The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	298712	405406	2186098	tail,transposase,head,plate,tRNA,protease	Haemophilus_phage(19.51%)	113	NA	NA
VEJ36662.1|298712_299213_+|transposase	IS1016 transposase	transposase	NA	NA	NA	NA
VEJ36663.1|300031_301090_-	alanine racemase	NA	NA	NA	NA	NA
VEJ36664.1|301414_301879_+	putative AsnC-family transcriptional regulator	NA	NA	NA	NA	NA
VEJ36665.1|302482_302971_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
VEJ36666.1|303029_303758_-	Transcriptional regulatory protein PmpR	NA	NA	NA	NA	NA
VEJ36667.1|304084_305503_+	amino-acid transporter sodium/alanine symporter	NA	NA	NA	NA	NA
VEJ36668.1|305566_306193_-	Hemolysin, putative	NA	NA	NA	NA	NA
VEJ36669.1|306335_307685_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEJ36670.1|307746_309141_+	integral membrane protein	NA	A0A0R6PHS5	Moraxella_phage	50.8	2.5e-92
VEJ36671.1|309351_312240_-	initiation factor IF2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	1.2e-19
VEJ36672.1|312251_313754_-	transcription elongation factor NusA	NA	NA	NA	NA	NA
VEJ36673.1|313781_314213_-	Ribosome maturation factor RimP	NA	NA	NA	NA	NA
VEJ36674.1|314403_315684_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	8.5e-87
VEJ36675.1|316086_317721_+	YhbX/YhjW/YijP/YjdB family protein	NA	NA	NA	NA	NA
VEJ36676.1|317796_318354_+	nitroreductase	NA	NA	NA	NA	NA
VEJ36677.1|318554_319244_-	opacity protein	NA	NA	NA	NA	NA
VEJ36678.1|321132_321888_-	Serine/threonine-protein kinase pkn1	NA	A0A7F1	Microcystis_virus	32.7	3.9e-15
VEJ36679.1|322067_323240_-	nitrite reductase	NA	NA	NA	NA	NA
VEJ36680.1|323621_325877_+	nitric oxide reductase	NA	NA	NA	NA	NA
VEJ36681.1|326140_326845_-	putative transcriptional regulator	NA	A0A0A1IWY4	Pseudomonas_phage	33.2	6.9e-22
VEJ36682.1|327402_329448_+|transposase	transposase	transposase	F6MII5	Haemophilus_phage	40.0	6.5e-113
VEJ36683.1|329489_330404_+	putative phage transposition protein	NA	A0A2D1GNS0	Pseudomonas_phage	44.5	2.0e-53
VEJ36684.1|330479_330722_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36685.1|330711_331011_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36686.1|331013_331166_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36687.1|331181_331346_+	small secreted protein	NA	NA	NA	NA	NA
VEJ36688.1|331362_331542_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36689.1|331538_331853_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36690.1|332332_332788_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36691.1|332792_332954_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36692.1|332946_333558_+	Protein of uncharacterised function (DUF3164)	NA	A0A0M3LQ92	Mannheimia_phage	54.4	6.3e-56
VEJ36693.1|333563_334214_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36694.1|334214_334415_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36695.1|334463_334739_+	DNA-binding protein HU-B	NA	A3E2K9	Sodalis_phage	52.8	8.9e-18
VEJ36696.1|334814_335249_+	phage protein	NA	L7P7R1	Pseudomonas_phage	43.3	5.2e-20
VEJ36697.1|335245_335692_+	integral membrane protein	NA	A0A2D1GNW5	Pseudomonas_phage	29.2	2.5e-09
VEJ36698.1|335739_336381_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36699.1|336512_337058_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	4.1e-38
VEJ36700.1|337263_337428_+	phage protein	NA	NA	NA	NA	NA
VEJ36701.1|337430_337667_+	phage protein	NA	NA	NA	NA	NA
VEJ36702.1|337638_338058_+	putative phage associated membrane protein	NA	NA	NA	NA	NA
VEJ36703.1|338077_338260_+	phage protein	NA	NA	NA	NA	NA
VEJ36704.1|338304_338475_-	phage protein	NA	NA	NA	NA	NA
VEJ36705.1|338487_338706_+	phage protein	NA	NA	NA	NA	NA
VEJ36706.1|338702_339044_+	phage protein	NA	NA	NA	NA	NA
VEJ36707.1|339040_339322_+	phage protein	NA	NA	NA	NA	NA
VEJ36708.1|339321_339537_+	phage protein	NA	NA	NA	NA	NA
VEJ36709.1|339539_340046_+	phage protein	NA	A0A0A1IX73	Pseudomonas_phage	56.2	7.1e-45
VEJ36710.1|340042_340237_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36711.1|340248_341868_+	phage protein	NA	B7SDN0	Haemophilus_phage	70.5	1.7e-220
VEJ36712.1|341946_343506_+	phage protein	NA	A0A0M3LRU4	Mannheimia_phage	47.8	3.1e-131
VEJ36713.1|343498_344845_+|head	putative phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	31.6	1.7e-40
