2199287_-	transcriptional regulator HU subunit alpha	NA	A7KV42	Bacillus_phage	55.6	6.2e-19
VEF81944.1|2199475_2200066_-	Protein of uncharacterised function (DUF416)	NA	NA	NA	NA	NA
VEF81945.1|2200111_2200816_-	endonuclease V	NA	NA	NA	NA	NA
VEF81946.1|2200839_2201907_-	uroporphyrinogen III decarboxylase	NA	NA	NA	NA	NA
VEF81947.1|2201987_2202773_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
VEF81948.1|2202864_2203368_+	anti-RNA polymerase sigma 70 factor	NA	NA	NA	NA	NA
VEF81949.1|2203783_2205751_+	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
VEF81950.1|2205737_2206409_+	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
VEF81951.1|2206401_2207202_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
VEF81952.1|2207198_2207399_+	sulfur transfer protein involved in thiamine biosynthesis	NA	NA	NA	NA	NA
VEF81953.1|2207400_2208189_+	thiazole synthase	NA	NA	NA	NA	NA
VEF81954.1|2208181_2209312_+	thiamine biosynthesis protein ThiH	NA	NA	NA	NA	NA
VEF81955.1|2209734_2210754_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF81956.1|2210965_2215186_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
VEF81957.1|2215322_2219351_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
VEF81958.1|2219694_2220063_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
VEF81959.1|2220131_2220635_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
VEF81960.1|2221008_2221713_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
VEF81961.1|2221716_2222145_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
VEF81962.1|2222338_2222884_-	transcription antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
VEF81963.1|2222885_2223269_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
VEF81964.1|2223508_2224693_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	2.6e-13
VEF81965.1|2225859_2226312_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEF81966.1|2226295_2226409_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEF81967.1|2226618_2227569_+	pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	1.6e-29
VEF81968.1|2227608_2228568_-	biotin--protein ligase	NA	NA	NA	NA	NA
VEF81969.1|2228564_2229602_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
VEF81970.1|2229962_2230520_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF81971.1|2230675_2230936_-|transposase	IS3 family transposase, orfA	transposase	NA	NA	NA	NA
VEF81972.1|2237116_2237650_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
VEF81973.1|2237671_2239123_-	potassium transporter	NA	NA	NA	NA	NA
VEF81974.1|2239159_2239774_-	protein co-occurring with transport systems (COG1739)	NA	A0A1X9I5T8	Streptococcus_phage	45.9	3.8e-24
VEF81975.1|2239773_2241105_-	proline dipeptidase	NA	NA	NA	NA	NA
VEF81976.1|2241432_2243622_+	multifunctional fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
VEF81977.1|2243633_2244797_+	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
VEF81978.1|2244896_2245598_-	FMN reductase	NA	NA	NA	NA	NA
VEF81979.1|2245652_2247173_-	3-octaprenyl-4-hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
VEF81980.1|2247413_2247902_+	transcriptional activator RfaH	NA	NA	NA	NA	NA
VEF81981.1|2247990_2249013_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
VEF81982.1|2249027_2249810_-	DNase TatD	NA	NA	NA	NA	NA
VEF81983.1|2249865_2250645_-	twin-arginine protein translocation system subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.6	2.1e-27
VEF81984.1|2250647_2251304_-	Sec-independent protein translocase protein TatB	NA	NA	NA	NA	NA
VEF81985.1|2251307_2251574_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
VEF81986.1|2251774_2253406_-	putative ubiquinone biosynthesis protein UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	29.5	3.1e-41
VEF81987.1|2253402_2254056_-	protein YigP (COG3165) clustered with ubiquinone biosynthetic genes	NA	NA	NA	NA	NA
VEF81988.1|2254069_2254825_-	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
VEF81989.1|2254958_2256485_-	putative DNA recombination protein	NA	NA	NA	NA	NA
VEF81990.1|2256685_2257216_-	DedA family protein	NA	NA	NA	NA	NA
VEF81991.1|2257344_2259156_-	putative carbon starvation protein	NA	NA	NA	NA	NA
VEF81992.1|2259499_2260297_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
VEF81993.1|2260543_2261563_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 8
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	2407405	2525242	4560086	capsid,tail,protease,transposase,terminase,tRNA,integrase	Erwinia_phage(14.29%)	104	2470086:2470128	2494092:2494134
