The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006300	[Mannheimia] succiniciproducens MBEL55E, complete sequence	2314078	29889	110254	2314078	tRNA,transposase,integrase,plate,capsid,tail	Burkholderia_phage(27.03%)	93	82300:82319	106846:106865
WP_011199215.1|29889_30324_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_041639421.1|30320_31169_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011199217.1|31165_31651_-	YchJ family protein	NA	NA	NA	NA	NA
WP_041639422.1|31790_33281_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.5	7.4e-82
WP_011199219.1|33355_33808_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_011199220.1|33986_34979_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.3	8.4e-50
WP_041639423.1|35236_36544_-	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_011199223.1|36560_38369_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011199224.1|38390_38657_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_041639424.1|38820_39927_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.7	2.1e-33
WP_011199228.1|40048_40942_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_011199229.1|41151_42633_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011199230.1|42708_43401_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_011199231.1|43394_44255_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011199232.1|44303_45761_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011199233.1|45892_46882_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011199234.1|46946_47933_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011199235.1|48007_49285_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_011199236.1|49281_49764_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_011199237.1|49773_50235_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_041639426.1|50338_51337_-	3-dehydro-L-gulonate 2-dehydrogenase	NA	NA	NA	NA	NA
WP_041639427.1|51508_52300_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011199240.1|52336_53014_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_011199241.1|53201_55199_+	transketolase	NA	NA	NA	NA	NA
WP_011199242.1|55333_56821_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_041639428.1|56848_58447_-	ATPase	NA	NA	NA	NA	NA
WP_011199244.1|58643_59501_-	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_041639429.1|59512_60481_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_011199246.1|60483_61992_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.2e-16
WP_011199247.1|62049_63063_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_193329810.1|63296_65228_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_041639431.1|65531_66773_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_011199250.1|66787_67789_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011199251.1|67807_68686_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_041640113.1|68695_69673_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.5	1.7e-34
WP_011199253.1|69685_70840_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_102030683.1|71052_71529_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_011199256.1|71541_73035_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_011199257.1|73055_74039_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011199258.1|74117_74873_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.1	1.3e-31
WP_011199259.1|75048_75873_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.5	2.0e-113
WP_011199260.1|75890_76019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199261.1|76019_76505_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.3	4.0e-45
WP_011199262.1|76497_77256_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	52.7	1.1e-33
WP_011199263.1|77267_78158_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	41.6	1.2e-39
WP_041639434.1|78176_78755_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	53.4	9.3e-49
WP_011199265.1|78747_79845_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	40.9	7.4e-63
WP_041639435.1|79854_80217_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_011199267.1|80271_80808_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_011199268.1|80794_81859_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	42.3	1.4e-66
WP_011199269.1|81851_82085_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	47.8	1.5e-13
WP_011199270.1|82062_83007_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	32.5	4.4e-24
82300:82319	attL	AAATTTGACCGCACTTGGTA	NA	NA	NA	NA
WP_041639437.1|83006_85745_-|tail	phage tail tape measure protein	tail	A0A1B2LRQ0	Wolbachia_phage	36.8	1.4e-70
WP_041639438.1|85785_86076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_180334855.1|86088_86232_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_041639440.1|86237_86519_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011199275.1|86607_87126_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	45.0	1.3e-38
WP_011199276.1|87139_88534_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	42.6	2.8e-91
WP_011199277.1|88561_89050_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_011199278.1|89052_89487_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	39.6	5.7e-19
WP_011199279.1|89486_89723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199280.1|89812_90757_-|capsid	major capsid protein	capsid	A4JWK0	Burkholderia_virus	40.3	2.2e-55
WP_041639442.1|90799_91909_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	42.0	1.7e-70
WP_011199282.1|92136_92598_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	47.9	3.3e-09
WP_011199283.1|92658_92892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011199284.1|93156_94434_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	51.0	4.9e-58
WP_011199285.1|94426_95875_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	48.4	8.6e-120
WP_041640114.1|95984_97478_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	63.2	4.2e-178
WP_011199287.1|97516_98068_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	57.8	9.8e-48
WP_011199288.1|98072_98375_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	57.1	1.8e-27
WP_040977413.1|98374_98683_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	39.4	3.1e-11
WP_193329809.1|98679_98832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199291.1|98871_99135_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_011199292.1|99168_99678_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	70.0	4.9e-62
WP_041639444.1|99762_100128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199293.1|100117_100381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041639446.1|100373_101405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199295.1|101440_101872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011199296.1|101871_102351_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	30.3	8.0e-06
WP_041639447.1|102435_102627_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	59.3	2.8e-10
WP_011199298.1|102729_103011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041639449.1|103070_103304_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011199300.1|103420_103591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041639451.1|103587_103890_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.5	1.2e-15
WP_011199302.1|103945_104842_+	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	38.8	1.7e-49
WP_011199303.1|104851_106669_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	45.2	4.7e-131
WP_041639453.1|106690_107866_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	56.1	2.3e-110
106846:106865	attR	AAATTTGACCGCACTTGGTA	NA	NA	NA	NA