VEJ36714.1|344948_345446_+|tail	putative phage tail completion protein	tail	A0A0M3LSP9	Mannheimia_phage	37.3	2.4e-13
VEJ36715.1|345663_346719_+	putative phage maturation peptidase	NA	A0A0M5N0Q6	Ralstonia_phage	34.3	7.9e-30
VEJ36716.1|346740_347643_+|head	putative GpT-like prophage major head subunit protein	head	A0SMP3	Pseudomonas_virus	64.8	5.0e-110
VEJ36717.1|347680_348154_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36718.1|348150_348576_+	phage protein	NA	A0A0C4UR02	Shigella_phage	41.7	2.9e-15
VEJ36719.1|348559_349228_+	putative Gp37-like prophage protein	NA	NA	NA	NA	NA
VEJ36720.1|349224_349413_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36721.1|349412_350840_+|tail	putative bacteriophage Mu-like tail sheath protein	tail	B7SDP8	Haemophilus_phage	42.0	3.1e-85
VEJ36722.1|350853_351228_+	Uncharacterised protein	NA	F6MIK8	Haemophilus_phage	45.2	3.3e-23
VEJ36723.1|351403_352240_+	putative peptidase	NA	L7TKV7	Pseudomonas_virus	55.5	4.6e-25
VEJ36724.1|352457_352601_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36725.1|352729_353119_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36726.1|353076_353325_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36727.1|353321_355001_+|tail	Phage-related minor tail protein	tail	A0A0M3LPB6	Mannheimia_phage	34.7	4.9e-42
VEJ36728.1|354951_355371_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36729.1|355370_356738_+	putative phage DNA circulation proteins	NA	F6MIL2	Haemophilus_phage	28.9	6.2e-43
VEJ36730.1|356721_357861_+|tail	putative phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	44.0	1.6e-81
VEJ36731.1|357861_358491_+	putative Gp45-like prophage protein	NA	A0A0M3LPA3	Mannheimia_phage	47.2	2.3e-32
VEJ36732.1|358551_358905_+	putative Gp46-like prophage protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	53.0	3.7e-24
VEJ36733.1|358901_359387_+|plate	baseplate J-like protein	plate	F6MIL6	Haemophilus_phage	41.4	6.8e-21
VEJ36734.1|359389_359965_+	Phage-like element PBSX protein xkdT	NA	F6MIL6	Haemophilus_phage	42.0	3.4e-35
VEJ36735.1|359961_360528_+	phage protein	NA	A0A0M3LQE1	Mannheimia_phage	36.3	8.0e-21
VEJ36736.1|360530_362813_+|tail	putative tail fiber protein	tail	U5PSK6	Bacillus_phage	35.3	9.4e-20
VEJ36737.1|362809_363433_+	putative phage fiber-spike protein	NA	NA	NA	NA	NA
VEJ36738.1|363433_363922_+	Uncharacterised protein	NA	A0A0R6PGL8	Moraxella_phage	47.7	6.7e-24
VEJ36739.1|364269_365109_+	putative N-6adenine-specific DNA methylase	NA	A0A0R6PH56	Moraxella_phage	50.0	6.2e-78
VEJ36740.1|365368_365902_+	glutathione peroxidase	NA	NA	NA	NA	NA
VEJ36741.1|365964_367149_-	putative muramoyltetrapeptide carboxypeptidase (LD-carboxypeptidase A)	NA	NA	NA	NA	NA
VEJ36742.1|367188_367593_-	putative HIT domain protein	NA	NA	NA	NA	NA
VEJ36743.1|368894_369332_-	ribonuclease H	NA	J9Q745	Salmonella_phage	55.0	7.7e-40
VEJ36744.1|369460_370315_+	tellurite resistance protein TehB	NA	NA	NA	NA	NA
VEJ36745.1|370364_371171_-	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEJ36746.1|372684_373650_-|transposase	transposase for IS1655	transposase	W5R8L2	Staphylococcus_phage	35.5	1.0e-36
VEJ36747.1|373953_375366_-	potassium transporter peripheral membrane protein	NA	NA	NA	NA	NA
VEJ36748.1|375463_376987_-	fumarate hydratase	NA	NA	NA	NA	NA
VEJ36749.1|377293_378100_-	ABC transporter periplasmic histidine-binding protein precursor	NA	NA	NA	NA	NA
VEJ36750.1|378151_378403_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36751.1|378502_379264_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36752.1|379561_380731_+	putative O-succinylhomoserine sulfhydrolase	NA	A0A2K9L4S9	Tupanvirus	23.6	3.3e-05
VEJ36753.1|380825_381032_+	Protein of uncharacterised function (DUF2788)	NA	NA	NA	NA	NA
VEJ36754.1|382065_382818_-	Ribosomal RNA small subunit methyltransferase J	NA	NA	NA	NA	NA
VEJ36755.1|382921_383389_-	two component response regulator	NA	NA	NA	NA	NA
VEJ36756.1|383381_384959_-	two component sensor kinase	NA	NA	NA	NA	NA
VEJ36757.1|384978_387276_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	37.4	7.6e-86
VEJ36758.1|387577_388261_+	phosphoglyceromutase	NA	NA	NA	NA	NA
VEJ36759.1|389062_390091_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36760.1|390080_391475_-	Type I restriction-modification system methyltransferase subunit	NA	Q6NE04	Leptospira_phage	39.9	5.1e-61
