The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134369	Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1	2385160	997156	1039962	2385160	integrase,protease,transposase	Gordonia_phage(40.0%)	39	992458:992474	1044744:1044760
992458:992474	attL	CCGGCCTGTCCGCCGTG	NA	NA	NA	NA
VEG79210.1|997156_998440_+|transposase	transposase	transposase	A0A1B3AZE5	Gordonia_phage	30.8	2.9e-10
VEG79211.1|998526_999582_-|integrase	phage integrase	integrase	A0A2K9VH95	Gordonia_phage	30.8	2.3e-05
VEG79212.1|999578_1000544_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
VEG79213.1|1000540_1001743_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
VEG79214.1|1001976_1002198_+|transposase	transposase	transposase	NA	NA	NA	NA
VEG79215.1|1002568_1002703_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79216.1|1002941_1003166_-	protein	NA	NA	NA	NA	NA
VEG79217.1|1003252_1004077_+	ribosylglycohydrolase	NA	G3M9X5	Bacillus_virus	27.4	3.7e-19
VEG79218.1|1004586_1005477_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79219.1|1005766_1006201_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79220.1|1006215_1007154_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79221.1|1007178_1008171_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79222.1|1008198_1008426_+	transcriptional regulator	NA	NA	NA	NA	NA
VEG79223.1|1009225_1011001_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEG79224.1|1011476_1012424_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VEG79225.1|1012659_1013595_-	peptidase, S9A/B/C family, catalytic domain protein	NA	NA	NA	NA	NA
VEG79226.1|1013851_1014811_+	oxidoreductase	NA	NA	NA	NA	NA
VEG79227.1|1014851_1015490_-	esterase	NA	NA	NA	NA	NA
VEG79228.1|1015566_1016637_+	methyltransferase domain protein	NA	NA	NA	NA	NA
VEG79229.1|1016742_1017300_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
VEG79230.1|1017410_1019714_+	5- methyltetrahydropteroyltriglutamate/homocysteine S-methyltransferase	NA	NA	NA	NA	NA
VEG79231.1|1019772_1020627_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
VEG79232.1|1020760_1021714_+	putative choloylglycine hydrolase	NA	M1H8K9	Paramecium_bursaria_Chlorella_virus	26.5	1.0e-20
VEG79233.1|1021769_1025000_+	glne	NA	NA	NA	NA	NA
VEG79234.1|1025141_1026104_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HQL8	Paramecium_bursaria_Chlorella_virus	46.2	9.3e-54
VEG79235.1|1026103_1026523_+	aspartate carbamoyltransferase regulatory chain, allosteric domain protein	NA	NA	NA	NA	NA
VEG79236.1|1026519_1028016_+	putative dihydroorotase	NA	NA	NA	NA	NA
VEG79237.1|1028033_1028987_+	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
VEG79238.1|1029122_1029947_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
VEG79239.1|1029949_1030921_+	dihydroorotate dehydrogenase 1B	NA	NA	NA	NA	NA
VEG79240.1|1030929_1031625_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
VEG79241.1|1031733_1031886_+	protein	NA	NA	NA	NA	NA
VEG79242.1|1032100_1033222_+	protein	NA	NA	NA	NA	NA
VEG79243.1|1033376_1034300_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEG79244.1|1034401_1035031_-	had superfamily hydrolase	NA	NA	NA	NA	NA
VEG79245.1|1035132_1036896_-	protein	NA	NA	NA	NA	NA
VEG79246.1|1036935_1038126_-	class I/II aminotransferase	NA	NA	NA	NA	NA
VEG79247.1|1038497_1039187_-	protein	NA	NA	NA	NA	NA
VEG79248.1|1039443_1039962_+|protease	putative ThiJ family intracellular protease/amidase	protease	NA	NA	NA	NA
1044744:1044760	attR	CACGGCGGACAGGCCGG	NA	NA	NA	NA
>prophage 2
LR134369	Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1	2385160	1310337	1354333	2385160	integrase,protease,tRNA,transposase	Prochlorococcus_phage(16.67%)	41	1352995:1353054	1356380:1356475