WP_011199305.1|107868_108393_+	host-nuclease inhibitor Gam family protein	NA	F6MIJ0	Haemophilus_phage	51.7	7.6e-42
WP_011199306.1|108389_108602_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011199307.1|108603_108765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011199308.1|108761_109175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011199310.1|109495_109879_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_011199311.1|109879_110254_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	42.1	3.8e-19
>prophage 2
NC_006300	[Mannheimia] succiniciproducens MBEL55E, complete sequence	2314078	139024	147160	2314078	tRNA	Streptococcus_phage(33.33%)	8	NA	NA
WP_011199347.1|139024_141127_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	1.2e-61
WP_011199348.1|141197_142382_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.8	3.7e-12
WP_011199349.1|142614_143094_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_011199351.1|143109_143805_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_011199352.1|143828_145088_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.9	1.0e-92
WP_011199355.1|145526_146171_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.9	4.2e-42
WP_011199356.1|146223_146463_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	7.3e-08
WP_011199357.1|146551_147160_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.3	1.7e-21
>prophage 3
NC_006300	[Mannheimia] succiniciproducens MBEL55E, complete sequence	2314078	1552354	1614948	2314078	tRNA,transposase,protease	uncultured_Mediterranean_phage(15.0%)	60	NA	NA
WP_011200730.1|1552354_1553446_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011200731.1|1553491_1554631_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	1.6e-89
WP_041639875.1|1554713_1555244_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_011200733.1|1555261_1555480_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_011200734.1|1555594_1555894_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.0	1.4e-08
WP_011200735.1|1555927_1557778_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011200736.1|1557787_1558756_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.9	8.0e-45
WP_011200737.1|1558920_1561029_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.3	9.0e-17
WP_011200738.1|1561063_1561369_+	trp operon repressor	NA	NA	NA	NA	NA
WP_011200739.1|1561349_1562084_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_011200740.1|1562149_1562896_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041639878.1|1562966_1564916_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_011200742.1|1565444_1566227_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	34.3	5.1e-34
WP_041640216.1|1566297_1566762_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.5	4.5e-46
WP_011200744.1|1566837_1567182_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_011200745.1|1567397_1568483_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	2.7e-86
WP_041640217.1|1568570_1569671_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	27.4	3.7e-22
WP_011200747.1|1569726_1571028_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011200748.1|1571039_1571753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157847505.1|1572145_1572982_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	40.0	9.0e-45
WP_011200156.1|1572969_1573284_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	42.4	1.7e-12
WP_011200750.1|1573392_1574586_-	sugar transporter	NA	NA	NA	NA	NA
WP_011200751.1|1574586_1575948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011200752.1|1575955_1576540_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	37.4	1.5e-25
WP_011200753.1|1576552_1577203_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.6	1.8e-32
WP_011200754.1|1577424_1578465_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011200756.1|1578547_1579585_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041640218.1|1579665_1581723_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011200758.1|1581826_1582882_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_011200759.1|1582961_1583963_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_011200760.1|1584146_1584557_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_011200761.1|1584560_1585004_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011200762.1|1585062_1586283_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011200763.1|1586500_1588519_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_011200764.1|1588566_1589631_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.0	8.1e-99
WP_011200765.1|1589727_1590900_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_011200766.1|1590906_1591827_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011200767.1|1591826_1592753_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005760959.1|1592903_1593161_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011200769.1|1593181_1593493_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_041640219.1|1593748_1594720_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.5	1.3e-10
WP_011200771.1|1594780_1595521_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_157847505.1|1596073_1596910_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	40.0	9.0e-45
WP_011200156.1|1596897_1597212_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	42.4	1.7e-12
WP_011200772.1|1597340_1598600_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	1.4e-97
WP_011200773.1|1598608_1599292_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_011200774.1|1599551_1600622_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_011200775.1|1600642_1601269_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_011200776.1|1601277_1601688_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_011200777.1|1601778_1603233_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011200778.1|1603237_1604266_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041639886.1|1604281_1605769_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.1e-16
WP_011200780.1|1605931_1606873_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011200781.1|1606948_1608301_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_011200782.1|1608426_1609788_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011200783.1|1609949_1610957_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_041640221.1|1611044_1611860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041639889.1|1611873_1612539_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011200787.1|1612828_1614061_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011200788.1|1614060_1614948_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 4
NC_006300	[Mannheimia] succiniciproducens MBEL55E, complete sequence	2314078	1845214	1853324	2314078		Clostridium_phage(14.29%)	9	NA	NA
WP_041639991.1|1845214_1845658_-	peptidoglycan-binding protein LysM	NA	J9QDY6	Clostridium_phage	44.4	9.7e-06
WP_011201017.1|1847398_1848232_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.2	1.1e-29
WP_041639993.1|1848436_1849105_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.8	1.9e-53
WP_011201019.1|1849118_1849547_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	43.9	1.8e-20
WP_011201020.1|1849507_1850182_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	4.7e-12
WP_011201021.1|1850228_1850714_-	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.0	6.0e-33
WP_011201022.1|1850747_1851212_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011201023.1|1851212_1852001_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_011201025.1|1852202_1853324_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.9	1.9e-66
