The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134345	Mycobacteroides chelonae strain NCTC946 genome assembly, chromosome: 1	5348362	480703	539499	5348362	transposase,integrase	Only_Syngen_Nebraska_virus(20.0%)	56	477116:477132	541665:541681
477116:477132	attL	CGGTGACGTCGTCGCCG	NA	NA	NA	NA
VEG07459.1|480703_481681_-|transposase	transposase for ISMyma06	transposase	NA	NA	NA	NA
VEG07460.1|481786_482323_-	putative secreted protein	NA	NA	NA	NA	NA
VEG07461.1|482363_483422_-	Ferredoxin:Oxidoreductase FAD/NAD(P)-binding:Oxidoreductase FAD-binding region	NA	NA	NA	NA	NA
VEG07462.1|483615_484806_+	pigment production hydroxylase	NA	NA	NA	NA	NA
VEG07463.1|484818_485736_+	putative hydrolase or acyltransferase of alpha/beta superfamily	NA	NA	NA	NA	NA
VEG07464.1|485732_486632_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
VEG07465.1|486637_487210_+	Flavin reductase-like, FMN-binding protein	NA	NA	NA	NA	NA
VEG07466.1|487210_487468_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07467.1|487657_487825_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07468.1|487883_488789_-	transcriptional regulator	NA	NA	NA	NA	NA
VEG07469.1|488897_490262_+	major facilitator superfamily transporter	NA	NA	NA	NA	NA
VEG07470.1|490258_491005_+	dehydrogenase of uncharacterised specificity, short-chain alcohol dehydrogenase like protein	NA	NA	NA	NA	NA
VEG07471.1|490989_492897_+	acetoacetyl-CoA synthase	NA	NA	NA	NA	NA
VEG07472.1|492880_494164_-	HNH nuclease	NA	NA	NA	NA	NA
VEG07473.1|494174_495365_-	ROK family protein	NA	NA	NA	NA	NA
VEG07474.1|495459_496680_+	xylose isomerase	NA	NA	NA	NA	NA
VEG07475.1|496769_497843_+	periplasmic binding protein/LacI transcriptional regulator	NA	NA	NA	NA	NA
VEG07476.1|497842_498622_+	ABC transporter--like protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	29.8	1.1e-07
VEG07477.1|498618_499926_+	inner-membrane translocator	NA	NA	NA	NA	NA
VEG07478.1|499917_501072_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
VEG07479.1|501082_502024_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07480.1|502020_502974_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07481.1|502978_504103_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07482.1|505756_506935_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07483.1|506931_507726_+	dehydrogenase	NA	NA	NA	NA	NA
VEG07484.1|507722_508316_+	transcriptional regulator	NA	NA	NA	NA	NA
VEG07485.1|508317_509478_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
VEG07486.1|509498_510155_+	NUDIX hydrolase	NA	NA	NA	NA	NA
VEG07487.1|510155_511016_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07488.1|511032_512151_-	oxidoreductase, Rxyl_3153 family	NA	E3SJ82	Synechococcus_phage	29.1	1.1e-34
VEG07489.1|512196_512922_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07490.1|512918_513572_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07491.1|513615_514686_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
VEG07492.1|514688_515435_-	acyl CoA:acetate/3-ketoacid CoA transferase subunit beta	NA	NA	NA	NA	NA
VEG07493.1|515434_516316_-	coenzyme A transferase	NA	NA	NA	NA	NA
VEG07494.1|516312_517068_-	enoyl-CoA hydratase/carnithine racemase	NA	NA	NA	NA	NA
VEG07495.1|517123_517900_+	dehydrogenase of uncharacterised specificity, short-chain alcohol dehydrogenase like protein	NA	NA	NA	NA	NA
VEG07496.1|517914_518820_+	dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	6.0e-10
VEG07497.1|518823_519804_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07498.1|519800_521168_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07499.1|521217_522531_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
VEG07500.1|522635_523025_+	site-specific recombinase XerC	NA	NA	NA	NA	NA
VEG07501.1|523083_524247_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
VEG07502.1|524365_525616_+	cytochrome P450 CYP125	NA	NA	NA	NA	NA
VEG07503.1|525657_526677_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07504.1|526679_527843_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEG07505.1|527839_528838_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
VEG07506.1|528834_529233_+	MaoC like domain-containing protein	NA	NA	NA	NA	NA
VEG07507.1|529229_530393_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
VEG07508.1|530534_531062_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
VEG07509.1|531074_532583_+|integrase	phage integrase-like protein SAM-like protein	integrase	NA	NA	NA	NA
VEG07510.1|533323_534364_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG07511.1|534360_536037_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
VEG07512.1|537114_537441_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VEG07513.1|537470_538202_+|transposase	putative transposase for insertion element IS6110 (second part)	transposase	Q8W6R2	Burkholderia_virus	42.7	9.0e-33
VEG07514.1|538098_539499_-|integrase	integrase catalytic subunit	integrase	W5R8L2	Staphylococcus_phage	36.2	7.0e-34
541665:541681	attR	CGGTGACGTCGTCGCCG	NA	NA	NA	NA
>prophage 2