VEG79543.1|1310337_1310706_-|protease	zn-dependent protease	protease	NA	NA	NA	NA
VEG79544.1|1310776_1311484_-	short chain dehydrogenase/reductase family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	28.9	9.4e-11
VEG79545.1|1311527_1313129_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	29.3	1.1e-51
VEG79546.1|1313224_1313380_+	protein	NA	NA	NA	NA	NA
VEG79547.1|1313444_1315001_-	anthranilate synthase component I	NA	NA	NA	NA	NA
VEG79548.1|1315081_1315477_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
VEG79549.1|1315610_1316381_-	imidazole glycerol phosphate synthase, cyclase subunit HisF	NA	NA	NA	NA	NA
VEG79550.1|1316555_1317104_+	thij	NA	NA	NA	NA	NA
VEG79551.1|1317104_1318274_-	2-vinyl bacteriochlorophyllide hydratase	NA	NA	NA	NA	NA
VEG79552.1|1318484_1319471_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
VEG79553.1|1319493_1320045_-	ribosome recycling factor	NA	NA	NA	NA	NA
VEG79554.1|1320121_1320862_-	UMP kinase	NA	NA	NA	NA	NA
VEG79555.1|1321035_1321887_-	translation elongation factor Ts	NA	NA	NA	NA	NA
VEG79556.1|1321965_1322811_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
VEG79557.1|1323165_1323654_-	def1	NA	NA	NA	NA	NA
VEG79558.1|1323660_1325757_-	long-chain acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	26.1	1.7e-44
VEG79559.1|1325847_1326339_-	protein	NA	NA	NA	NA	NA
VEG79560.1|1326500_1327625_-	IMP dehydrogenase family protein	NA	NA	NA	NA	NA
VEG79561.1|1327752_1328973_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
VEG79562.1|1329221_1330853_+	protein	NA	NA	NA	NA	NA
VEG79563.1|1330930_1331620_-	peptidase M23B	NA	NA	NA	NA	NA
VEG79564.1|1332626_1333670_-|protease	putative glycoprotease GCP	protease	A0A0R6PI74	Moraxella_phage	39.3	7.8e-54
VEG79565.1|1333666_1334260_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
VEG79566.1|1334237_1335119_-|protease	metal-dependent proteases-like protein	protease	NA	NA	NA	NA
VEG79567.1|1335180_1335747_-	atpase	NA	NA	NA	NA	NA
VEG79568.1|1335767_1336739_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
VEG79569.1|1336805_1338152_-	huti	NA	NA	NA	NA	NA
VEG79570.1|1338291_1340046_-	comec	NA	NA	NA	NA	NA
VEG79571.1|1340042_1340747_-	competence protein ComEA	NA	NA	NA	NA	NA
VEG79572.1|1340981_1343945_-|tRNA	leucyl-tRNA synthetase LeuS	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	6.6e-199
VEG79573.1|1343987_1344833_-	hisj3	NA	NA	NA	NA	NA
VEG79574.1|1344928_1345879_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
VEG79575.1|1345993_1346839_-	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
VEG79576.1|1346907_1348203_+	sam-dependent methyltransferase	NA	NA	NA	NA	NA
VEG79577.1|1348230_1348635_-	putative flavin-nucleotide-binding protein	NA	NA	NA	NA	NA
VEG79578.1|1348913_1349849_+	EamA-like transporter family protein	NA	NA	NA	NA	NA
VEG79579.1|1350232_1351201_+	protein	NA	NA	NA	NA	NA
VEG79580.1|1351243_1351813_+	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.3	1.2e-21
VEG79581.1|1352077_1352425_+|transposase	transposase	transposase	NA	NA	NA	NA
VEG79582.1|1352433_1353000_+|transposase	transposase	transposase	NA	NA	NA	NA
1352995:1353054	attL	GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTG	NA	NA	NA	NA
VEG79583.1|1353130_1354333_+|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
VEG79583.1|1353130_1354333_+|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
1356380:1356475	attR	CACGGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCACTGTTAAACCGATGTCGGTTTAACAGTGACATGGG	NA	NA	NA	NA