VEJ36761.1|391652_391895_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36762.1|392183_392915_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36763.1|392976_395223_-|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L1X7	Tupanvirus	36.2	1.4e-47
VEJ36764.1|395174_395633_-|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	50.0	6.4e-29
VEJ36765.1|395804_396935_+	ABC transporter periplasmic binding protein, polyamine	NA	NA	NA	NA	NA
VEJ36766.1|396975_397839_-	Predicted permease, DMT superfamily	NA	NA	NA	NA	NA
VEJ36767.1|398024_398513_+	lipoprotein	NA	NA	NA	NA	NA
VEJ36768.1|398574_399480_-	AraC family transcription regulator	NA	NA	NA	NA	NA
VEJ36769.1|399608_399944_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
VEJ36770.1|399961_400528_+|transposase	transposase	transposase	NA	NA	NA	NA
VEJ36771.1|400754_401318_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
VEJ36772.1|402116_403217_+|protease	putative periplasmic protease	protease	NA	NA	NA	NA
VEJ36773.1|403267_404131_-	integral membrane protein	NA	NA	NA	NA	NA
VEJ36774.1|404398_405406_-|transposase	IS1106A3 transposase	transposase	NA	NA	NA	NA
>prophage 2
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	574551	618565	2186098	tRNA,transposase	Acinetobacter_phage(25.0%)	42	NA	NA
VEJ36915.1|574551_575373_+|transposase	insertion element IS1106 transposase	transposase	NA	NA	NA	NA
VEJ36916.1|576320_578117_-	aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	46.9	1.3e-154
VEJ36917.1|578172_578637_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36918.1|578633_579827_+	membrane protein	NA	NA	NA	NA	NA
VEJ36919.1|579981_581493_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.9	2.9e-86
VEJ36920.1|581676_581907_-	FAD-binding protein	NA	NA	NA	NA	NA
VEJ36921.1|581910_582789_-	peptidase domain-containing protein	NA	NA	NA	NA	NA
VEJ36922.1|582818_583946_-	Fic family protein	NA	NA	NA	NA	NA
VEJ36923.1|584520_585894_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.5	1.1e-52
VEJ36924.1|586259_587270_+|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
VEJ36925.1|587299_587539_+	factor-for-inversion-stimulation protein	NA	NA	NA	NA	NA
VEJ36926.1|587541_588078_+	Holliday junction resolvase	NA	NA	NA	NA	NA
VEJ36927.1|588116_588998_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
VEJ36928.1|589496_589631_+	DNA-binding protein	NA	NA	NA	NA	NA
VEJ36929.1|589746_590541_+	putative polynucleotidyl transferase	NA	NA	NA	NA	NA
VEJ36930.1|590676_593280_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.3	3.0e-14
VEJ36931.1|593621_595715_-	RTX-family exoprotein	NA	NA	NA	NA	NA
VEJ36932.1|595769_596822_-	RTX family exoprotein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	45.2	2.8e-11
VEJ36933.1|596808_597528_-	integral membrane protein	NA	NA	NA	NA	NA
VEJ36934.1|597571_597763_-	FrpA/C-like protein	NA	NA	NA	NA	NA
VEJ36935.1|597803_598238_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36936.1|598574_599114_+|transposase	IS1016 transposase	transposase	NA	NA	NA	NA
VEJ36937.1|599913_601167_+	ABC transporter family protein	NA	NA	NA	NA	NA
VEJ36938.1|601157_602141_+	ABC transporter family protein	NA	W8CYL7	Bacillus_phage	36.8	2.1e-37
VEJ36939.1|602364_602733_+|transposase	transposase for IS1106A3	transposase	NA	NA	NA	NA
VEJ36940.1|602675_603371_+|transposase	IS1106A3 transposase	transposase	NA	NA	NA	NA
VEJ36941.1|603728_604289_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	51.9	2.1e-45
VEJ36942.1|604360_604543_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ36943.1|604705_605746_-	adenine glycosylase	NA	NA	NA	NA	NA
VEJ36944.1|605908_606091_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
VEJ36945.1|606248_606971_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
VEJ36946.1|607227_607500_-	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
VEJ36947.1|607538_607865_-	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
VEJ36948.1|608045_609959_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
VEJ36949.1|610498_611944_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.2	5.3e-77
VEJ36950.1|612223_612919_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
VEJ36951.1|612899_613886_+	glucokinase	NA	NA	NA	NA	NA
VEJ36952.1|613935_614784_+	putative RpiR-family transcriptional regulator	NA	NA	NA	NA	NA