LR134345	Mycobacteroides chelonae strain NCTC946 genome assembly, chromosome: 1	5348362	2010138	2017898	5348362		Bacillus_phage(16.67%)	8	NA	NA
VEG08883.1|2010138_2010996_+	short-chain alcohol dehydrogenase	NA	W8CYX9	Bacillus_phage	28.8	1.7e-06
VEG08884.1|2010999_2012187_-	Na+/H+ antiporter	NA	A0A077SLJ9	Escherichia_phage	36.2	2.7e-58
VEG08885.1|2012191_2013256_-	nucleotidyltransferase/DNA polymerase involved in DNA repair	NA	F1C5A5	Cronobacter_phage	28.3	3.7e-19
VEG08886.1|2013264_2013840_-	transcriptional regulator	NA	NA	NA	NA	NA
VEG08887.1|2013962_2014514_+	putative flavoprotein	NA	A0A2P0ZL77	Lactobacillus_phage	36.5	3.7e-07
VEG08888.1|2014991_2015249_+	ribonucleoside-diphosphate reductase class Ib glutaredoxin subunit	NA	V5UN81	Mycobacterium_phage	67.1	2.8e-21
VEG08889.1|2015301_2015754_+	ribonucleoside-diphosphate reductase 2, operon protein nrdI	NA	NA	NA	NA	NA
VEG08890.1|2015777_2017898_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A2H4P9B7	Corynebacterium_phage	42.0	2.8e-207
>prophage 3
LR134345	Mycobacteroides chelonae strain NCTC946 genome assembly, chromosome: 1	5348362	5062542	5100747	5348362	transposase,integrase,protease	Burkholderia_virus(30.0%)	39	5062405:5062464	5099432:5099539
5062405:5062464	attL	TGAAACGCCCTGGAAATCCCGGAGGCTCCTGACCTTGGAAACGAGGATGCAGGTATGCCG	NA	NA	NA	NA
VEG11818.1|5062542_5063382_-|integrase	integrase catalytic subunit	integrase	U5P429	Shigella_phage	35.3	1.1e-34
VEG11819.1|5063432_5063726_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VEG11820.1|5064165_5065005_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	54.8	8.1e-70
VEG11821.1|5065143_5066391_+|transposase	transposase, Mutator family protein	transposase	A0A220NQR7	Corynebacterium_phage	42.2	1.2e-80
VEG11822.1|5067097_5068276_+	theronine dehydrogenase-like Zn-dependent dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.9	7.0e-11
VEG11823.1|5068379_5070212_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11824.1|5070208_5070382_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11825.1|5070378_5070801_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11826.1|5070803_5072093_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11827.1|5072103_5072655_+	nicotinamidase-like amidase	NA	NA	NA	NA	NA
VEG11828.1|5072704_5074954_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
VEG11829.1|5075044_5075287_-	PAS domain S-box/diguanylate cyclase (GGDEF) domain-containing protein	NA	NA	NA	NA	NA
VEG11830.1|5075648_5076221_+	transcriptional regulator	NA	NA	NA	NA	NA
VEG11831.1|5076341_5077400_+	beta-1,4-xylanase	NA	A0A067XRB1	Caulobacter_phage	32.0	7.0e-18
VEG11832.1|5077392_5078742_-	uncharacterized protein, probably involved in trehalose biosynthesis	NA	NA	NA	NA	NA
VEG11833.1|5078738_5080541_-	trehalose synthase	NA	NA	NA	NA	NA
VEG11834.1|5080636_5081437_+	putative heme iron utilization protein	NA	NA	NA	NA	NA
VEG11835.1|5081472_5082039_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	32.9	8.0e-13
VEG11836.1|5082035_5083076_-	ABC-type spermidine/putrescine transport system, ATPase component	NA	G3M9Y6	Bacillus_virus	39.3	2.0e-30
VEG11837.1|5083072_5083855_-	binding-protein-dependent transport systems inner membrane component	NA	NA	NA	NA	NA
VEG11838.1|5083851_5084712_-	binding-protein-dependent transport systems inner membrane component	NA	NA	NA	NA	NA
VEG11839.1|5084724_5085855_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
VEG11840.1|5086038_5086584_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11841.1|5086627_5087035_+	PPOX class probable F420-dependent enzyme, Rv0121 family	NA	NA	NA	NA	NA
VEG11842.1|5087136_5089287_+	translation elongation factor 2 (EF-2/EF-G)	NA	NA	NA	NA	NA
VEG11843.1|5089320_5090049_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11844.1|5090045_5091242_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11845.1|5091238_5092777_-|protease	putative protease	protease	A0A1V0SLL0	Klosneuvirus	27.2	4.8e-20
VEG11846.1|5092871_5093162_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11847.1|5093275_5093662_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
VEG11848.1|5093942_5094254_+	anti-anti-sigma regulatory factor (antagonist of anti-sigma factor)	NA	NA	NA	NA	NA
VEG11849.1|5094277_5095063_+	response regulator with putative antiterminator output domain	NA	NA	NA	NA	NA
VEG11850.1|5095059_5095962_-	conserved alanine, valine and leucine rich membrane protein	NA	NA	NA	NA	NA
VEG11851.1|5096092_5096431_+	transmembrane protein	NA	NA	NA	NA	NA
VEG11852.1|5096509_5096893_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11853.1|5097107_5097374_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG11854.1|5097370_5097916_-	transcriptional regulator	NA	NA	NA	NA	NA
VEG11855.1|5098013_5099315_-	arabinose efflux permease family protein	NA	Q6JIH2	Burkholderia_virus	38.0	3.0e-63
VEG11856.1|5099907_5100747_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	54.8	8.1e-70
5099432:5099539	attR	TGAAACGCCCTGGAAATCCCGGAGGCTCCTGACCTTGGAAACGAGGATGCAGGTATGCCGAAGGAACAGTCGCCCGGGAAGCCGACGACACGTCGATACAGTGCCGAG	NA	NA	NA	NA