VEF82113.1|2407405_2408509_+|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	NA	NA	NA	NA
VEF82114.1|2408774_2409215_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEF82115.1|2409237_2409870_-	DNA-binding transcriptional repressor FabR	NA	NA	NA	NA	NA
VEF82116.1|2410087_2411488_+	soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
VEF82117.1|2411470_2412403_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
VEF82118.1|2412550_2413282_+	putative peroxiredoxin/glutaredoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	57.9	3.8e-47
VEF82119.1|2413574_2415023_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
VEF82120.1|2415304_2415997_-	putative TonB protein	NA	NA	NA	NA	NA
VEF82121.1|2416182_2417514_-	HlyD family secretion protein	NA	NA	NA	NA	NA
VEF82122.1|2417547_2419353_-	ABC transporter	NA	W8CYL7	Bacillus_phage	30.6	1.5e-25
VEF82123.1|2419517_2420210_-	Preprotein translocase subunit SecG	NA	NA	NA	NA	NA
VEF82124.1|2420226_2420883_-	Hemophore	NA	NA	NA	NA	NA
VEF82125.1|2421052_2421667_-	hemophore HasA	NA	NA	NA	NA	NA
VEF82126.1|2421845_2422466_-	hemophore HasA	NA	NA	NA	NA	NA
VEF82127.1|2422631_2425121_-	putative TonB dependent receptor protein	NA	NA	NA	NA	NA
VEF82128.1|2425684_2427058_-	argininosuccinate lyase	NA	NA	NA	NA	NA
VEF82129.1|2427229_2428006_-	acetylglutamate kinase	NA	NA	NA	NA	NA
VEF82130.1|2428081_2429086_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
VEF82131.1|2429333_2430512_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
VEF82132.1|2430648_2433375_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
VEF82133.1|2434219_2435104_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
VEF82134.1|2435345_2437781_-	bifunctional aspartate kinase II/homoserine dehydrogenase II	NA	NA	NA	NA	NA
VEF82135.1|2437783_2438944_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
VEF82136.1|2439319_2439637_+	transcriptional repressor protein MetJ	NA	NA	NA	NA	NA
VEF82137.1|2439729_2439945_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEF82138.1|2440192_2442391_+	primosome assembly protein PriA	NA	NA	NA	NA	NA
VEF82139.1|2442632_2443661_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
VEF82140.1|2443825_2444596_+	cell division protein FtsN	NA	NA	NA	NA	NA
VEF82141.1|2444695_2445220_+|protease	ATP-dependent protease peptidase subunit	protease	NA	NA	NA	NA
VEF82142.1|2445256_2446588_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.0	1.7e-45
VEF82143.1|2446702_2447671_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
VEF82144.1|2447801_2448287_+	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
VEF82145.1|2448423_2448663_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEF82146.1|2449257_2450106_+	glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.8e-15
VEF82147.1|2450182_2451706_+	glycerol kinase	NA	NA	NA	NA	NA
VEF82148.1|2451887_2452898_+	fructose 1,6-bisphosphatase II	NA	NA	NA	NA	NA
VEF82149.1|2453090_2454110_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF82150.1|2454539_2455691_-	multidrug resistance protein D	NA	S4TR35	Salmonella_phage	24.6	6.9e-11
VEF82151.1|2456478_2457414_+	transferase	NA	NA	NA	NA	NA
VEF82152.1|2457529_2462467_+	Rhs family protein	NA	B6SD27	Bacteriophage	41.1	3.7e-287
VEF82153.1|2462708_2463455_+	ferredoxin-NADP reductase	NA	NA	NA	NA	NA
VEF82154.1|2463513_2463951_-	Inner membrane protein yhaH	NA	NA	NA	NA	NA
VEF82155.1|2464109_2464715_+	Protein of uncharacterised function (DUF1454)	NA	NA	NA	NA	NA
VEF82156.1|2464843_2465611_+	triosephosphate isomerase	NA	NA	NA	NA	NA
VEF82157.1|2465626_2466499_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF82158.1|2466713_2467703_-	sulfate transporter subunit	NA	NA	NA	NA	NA
VEF82159.1|2467913_2468897_-	6-phosphofructokinase	NA	NA	NA	NA	NA
VEF82160.1|2469131_2470034_-	ferrous iron efflux protein F	NA	NA	NA	NA	NA
2470086:2470128	attL	AAAAAAAGCCCTCCATCATGGAGGGCGAAAGACAGGGATGGTG	NA	NA	NA	NA
VEF82161.1|2470145_2470448_-	prophage p2 ogr protein	NA	A0A2I8TV89	Erwinia_phage	70.7	9.8e-18
VEF82162.1|2470523_2471672_-	gene D protein	NA	A0A218M4J7	Erwinia_phage	73.9	4.1e-157
VEF82163.1|2471668_2472121_-|tail	phage-related tail protein	tail	Q6K1G5	Salmonella_virus	61.4	1.2e-46
VEF82164.1|2472133_2474557_-	phage protein	NA	Q858U7	Yersinia_virus	62.3	2.2e-240
VEF82165.1|2474713_2475028_-|tail	putative phage tail protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	3.7e-28