VEJ36953.1|614904_616551_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEJ36954.1|616693_617116_+	putative phage associated protein	NA	NA	NA	NA	NA
VEJ36955.1|617883_618102_-|transposase	transposase	transposase	NA	NA	NA	NA
VEJ36956.1|618160_618565_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	873349	914047	2186098	transposase,plate,tRNA,tail	Haemophilus_phage(39.13%)	53	NA	NA
VEJ37181.1|873349_874660_-|tRNA	tRNA(Ile)-lysidine synthetase (tRNA(Ile)-lysidine synthase; tRNA(Ile)-2-lysyl-cytidine synthase)	tRNA	NA	NA	NA	NA
VEJ37182.1|874846_875686_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
VEJ37183.1|875896_876298_+	Ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
VEJ37184.1|876365_876563_-	FeS assembly protein IscX	NA	NA	NA	NA	NA
VEJ37185.1|876775_877363_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37186.1|877649_877991_-	ferredoxin	NA	NA	NA	NA	NA
VEJ37187.1|878045_878297_-	ankyrin	NA	NA	NA	NA	NA
VEJ37188.1|878277_878805_-	ankyrin	NA	NA	NA	NA	NA
VEJ37189.1|878843_879500_-	T5orf172 domain	NA	NA	NA	NA	NA
VEJ37190.1|879581_881600_-	chaperone protein HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	41.1	6.9e-107
VEJ37191.1|881614_882487_+	poly-isoprenyl transferase	NA	NA	NA	NA	NA
VEJ37192.1|882565_883879_+	oxidoreductase	NA	NA	NA	NA	NA
VEJ37193.1|883961_884681_+	short chain dehydrogenase	NA	NA	NA	NA	NA
VEJ37194.1|884845_885517_+	putative CsgG-like lipoprotein	NA	NA	NA	NA	NA
VEJ37195.1|885526_885895_+	putative lipoprotein	NA	NA	NA	NA	NA
VEJ37196.1|885891_886539_+	genome-derived Neisseria antigen 1162	NA	NA	NA	NA	NA
VEJ37197.1|886826_888068_+	ABC transporter, permease protein, SbmA/BacA family	NA	NA	NA	NA	NA
VEJ37198.1|888177_888387_-	putative N-6adenine-specific DNA methylase	NA	A0A0R6PHB4	Moraxella_phage	48.2	4.1e-07
VEJ37199.1|888383_888680_-	Uncharacterised protein	NA	A0A0M3LNN9	Mannheimia_phage	61.4	1.4e-24
VEJ37200.1|888658_889264_-	putative phage fiber-spike protein	NA	Q7Y5S1	Haemophilus_phage	38.2	1.4e-15
VEJ37201.1|889343_889631_+	Protein of uncharacterised function (DUF497)	NA	NA	NA	NA	NA
VEJ37202.1|889602_889905_+	Uncharacterized protein conserved in bacteria	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	38.8	1.1e-05
VEJ37203.1|890667_891165_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37204.1|892955_893516_-	phage protein	NA	A0A0M3LQE1	Mannheimia_phage	39.2	3.1e-25
VEJ37205.1|893664_894030_-	Phage-like element PBSX protein xkdT	NA	F6MIL6	Haemophilus_phage	61.2	2.6e-33
VEJ37206.1|893980_894214_-|plate	putative baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	55.4	1.1e-11
VEJ37207.1|894210_895356_-|tail	putative phage tail protein	tail	F6MIL3	Haemophilus_phage	57.9	3.0e-115
VEJ37208.1|895345_896677_-	putative phage virion protein	NA	A0A0M3LQ21	Mannheimia_phage	35.4	9.5e-65
VEJ37209.1|896676_898848_-	Uncharacterised protein	NA	A0A0M3LPB6	Mannheimia_phage	29.8	9.5e-38
VEJ37210.1|899002_899605_+	putative lipoprotein	NA	NA	NA	NA	NA
VEJ37211.1|899856_900222_-	Uncharacterised protein	NA	F6MIK9	Haemophilus_phage	37.7	5.3e-10
VEJ37212.1|900225_900603_-	Uncharacterised protein	NA	A0A0M3LRV6	Mannheimia_phage	50.8	5.3e-29
VEJ37213.1|900667_902077_-|tail	Bacteriophage Mu tail sheath protein	tail	B7SDP8	Haemophilus_phage	52.8	2.5e-124
VEJ37214.1|902079_902277_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37215.1|902273_902924_-	putative Gp37-like prophage protein	NA	B7SDP5	Haemophilus_phage	38.4	5.2e-32
VEJ37216.1|902913_903090_-	Mu-like prophage protein gp36	NA	NA	NA	NA	NA
VEJ37217.1|903124_903565_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37218.1|903619_904084_+|transposase	transposase, IS30 family	transposase	NA	NA	NA	NA
VEJ37219.1|904047_904584_+|transposase	transposase for IS1655	transposase	W5R8L2	Staphylococcus_phage	39.9	7.8e-26
VEJ37220.1|904671_905733_-	protein gp32	NA	A0A2D1GNS3	Pseudomonas_phage	43.0	9.6e-60
VEJ37221.1|905963_906380_-|tail	putative phage tail completion protein	tail	B7SDN8	Haemophilus_phage	48.2	2.4e-30
VEJ37222.1|906489_907785_-	Phage Mu protein F like protein	NA	B7SDN5	Haemophilus_phage	49.9	2.8e-114
VEJ37223.1|907771_909340_-	phage protein	NA	A0A0M3LRU4	Mannheimia_phage	61.4	1.0e-187
VEJ37224.1|909339_910962_-	phage protein	NA	B7SDN0	Haemophilus_phage	69.5	2.5e-224
VEJ37225.1|910982_911489_-	phage protein	NA	I6PBD1	Pseudomonas_phage	51.5	5.3e-40
VEJ37226.1|911490_911688_-	phage protein	NA	NA	NA	NA	NA
VEJ37227.1|911684_911951_-	phage protein	NA	NA	NA	NA	NA
VEJ37228.1|912078_912291_-	phage protein	NA	NA	NA	NA	NA
VEJ37229.1|912287_912482_-	phage protein	NA	NA	NA	NA	NA
VEJ37230.1|912501_912921_-	putative phage associated membrane protein	NA	NA	NA	NA	NA
VEJ37231.1|912892_913129_-	phage protein	NA	NA	NA	NA	NA
VEJ37232.1|913131_913296_-	phage protein	NA	NA	NA	NA	NA
VEJ37233.1|913501_914047_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	1.5e-37
>prophage 5
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	920256	953095	2186098	transposase	Streptococcus_phage(16.67%)	31	NA	NA
VEJ37250.1|920256_921171_-|transposase	phage transposase	transposase	A0A2D1GNS0	Pseudomonas_phage	41.8	1.0e-57
VEJ37251.1|921385_923359_-|transposase	bacteriophage transposase	transposase	A0A0M3LPN5	Mannheimia_phage	41.9	2.5e-117
VEJ37252.1|923360_923612_-	putative DNA-binding phage protein	NA	NA	NA	NA	NA
VEJ37253.1|923659_924541_+	putative DNA-binding phage protein	NA	NA	NA	NA	NA
VEJ37254.1|924736_924922_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37255.1|925164_925716_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	6.4e-07
VEJ37256.1|925820_926489_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
VEJ37257.1|926485_926971_+	putative hydrolase	NA	NA	NA	NA	NA
VEJ37258.1|927707_927956_+	membrane protein	NA	NA	NA	NA	NA
VEJ37259.1|928589_929486_-	acetylglutamate kinase	NA	NA	NA	NA	NA
VEJ37260.1|929655_930786_+	carboxypeptidase	NA	NA	NA	NA	NA
VEJ37261.1|930856_931717_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
VEJ37262.1|931789_932452_-	yecA family protein	NA	G9E3U3	Emiliania_huxleyi_virus	40.3	7.2e-05
VEJ37263.1|932651_934445_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.9	1.2e-09
VEJ37264.1|934690_935800_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.7	1.7e-112
VEJ37265.1|935812_937075_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	62.9	4.7e-138
VEJ37266.1|937299_940344_-	putative cell-division protein	NA	G1FGP1	Mycobacterium_phage	48.7	1.6e-83
VEJ37267.1|940508_941189_+	membrane protein	NA	NA	NA	NA	NA
VEJ37268.1|941217_941577_+	putative CrcB-like protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	45.5	9.6e-12
VEJ37269.1|942232_942769_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
VEJ37270.1|942802_943159_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
VEJ37271.1|943214_943817_+	integral membrane protein	NA	NA	NA	NA	NA
VEJ37272.1|943904_944750_+	putative competence protein ComJ	NA	NA	NA	NA	NA
VEJ37273.1|944995_945970_+	fructose-1,6-bisphosphatase	NA	A0A1V0SEY8	Hokovirus	30.3	9.5e-30
VEJ37274.1|946128_946347_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEJ37275.1|947118_948894_+	gamma-glutamyltranspeptidase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	28.7	6.6e-05
VEJ37276.1|949374_950625_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	4.3e-99
VEJ37277.1|950752_951025_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37278.1|951063_951306_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37279.1|951369_952377_-|transposase	IS1106A3 transposase	transposase	NA	NA	NA	NA
VEJ37280.1|952534_953095_+|transposase	ISNme1 transposase (contains a 35 aa insertion)	transposase	NA	NA	NA	NA
>prophage 6
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	962889	1001649	2186098	tRNA,integrase,transposase	Mannheimia_phage(18.18%)	49	952846:952891	989756:989801
952846:952891	attL	AAATCAGGACAAGGCGACGAAGCCGCAGACAGTACAAATAGTACGG	NA	NA	NA	NA
VEJ37291.1|962889_963195_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37292.1|963347_963893_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37293.1|963907_964858_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37294.1|965624_966230_+	putative Smr-like protein	NA	NA	NA	NA	NA
VEJ37295.1|966975_967725_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	42.2	7.5e-51
VEJ37296.1|967729_968140_-	phage associated protein	NA	NA	NA	NA	NA
VEJ37297.1|968392_968566_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37298.1|968579_969083_-	Predicted lysozyme (DUF847)	NA	A0A0M3LSH2	Mannheimia_phage	60.7	6.0e-52