VEF82166.1|2475054_2475573_-|tail	major tail tube protein	tail	Q37845	Escherichia_phage	77.9	3.5e-79
VEF82167.1|2475587_2476757_-|tail	phage tail sheath monomer	tail	F1BUU3	Erwinia_phage	78.1	4.3e-178
VEF82168.1|2477018_2477204_-	putative prophage protein	NA	NA	NA	NA	NA
VEF82169.1|2477926_2479270_-	protein hipA	NA	NA	NA	NA	NA
VEF82170.1|2479266_2479677_-	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEF82171.1|2480048_2480312_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEF82172.1|2480304_2480661_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEF82173.1|2480786_2482295_+|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	1.1e-21
VEF82174.1|2482281_2483007_+	putative NTP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.3	4.4e-32
VEF82175.1|2483054_2483828_+|terminase	phage terminase, ATPase subunit	terminase	M1SNM9	Escherichia_phage	78.8	2.2e-114
VEF82176.1|2483827_2484850_+|capsid	phage-related capsid packaging protein	capsid	F1BUR7	Erwinia_phage	76.3	1.0e-154
VEF82177.1|2485358_2485775_+	Predicted ATP-binding protein involved in virulence	NA	NA	NA	NA	NA
VEF82178.1|2485840_2486596_+	putative ATP binding protein SugR	NA	C7BGE8	Burkholderia_phage	28.6	4.7e-08
VEF82179.1|2486596_2487253_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF82180.1|2487859_2489329_-	SEC-C motif	NA	NA	NA	NA	NA
VEF82181.1|2489581_2491663_-	phage replication protein	NA	A0A0F7LBQ2	Escherichia_phage	59.1	1.5e-226
VEF82182.1|2491701_2492202_-	replication gene B protein	NA	S4TTB7	Salmonella_phage	61.4	1.4e-56
VEF82183.1|2492241_2492514_-	cox	NA	Q1JS44	Enterobacteria_phage	78.9	3.2e-36
VEF82184.1|2492647_2492923_+	C protein	NA	Q1JS21	Enterobacteria_phage	65.6	3.0e-29
VEF82185.1|2493007_2493988_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	72.2	5.8e-136
VEF82186.1|2494171_2494669_-	P pilus assembly/Cpx signaling pathway,periplasmic inhibitor/zinc-resistance associated protein	NA	NA	NA	NA	NA
2494092:2494134	attR	AAAAAAAGCCCTCCATCATGGAGGGCGAAAGACAGGGATGGTG	NA	NA	NA	NA
VEF82187.1|2494856_2495555_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	4.0e-06
VEF82188.1|2495551_2496928_+	two-component sensor protein	NA	W8CYF6	Bacillus_phage	25.1	4.5e-17
VEF82189.1|2496997_2498158_-	bifunctional regulatory protein/DNA repair protein	NA	NA	NA	NA	NA
VEF82190.1|2498267_2498771_+	putative methyltransferase	NA	NA	NA	NA	NA
VEF82191.1|2499178_2500000_-	serine acetyltransferase	NA	NA	NA	NA	NA
VEF82192.1|2500125_2501145_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEF82193.1|2501144_2501615_-	preprotein translocase subunit SecB	NA	NA	NA	NA	NA
VEF82194.1|2501706_2501955_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	2.4e-14
VEF82195.1|2502004_2502439_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
VEF82196.1|2502680_2504228_+	phosphoglyceromutase	NA	NA	NA	NA	NA
VEF82197.1|2504237_2505605_+	cell wall endopeptidase, family M23/M37	NA	G9BW84	Planktothrix_phage	34.8	2.4e-10
VEF82198.1|2505628_2506633_+	putative divergent polysaccharide deacetylase	NA	NA	NA	NA	NA
VEF82199.1|2507023_2508358_-|protease	putative Zn-dependent protease	protease	NA	NA	NA	NA
VEF82200.1|2508373_2509648_-	putative TRANSmembrane protein	NA	NA	NA	NA	NA
VEF82201.1|2509972_2511013_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
VEF82202.1|2511022_2512234_-	2-amino-3-ketobutyrate coenzyme A ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	4.2e-35
VEF82203.1|2512477_2513410_+	ADP-L-glycero-D-manno-heptose-6-epimerase	NA	E3SL51	Synechococcus_phage	36.2	2.2e-31
VEF82204.1|2513440_2514505_+	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
VEF82205.1|2514504_2515470_+	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
VEF82206.1|2516014_2517292_+	3-deoxy-D-manno-octulosonic-acid transferase	NA	NA	NA	NA	NA
VEF82207.1|2517292_2518075_+	lipopolysaccharide core biosynthesis glycosyl transferase	NA	NA	NA	NA	NA
VEF82208.1|2518071_2518551_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	3.3e-28
VEF82209.1|2518848_2519658_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	30.7	1.9e-23
VEF82210.1|2519744_2519912_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
VEF82211.1|2519923_2520160_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
VEF82212.1|2520423_2521092_-	DNA repair protein RadC	NA	NA	NA	NA	NA
VEF82213.1|2521283_2522516_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	34.9	5.6e-43