VEJ37299.1|969172_969655_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37300.1|969651_970620_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37301.1|970853_971099_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37302.1|971127_971505_-	putative DNA-binding phage protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	34.0	3.1e-05
VEJ37303.1|971809_972100_+	putative DNA-binding phage protein	NA	NA	NA	NA	NA
VEJ37304.1|972144_973020_+	phage protein	NA	A4JWN3	Burkholderia_virus	39.5	4.7e-44
VEJ37305.1|973000_973696_+|integrase	phage integrase	integrase	Q6QIE0	Burkholderia_phage	44.6	1.7e-17
VEJ37306.1|973656_973905_+|integrase	phage integrase	integrase	NA	NA	NA	NA
VEJ37307.1|973984_974188_+	phage associated protein	NA	NA	NA	NA	NA
VEJ37308.1|974225_974507_+	phage associated protein	NA	NA	NA	NA	NA
VEJ37309.1|974518_974722_+	putative phage associated protein	NA	NA	NA	NA	NA
VEJ37310.1|974986_975871_-|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37311.1|975962_976166_-	phage associated protein	NA	NA	NA	NA	NA
VEJ37312.1|976204_976498_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37313.1|976791_977247_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37314.1|977818_978373_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37315.1|979088_979271_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37316.1|979320_980322_-|tRNA	tRNA-dihydrouridine synthase C	tRNA	NA	NA	NA	NA
VEJ37317.1|980398_984319_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEJ37318.1|984756_986448_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
VEJ37319.1|986742_987114_+	putative lipoprotein	NA	NA	NA	NA	NA
VEJ37320.1|987249_987816_+	macrophage infectivity potentiator-related protein	NA	NA	NA	NA	NA
VEJ37321.1|987950_989042_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VEJ37322.1|989499_989670_+	rebredoxin	NA	NA	NA	NA	NA
VEJ37323.1|990440_992219_+	autotransporter NhhA	NA	NA	NA	NA	NA
989756:989801	attR	AAATCAGGACAAGGCGACGAAGCCGCAGACAGTACAAATAGTACGG	NA	NA	NA	NA
VEJ37324.1|992351_993359_+|transposase	IS1106A3 transposase	transposase	NA	NA	NA	NA
VEJ37325.1|993682_994189_-	phage protein	NA	I6PBD1	Pseudomonas_phage	51.2	2.4e-40
VEJ37326.1|994191_994389_-	phage protein	NA	NA	NA	NA	NA
VEJ37327.1|994385_994652_-	phage protein	NA	NA	NA	NA	NA
VEJ37328.1|994663_995002_-	phage protein	NA	NA	NA	NA	NA
VEJ37329.1|994998_995217_-	phage protein	NA	NA	NA	NA	NA
VEJ37330.1|995229_995400_+	phage protein	NA	NA	NA	NA	NA
VEJ37331.1|995444_995627_-	phage protein	NA	NA	NA	NA	NA
VEJ37332.1|995646_996066_-	putative phage associated membrane protein	NA	NA	NA	NA	NA
VEJ37333.1|996037_996274_-	phage protein	NA	NA	NA	NA	NA
VEJ37334.1|996276_996441_-	phage protein	NA	NA	NA	NA	NA
VEJ37335.1|996646_997192_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	49.2	1.5e-37
VEJ37336.1|997499_997928_-	phage related protein	NA	A0A0M3LRS6	Mannheimia_phage	40.4	2.1e-21
VEJ37337.1|997908_998343_-	E16-like protein	NA	L7P7R1	Pseudomonas_phage	40.8	6.8e-20
VEJ37338.1|998499_999456_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.6	3.3e-27
VEJ37339.1|1000068_1001649_-	bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase) and IMP cyclohydrolase(inosinicase; IMP synthetase; ATIC)	NA	Q58MG4	Prochlorococcus_phage	47.6	3.5e-66
>prophage 7
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	1370627	1426786	2186098	protease,tRNA,transposase	Staphylococcus_phage(20.0%)	49	NA	NA
VEJ37715.1|1370627_1371593_+|transposase	transposase	transposase	NA	NA	NA	NA
VEJ37716.1|1372278_1372932_+|transposase	insertion element IS1016 transposase	transposase	NA	NA	NA	NA
VEJ37717.1|1373463_1374429_-|transposase	transposase for IS1655	transposase	W5R8L2	Staphylococcus_phage	35.1	2.3e-36
VEJ37718.1|1375431_1375845_+	putative peptidase	NA	NA	NA	NA	NA
VEJ37719.1|1375974_1377636_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
VEJ37720.1|1377723_1378218_-	dissimilatory nitrous oxide reduction protein, lipoprotein	NA	NA	NA	NA	NA
VEJ37721.1|1378435_1379056_-	putative ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	3.2e-23
VEJ37722.1|1379113_1380133_-	periplasmic copper-binding transport system protein	NA	NA	NA	NA	NA
VEJ37723.1|1380201_1380723_-	regulatory protein	NA	NA	NA	NA	NA
VEJ37724.1|1381049_1382297_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