VEF82214.1|2522493_2522952_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	59.5	2.1e-48
VEF82215.1|2523073_2523670_+	nucleoid occlusion protein	NA	NA	NA	NA	NA
VEF82216.1|2523805_2525242_-|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
>prophage 9
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	3168919	3227086	4560086	transposase,tRNA,protease	Bacillus_virus(21.43%)	58	NA	NA
VEF82781.1|3168919_3169798_-|protease	putative protease	protease	NA	NA	NA	NA
VEF82782.1|3169809_3170805_-|protease	putative protease	protease	NA	NA	NA	NA
VEF82783.1|3171179_3171701_+	putative lipid carrier protein	NA	NA	NA	NA	NA
VEF82784.1|3171718_3172198_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEF82785.1|3172184_3172478_-	GIY-YIG nuclease superfamily protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.6	1.4e-13
VEF82786.1|3172614_3173931_-	putrescine transporter	NA	NA	NA	NA	NA
VEF82787.1|3174024_3176190_-	ornithine decarboxylase	NA	NA	NA	NA	NA
VEF82788.1|3177334_3179359_-	heparinase II/III-like family protein	NA	NA	NA	NA	NA
VEF82789.1|3179382_3180519_-	Alginate lyase	NA	NA	NA	NA	NA
VEF82790.1|3180511_3180619_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF82791.1|3181179_3182493_+	putative sugar binding protein	NA	NA	NA	NA	NA
VEF82792.1|3182500_3183385_+	sugar transport system, permease	NA	NA	NA	NA	NA
VEF82793.1|3183403_3184243_+	sugar transport system, permease	NA	NA	NA	NA	NA
VEF82794.1|3184254_3185370_+	putative sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	7.3e-26
VEF82795.1|3185383_3186550_+	Alginate lyase	NA	NA	NA	NA	NA
VEF82796.1|3186623_3187076_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEF82797.1|3187283_3187535_+	stbd replicon stabilization protein (antitoxin to StbE)	NA	NA	NA	NA	NA
VEF82798.1|3187531_3187819_+	stbe replicon stabilization toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	8.4e-19
VEF82799.1|3187894_3188524_+	oxidoreductase	NA	NA	NA	NA	NA
VEF82800.1|3188524_3189292_-	carbon-phosphorus lyase complex accessory protein	NA	NA	NA	NA	NA
VEF82801.1|3189282_3189588_-	ATP-binding protein PhnN; Guanylate kinase	NA	NA	NA	NA	NA
VEF82802.1|3189581_3189860_-	ATP-binding protein PhnN; Guanylate kinase	NA	NA	NA	NA	NA
VEF82803.1|3189859_3191008_-	PhnM protein	NA	NA	NA	NA	NA
VEF82804.1|3191004_3191739_-	phosphonates transport ATP-binding protein PhnL	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
VEF82805.1|3191752_3192559_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.5	7.9e-14
VEF82806.1|3192555_3193422_-	PhnJ protein	NA	NA	NA	NA	NA
VEF82807.1|3193414_3193657_-	phni protein	NA	NA	NA	NA	NA
VEF82808.1|3193689_3194526_-	phni protein	NA	NA	NA	NA	NA
VEF82809.1|3194525_3195107_-	carbon-phosphorus lyase complex subunit	NA	NA	NA	NA	NA
VEF82810.1|3195106_3195583_-	PhnG protein	NA	NA	NA	NA	NA
VEF82811.1|3195583_3196309_-	phosphonate metabolism transcriptional regulator PhnF	NA	A0A291LID1	Streptomyces_phage	42.2	4.6e-05
VEF82812.1|3196693_3197797_+	putative lipoprotein	NA	NA	NA	NA	NA
VEF82813.1|3197905_3199666_+	putative activation/secretion signal peptide protein	NA	NA	NA	NA	NA
VEF82814.1|3199813_3200278_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	5.5e-52
VEF82815.1|3200457_3202596_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.4e-267
VEF82816.1|3203607_3204324_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.1e-22
VEF82817.1|3204310_3205189_-	putative ABC transporter transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.3e-13
VEF82818.1|3205181_3206021_-	putative permease	NA	NA	NA	NA	NA
VEF82819.1|3206022_3207072_-	putative permease	NA	NA	NA	NA	NA
VEF82820.1|3207234_3208803_-	oligo-dipeptide/nickel ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEF82821.1|3209355_3209814_+	putative sugar isomerase involved in processing of exogenous sialic acid	NA	NA	NA	NA	NA
VEF82822.1|3209966_3210983_-	ornithine carbamoyltransferase subunit I	NA	NA	NA	NA	NA
VEF82823.1|3211144_3211576_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
VEF82824.1|3211989_3212751_+|transposase	transposase	transposase	NA	NA	NA	NA
VEF82825.1|3212689_3212992_+|transposase	transposase	transposase	NA	NA	NA	NA
VEF82826.1|3213381_3213885_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEF82827.1|3214217_3217115_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.3	8.8e-140
VEF82828.1|3217128_3217578_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEF82829.1|3217827_3219339_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	1.6e-47
VEF82830.1|3219618_3220713_+	putative permease	NA	NA	NA	NA	NA
VEF82831.1|3220712_3221783_+	lipopolysaccharide ABC transporter permease	NA	NA	NA	NA	NA
VEF82832.1|3222708_3222942_+	z1226 protein	NA	NA	NA	NA	NA
VEF82833.1|3223018_3223267_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
VEF82834.1|3223270_3223546_+	Plasmid stabilisation system protein	NA	NA	NA	NA	NA
VEF82835.1|3223664_3224453_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VEF82836.1|3224680_3224869_+|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VEF82837.1|3224865_3225591_-	putative NTP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.3	8.9e-33
VEF82838.1|3225577_3227086_-|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	1.1e-21
>prophage 10
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	3849326	3945080	4560086	transposase,bacteriocin,protease	Bacillus_phage(22.22%)	91	NA	NA
VEF83375.1|3849326_3849629_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF83376.1|3849567_3850329_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF83377.1|3850649_3851216_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83378.1|3852471_3853335_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83379.1|3853428_3853587_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83380.1|3853602_3854148_+	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
VEF83381.1|3854227_3855193_-	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.4	4.7e-37
VEF83382.1|3855185_3855956_-	DNA-binding transcriptional repressor SrlR	NA	NA	NA	NA	NA
VEF83383.1|3856040_3856406_-	DNA-binding transcriptional activator GutM	NA	NA	NA	NA	NA
VEF83384.1|3856762_3857542_-	sorbitol-6-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEF83385.1|3857688_3858051_-	PTS system glucitol/sorbitol-specific transporter subunit IIA	NA	NA	NA	NA	NA
VEF83386.1|3858116_3859142_-	PTS system, glucitol/sorbitol-specific transporter subunit IIBC	NA	NA	NA	NA	NA
VEF83387.1|3859177_3859726_-	PTS system glucitol/sorbitol-specific transporter subunit IIc2	NA	NA	NA	NA	NA
VEF83388.1|3860104_3861004_-	lipid kinase	NA	NA	NA	NA	NA
VEF83389.1|3861477_3862881_-|protease	putative protease	protease	Q6DW11	Phage_TP	82.8	7.2e-180
VEF83390.1|3863104_3863443_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEF83391.1|3863521_3864241_-	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	8.9e-33
VEF83392.1|3864249_3865626_-	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	32.0	2.2e-32
VEF83393.1|3865642_3867052_-	multidrug efflux system protein MdtE	NA	NA	NA	NA	NA
VEF83394.1|3867048_3867189_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83395.1|3867195_3870270_-	multidrug efflux system subunit MdtC	NA	NA	NA	NA	NA
VEF83396.1|3870266_3873410_-	multidrug efflux system subunit MdtB	NA	NA	NA	NA	NA
VEF83397.1|3873409_3874744_-	multidrug efflux system subunit MdtA	NA	NA	NA	NA	NA
VEF83398.1|3875027_3875384_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83399.1|3875755_3877108_-	chaperone	NA	NA	NA	NA	NA
VEF83400.1|3877201_3877864_-	putative sensor protein	NA	NA	NA	NA	NA
VEF83401.1|3877982_3878795_-	phosphate ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	31.7	1.5e-15
VEF83402.1|3878823_3880488_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
VEF83403.1|3880487_3882674_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
VEF83404.1|3882919_3884989_+	polyphosphate kinase	NA	NA	NA	NA	NA
VEF83405.1|3884975_3886556_+	exopolyphosphatase	NA	NA	NA	NA	NA
VEF83406.1|3886618_3886810_+	Protein of uncharacterised function (DUF2633)	NA	NA	NA	NA	NA
VEF83407.1|3886857_3888333_+	putative divalent cation transport protein	NA	NA	NA	NA	NA
VEF83408.1|3888504_3892413_+	putative sensor protein	NA	A0A127AWB9	Bacillus_phage	36.9	6.5e-21
VEF83409.1|3892845_3893391_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
VEF83410.1|3893526_3894258_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.7	2.3e-28
VEF83411.1|3894205_3895249_-	phosphoribosylaminoimidazole synthetase	NA	A0A1D7SE90	Cyanophage	41.0	7.7e-70
VEF83412.1|3895482_3896109_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
VEF83413.1|3896189_3897479_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	38.4	2.7e-64
VEF83414.1|3897604_3898312_+	DNA replication initiation factor	NA	NA	NA	NA	NA
VEF83415.1|3898359_3898713_-	putative arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.9e-20