VEJ37725.1|1382448_1382835_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
VEJ37726.1|1382997_1384098_-	glycine cleavage system aminomethyltransferase T	NA	NA	NA	NA	NA
VEJ37727.1|1384609_1385092_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VEJ37728.1|1385147_1385744_+	Protein of uncharacterised function (DUF1415)	NA	NA	NA	NA	NA
VEJ37729.1|1385740_1386100_+	Membrane protein	NA	NA	NA	NA	NA
VEJ37730.1|1386457_1387879_+	membrane protein	NA	NA	NA	NA	NA
VEJ37731.1|1388226_1389570_+	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
VEJ37732.1|1389572_1390805_+	Na(+)-translocating NADH-quinone reductase subunit B	NA	NA	NA	NA	NA
VEJ37733.1|1390797_1391574_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
VEJ37734.1|1391573_1392200_+	Na(+)-translocating NADH-quinone reductase subunit D	NA	NA	NA	NA	NA
VEJ37735.1|1392203_1392797_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
VEJ37736.1|1392810_1394028_+	Na(+)-translocating NADH-quinone reductase subunit F	NA	NA	NA	NA	NA
VEJ37737.1|1394180_1395236_+	ApbE protein	NA	NA	NA	NA	NA
VEJ37738.1|1395261_1395477_+	Periplasmic protein	NA	NA	NA	NA	NA
VEJ37739.1|1395600_1396179_-	heat shock protein GrpE	NA	NA	NA	NA	NA
VEJ37740.1|1396362_1397181_+	protein CysE	NA	NA	NA	NA	NA
VEJ37741.1|1397537_1399049_-	putative ubiquinone biosynthesis protein UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.9	3.0e-38
VEJ37742.1|1399083_1399548_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37743.1|1399707_1400046_-	Putative iron-sulfur cluster insertion protein erpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.7	4.4e-27
VEJ37744.1|1400177_1400864_-	transcriptional regulator	NA	A5X9F5	Aeromonas_virus	36.4	6.3e-28
VEJ37745.1|1401049_1401322_+	putative secreted protein	NA	NA	NA	NA	NA
VEJ37746.1|1401529_1403458_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.8	4.1e-149
VEJ37747.1|1404522_1405449_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37748.1|1405564_1406404_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	34.4	3.8e-27
VEJ37749.1|1406421_1407525_+	integral membrane protein	NA	NA	NA	NA	NA
VEJ37750.1|1407570_1409760_-	primosome assembly protein PriA	NA	NA	NA	NA	NA
VEJ37751.1|1409898_1410681_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
VEJ37752.1|1410954_1412889_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	1.2e-36
VEJ37753.1|1412954_1414133_-	ABC transporter periplasmic protein	NA	A0A140XAI1	Dickeya_phage	58.3	5.2e-06
VEJ37754.1|1414358_1414748_+	type IV pilus assembly protein	NA	NA	NA	NA	NA
VEJ37755.1|1415030_1416077_+	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.8	1.7e-24
VEJ37756.1|1416241_1419727_-	SMC protein	NA	NA	NA	NA	NA
VEJ37757.1|1419976_1420699_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
VEJ37758.1|1420967_1422554_+	L-lactate permease	NA	NA	NA	NA	NA
VEJ37759.1|1422721_1422925_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEJ37760.1|1423040_1423538_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37761.1|1423619_1424813_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
VEJ37762.1|1425216_1426152_-	porphobilinogen deaminase	NA	NA	NA	NA	NA
VEJ37763.1|1426270_1426786_+|protease	putative metalloprotease NMB0538	protease	NA	NA	NA	NA
>prophage 8
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	1620133	1667395	2186098	protease,tRNA,transposase	Catovirus(12.5%)	52	NA	NA
VEJ37933.1|1620133_1620289_-|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37934.1|1620355_1620847_-	putative type I restriction-modification system DNA methylase	NA	NA	NA	NA	NA
VEJ37935.1|1621496_1622282_+|transposase	IS1106 transposase	transposase	NA	NA	NA	NA
VEJ37936.1|1622811_1623087_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
VEJ37937.1|1623303_1624098_-	Myo-inositol-1(Or 4)-monophosphatase	NA	NA	NA	NA	NA
VEJ37938.1|1624306_1625032_+	16S ribosomal RNA methyltransferase RsmE	NA	NA	NA	NA	NA
VEJ37939.1|1626966_1627773_-	lacto-N-neotetraose biosynthesis glycosyl transferase	NA	NA	NA	NA	NA
VEJ37940.1|1627772_1628531_-	lacto-N-neotetraose biosynthesis glycosyl transferase	NA	NA	NA	NA	NA
VEJ37941.1|1628496_1628862_-	lacto-N-neotetraose biosynthesis glycosyl transferase	NA	A0A1V0SAH6	Catovirus	36.5	2.6e-09
VEJ37942.1|1628878_1630942_-|tRNA	glycyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