VEF83416.1|3898724_3900251_-|protease	exported zinc metalloprotease YfgC	protease	NA	NA	NA	NA
VEF83417.1|3900603_3901668_+	putative permease PerM (=YfgO)	NA	NA	NA	NA	NA
VEF83418.1|3902032_3902503_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
VEF83419.1|3902505_3903075_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
VEF83420.1|3903221_3904121_+	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
VEF83421.1|3904137_3905196_+	lipoprotein	NA	NA	NA	NA	NA
VEF83422.1|3905408_3906122_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	34.4	5.0e-36
VEF83423.1|3906323_3907193_+|protease	ypfj protein, zinc metalloprotease superfamily	protease	NA	NA	NA	NA
VEF83424.1|3907330_3907783_+	Protein of uncharacterised function (DUF441)	NA	NA	NA	NA	NA
VEF83425.1|3907817_3909791_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEF83426.1|3909914_3910127_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83427.1|3910237_3910648_-	Secreted protein sopD	NA	NA	NA	NA	NA
VEF83428.1|3910920_3911556_+	esterase YpfH	NA	NA	NA	NA	NA
VEF83429.1|3911657_3911807_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83430.1|3911808_3912258_+	putative phage endopeptidase	NA	B0FEE8	Escherichia_phage	45.1	8.5e-26
VEF83431.1|3912659_3913034_+|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEF83432.1|3913000_3913651_+|transposase	transposase	transposase	NA	NA	NA	NA
VEF83433.1|3914067_3914289_+	phage-like protein	NA	A0A2H4FQV0	Salmonella_phage	85.1	2.3e-24
VEF83434.1|3914941_3915478_+	attachment invasion locus protein	NA	A0A1B0VBR9	Salmonella_phage	38.8	1.9e-27
VEF83435.1|3915633_3916449_+|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	29.2	2.1e-22
VEF83436.1|3916498_3916807_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83437.1|3916914_3917106_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83438.1|3917140_3917851_-	D,D-carboxypeptidase family protein	NA	NA	NA	NA	NA
VEF83439.1|3917847_3918975_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
VEF83440.1|3918976_3919399_-	A glutathione-dependent thiol reductase	NA	NA	NA	NA	NA
VEF83441.1|3919561_3920035_-	Predicted O-linked N-acetylglucosamine transferase, SPINDLY family	NA	NA	NA	NA	NA
VEF83442.1|3920494_3921709_-|bacteriocin	bacteriocin biosynthesis docking scaffold, SagD family	bacteriocin	NA	NA	NA	NA
VEF83443.1|3921878_3921989_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83444.1|3922198_3923635_-|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
VEF83445.1|3923770_3926902_-	aminoglycoside/multidrug efflux system	NA	NA	NA	NA	NA
VEF83446.1|3927111_3927390_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEF83447.1|3927428_3928058_-	nitrate/nitrite response regulator protein	NA	NA	NA	NA	NA
VEF83448.1|3928562_3929066_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
VEF83449.1|3929055_3929322_+	assembly protein for periplasmic nitrate reductase	NA	NA	NA	NA	NA
VEF83450.1|3929318_3931814_+	nitrate reductase catalytic subunit	NA	NA	NA	NA	NA
VEF83451.1|3931884_3932352_+	citrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
VEF83452.1|3932379_3932979_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
VEF83453.1|3933160_3933736_+	GDP-mannose pyrophosphatase YffH	NA	NA	NA	NA	NA
VEF83454.1|3933956_3936236_+	bifunctional malic enzyme oxidoreductase/phosphotransacetylase	NA	NA	NA	NA	NA
VEF83455.1|3936652_3937672_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF83456.1|3938107_3938488_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEF83457.1|3938456_3938849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEF83458.1|3938960_3939419_-	Uncharacterized BCR, YaiI/YqxD family COG1671	NA	NA	NA	NA	NA
VEF83459.1|3939418_3940360_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
VEF83460.1|3940590_3941016_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEF83461.1|3941169_3941583_-	protein ygiW	NA	A0A1I9LJU6	Stx_converting_phage	40.1	6.0e-18
VEF83462.1|3941966_3942578_+	putative outer membrane lipoprotein YfeY	NA	NA	NA	NA	NA
VEF83463.1|3942753_3943659_+	putative iron-dependent peroxidase, Dyp-type family	NA	S4VVJ7	Pandoravirus	32.9	7.7e-26
VEF83464.1|3944077_3944380_-|transposase	transposase	transposase	NA	NA	NA	NA
VEF83465.1|3944318_3945080_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	4263818	4333772	4560086	transposase,tRNA,protease	Bacillus_virus(12.5%)	57	NA	NA
VEF83743.1|4263818_4264838_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF83744.1|4265075_4265210_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83745.1|4265245_4266613_-	L-serine dehydratase 2	NA	NA	NA	NA	NA