VEJ37943.1|1630962_1631373_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEJ37944.1|1631449_1632355_-|tRNA	glycyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
VEJ37945.1|1632759_1633182_-	ATP synthase F0F1 subunit epsilon	NA	NA	NA	NA	NA
VEJ37946.1|1633192_1634590_-	ATP synthase F0F1 subunit beta	NA	NA	NA	NA	NA
VEJ37947.1|1634627_1635503_-	ATP synthase F0F1 subunit gamma	NA	NA	NA	NA	NA
VEJ37948.1|1635527_1637075_-	ATP synthase F0F1 subunit alpha	NA	NA	NA	NA	NA
VEJ37949.1|1637085_1637619_-	ATP synthase F0F1 subunit delta	NA	NA	NA	NA	NA
VEJ37950.1|1637623_1638094_-	ATP synthase F0F1 subunit B	NA	NA	NA	NA	NA
VEJ37951.1|1638164_1638401_-	ATP synthase subunit C	NA	NA	NA	NA	NA
VEJ37952.1|1638457_1639324_-	ATP synthase F0F1 subunit A	NA	NA	NA	NA	NA
VEJ37953.1|1639313_1639667_-	ATP synthase I	NA	NA	NA	NA	NA
VEJ37954.1|1640044_1641010_-|transposase	transposase for IS1655	transposase	W5R8L2	Staphylococcus_phage	35.5	1.8e-36
VEJ37955.1|1641118_1641457_-	putative lipoprotein	NA	NA	NA	NA	NA
VEJ37956.1|1641591_1642452_-	chromosome segregation protein	NA	I3NLC2	Bifidobacterium_phage	31.4	1.1e-13
VEJ37957.1|1642609_1643179_+	aromatic acid decarboxylase	NA	NA	NA	NA	NA
VEJ37958.1|1643240_1644104_-	outer membrane lipoprotein GNA1946	NA	NA	NA	NA	NA
VEJ37959.1|1644262_1644949_-	ABC transporter permease	NA	NA	NA	NA	NA
VEJ37960.1|1644950_1645688_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	6.3e-34
VEJ37961.1|1646217_1648068_+	transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	39.1	5.7e-15
VEJ37962.1|1648356_1648569_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEJ37963.1|1648700_1649147_+	GatB/Yqey domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	7.7e-19
VEJ37964.1|1649471_1649864_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
VEJ37965.1|1649935_1650541_-	RegF	NA	NA	NA	NA	NA
VEJ37966.1|1650642_1652319_-	inner membrane protein	NA	NA	NA	NA	NA
VEJ37967.1|1652474_1653104_-	cadmium resistance protein	NA	NA	NA	NA	NA
VEJ37968.1|1653418_1653634_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEJ37969.1|1653871_1654381_+	acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	47.4	1.3e-06
VEJ37970.1|1654461_1654950_-	putative thioredoxin	NA	NA	NA	NA	NA
VEJ37971.1|1654946_1655330_-	thioesterase family protein	NA	NA	NA	NA	NA
VEJ37972.1|1655329_1655692_-	VacJ-like protein	NA	NA	NA	NA	NA
VEJ37973.1|1655816_1656656_-	putative VacJ-like protein	NA	NA	NA	NA	NA
VEJ37974.1|1656652_1656931_-	NTP binding protein	NA	NA	NA	NA	NA
VEJ37975.1|1656987_1657578_-	Periplasmic transport protein	NA	NA	NA	NA	NA
VEJ37976.1|1657614_1658109_-	outer membrane transport protein	NA	NA	NA	NA	NA
VEJ37977.1|1658159_1658936_-	ABC transporter inner membrane protein	NA	NA	NA	NA	NA
VEJ37978.1|1658983_1659784_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.6e-25
VEJ37979.1|1659956_1660538_+	transcriptional regulator	NA	NA	NA	NA	NA
VEJ37980.1|1660556_1660874_+	transcriptional regulator	NA	NA	NA	NA	NA
VEJ37981.1|1661081_1661471_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEJ37982.1|1661714_1663157_+	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VEJ37983.1|1664189_1664537_+|protease	extracellular serine protease precursor	protease	NA	NA	NA	NA
VEJ37984.1|1664533_1667395_+|protease	extracellular serine protease precursor	protease	NA	NA	NA	NA
>prophage 9
LR134525	Neisseria meningitidis strain NCTC10025 genome assembly, chromosome: 1	2186098	1934027	1942167	2186098		Enterobacteria_phage(33.33%)	8	NA	NA
VEJ38223.1|1934027_1935149_+	DnaJ protein	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.0	7.9e-28
VEJ38224.1|1935343_1937362_+	membrane protein	NA	NA	NA	NA	NA
VEJ38225.1|1937404_1937977_-	dTDP-4-dehydrorhamnose 3,5-epimerase (dTDP-4-keto-6-deoxyglucose 3,5-epimerase; dTDP-L-rhamnose synthetase)	NA	I7HJC4	Enterobacteria_phage	52.3	1.8e-49
VEJ38226.1|1938015_1938882_-	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	64.6	5.5e-106
VEJ38227.1|1938987_1940013_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.0e-98
VEJ38228.1|1940128_1940770_-	UDP-glucose 4-epimerase, truncation	NA	A0A2K9L1R4	Tupanvirus	45.1	1.3e-48
VEJ38229.1|1940827_1941172_-	site-specific DNA methylase, truncation	NA	NA	NA	NA	NA
VEJ38230.1|1941336_1942167_-	5-methylcytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.7	1.1e-39