VEF83746.1|4266758_4268054_-	serine transporter	NA	NA	NA	NA	NA
VEF83747.1|4269313_4270078_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
VEF83748.1|4270265_4270937_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
VEF83749.1|4271212_4271821_-	UDP pyrophosphate phosphatase	NA	NA	NA	NA	NA
VEF83750.1|4271817_4272588_-	membrane protein	NA	NA	NA	NA	NA
VEF83751.1|4272860_4274549_-	trka, Potassium channel-family protein	NA	NA	NA	NA	NA
VEF83752.1|4274958_4275222_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.0e-26
VEF83753.1|4275536_4275845_+	Protein of uncharacterised function (DUF1418)	NA	NA	NA	NA	NA
VEF83754.1|4275963_4276449_+	putative sensory transduction regulator	NA	NA	NA	NA	NA
VEF83755.1|4276894_4278004_+	putrescine ABC transporter periplasmic-binding protein	NA	NA	NA	NA	NA
VEF83756.1|4278170_4279304_+	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.3e-30
VEF83757.1|4279325_4280291_+	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEF83758.1|4280287_4281133_+	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEF83759.1|4281282_4281759_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
VEF83760.1|4281847_4282975_+	23S rRNA methyluridine methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.9	3.8e-30
VEF83761.1|4283094_4283844_-	ABC transporter, periplasmic arginine-bindingprotein artI precursor	NA	NA	NA	NA	NA
VEF83762.1|4284528_4285197_-	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
VEF83763.1|4285196_4285913_-	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
VEF83764.1|4285924_4286656_-	arginine-binding periplasmic protein 1	NA	NA	NA	NA	NA
VEF83765.1|4286676_4287456_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	35.9	2.4e-28
VEF83766.1|4287828_4288404_-	putative lipoprotein	NA	NA	NA	NA	NA
VEF83767.1|4288472_4289483_-	putative nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VEF83768.1|4289614_4291072_-	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
VEF83769.1|4291068_4292088_-	L-threonine aldolase	NA	NA	NA	NA	NA
VEF83770.1|4292225_4293113_-	O-methyltransferase involved in polyketide biosynthesis	NA	NA	NA	NA	NA
VEF83771.1|4293344_4295066_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
VEF83772.1|4295165_4296188_-	HCP oxidoreductase	NA	NA	NA	NA	NA
VEF83773.1|4296286_4297939_-	hydroxylamine reductase	NA	NA	NA	NA	NA
VEF83774.1|4298135_4299035_-	putative surface protein	NA	NA	NA	NA	NA
VEF83775.1|4299285_4300950_+	putative OLD family ATP-dependent endonuclease	NA	NA	NA	NA	NA
VEF83776.1|4300946_4301930_-	putative virulence factor	NA	NA	NA	NA	NA
VEF83777.1|4302205_4303234_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
VEF83778.1|4303233_4305183_+	macrolide transporter ATP-binding /permease	NA	G9BWD6	Planktothrix_phage	38.1	4.7e-36
VEF83779.1|4305971_4306319_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.9e-15
VEF83780.1|4306344_4308621_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.5e-166
VEF83781.1|4308865_4309084_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEF83782.1|4309249_4309960_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
VEF83783.1|4310193_4311918_-	cysteine/glutathione ABC transporter membrane /ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.3	7.3e-17
VEF83784.1|4311920_4313687_-	cysteine/glutathione ABC transporter membrane /ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.6	1.4e-26
VEF83785.1|4313961_4314924_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	45.0	4.5e-64
VEF83786.1|4315364_4315535_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83787.1|4315693_4316188_+	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VEF83788.1|4316309_4319924_+	putative cell division protein	NA	A0A218M9A2	Mycobacterium_phage	48.5	2.3e-89
VEF83789.1|4320153_4320765_+	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEF83790.1|4320772_4322116_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
VEF83791.1|4322287_4323580_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	2.0e-91
VEF83792.1|4324022_4325042_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEF83793.1|4325156_4326350_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	71.0	9.1e-75
VEF83794.1|4326668_4327817_+	putative MFS family transporter protein	NA	NA	NA	NA	NA
VEF83795.1|4327894_4328635_-	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	3.6e-21
VEF83796.1|4328713_4330996_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	1.1e-156
VEF83797.1|4331048_4331906_-	formate transporter	NA	NA	NA	NA	NA
VEF83798.1|4332342_4332477_-	Yersinia protein of uncharacterised function (DUF3831)	NA	NA	NA	NA	NA
VEF83799.1|4332752_4333772_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 12
LR134335	Yersinia enterocolitica subsp. palearctica strain NCTC13769 genome assembly, chromosome: 1	4560086	4521836	4560048	4560086	transposase,tail,plate	Erwinia_phage(31.25%)	43	NA	NA
VEF83965.1|4521836_4523030_+|transposase	transposase for IS1330	transposase	S5FM71	Shigella_phage	61.5	1.3e-137
VEF83966.1|4523165_4523495_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83967.1|4523498_4524566_-	HNH endonuclease domain-containing protein	NA	NA	NA	NA	NA
VEF83968.1|4525356_4526217_+	ferrous iron transport permease EfeU	NA	NA	NA	NA	NA
VEF83969.1|4526233_4527364_+	ferrous iron transport periplasmic protein EfeO,contains peptidase-M75 domain and (frequently) cupredoxin-like domain	NA	NA	NA	NA	NA
VEF83970.1|4527372_4528674_+	ferrous iron transport peroxidase EfeB	NA	NA	NA	NA	NA
VEF83971.1|4528875_4529475_-	TrpR binding protein WrbA	NA	NA	NA	NA	NA
VEF83972.1|4529644_4530127_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEF83973.1|4530460_4531639_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VEF83974.1|4531846_4532437_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	86.8	4.3e-78
VEF83975.1|4532510_4533182_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	71.6	1.6e-81
VEF83976.1|4533252_4533801_-	4-hydroxyphenylacetate 3-monooxygenase coupling protein	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
VEF83977.1|4533850_4534441_-	putative reductase RutE in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEF83978.1|4534452_4534596_-	putative hydrolase or acyltransferase RutD in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEF83979.1|4534602_4535289_-	putative hydrolase	NA	NA	NA	NA	NA
VEF83980.1|4535321_4535708_-	putative ring-opening amidohydrolase RutC in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEF83981.1|4535757_4536546_-	putative isochorismatase	NA	NA	NA	NA	NA
VEF83982.1|4536545_4536926_-	putative monooxygenase RutA in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEF83983.1|4537100_4537769_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VEF83984.1|4537826_4539257_-	D-alanine/D-serine/glycine permease	NA	NA	NA	NA	NA
VEF83985.1|4540069_4540342_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEF83986.1|4541341_4542076_-	biotin synthesis protein bioC	NA	A0A1X9I6N4	Streptococcus_phage	40.7	1.1e-49
VEF83987.1|4542479_4542977_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83988.1|4543058_4543388_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF83989.1|4543532_4545032_+	alpha-amylase	NA	NA	NA	NA	NA
VEF83990.1|4545283_4545538_+	membrane protein	NA	NA	NA	NA	NA
VEF83991.1|4545568_4545907_-	GlpM protein	NA	NA	NA	NA	NA
VEF83992.1|4546017_4546242_-	Protein of uncharacterised function (DUF2594)	NA	NA	NA	NA	NA
VEF83993.1|4546935_4547592_+	response regulator	NA	NA	NA	NA	NA
VEF83994.1|4547584_4549417_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
VEF83995.1|4549475_4550024_+	phosphatidylglycerophosphate synthetase	NA	NA	NA	NA	NA
VEF83996.1|4550717_4550933_-	prophage p2 ogr protein	NA	Q37973	Salmonella_virus	62.5	7.4e-20
VEF83997.1|4551024_4552191_-	gene D protein	NA	S4TRX8	Salmonella_phage	68.1	1.4e-144
VEF83998.1|4552187_4552673_-|tail	phage-related tail protein	tail	S4TUC3	Salmonella_phage	61.6	9.2e-50
VEF83999.1|4552675_4555105_-	phage protein	NA	Q7Y4C8	Escherichia_virus	46.8	1.5e-156
VEF84000.1|4555252_4555564_-|tail	putative phage tail protein	tail	F1BUU0	Erwinia_phage	65.9	1.0e-25
VEF84001.1|4555616_4556132_-|tail	major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	1.1e-66
VEF84002.1|4556145_4557315_-|tail	phage tail sheath monomer	tail	F1BUU3	Erwinia_phage	80.5	6.2e-185
VEF84003.1|4557469_4557652_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEF84004.1|4557662_4558673_-|tail	tail fiber protein	tail	A9YX14	Burkholderia_phage	42.9	5.6e-41
VEF84005.1|4558808_4558952_-|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	61.7	9.6e-08
VEF84006.1|4558948_4559104_-|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	77.8	5.4e-12
VEF84007.1|4559412_4560048_-|plate	baseplate assembly protein J	plate	F1BUP2	Erwinia_phage	79.6	4.3e-39
