The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	368941	409983	4755700	terminase,holin,lysis,coat,portal,integrase,protease	Salmonella_phage(51.79%)	58	372787:372832	413191:413236
WP_001539157.1|368941_369994_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	4.8e-112
WP_001285275.1|370275_371379_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893222.1|371390_372641_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	1.2e-98
372787:372832	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_001539161.1|372846_374010_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	98.2	3.8e-227
WP_001283605.1|374239_374875_-	DUF5420 family protein	NA	A0A075B8I7	Enterobacteria_phage	89.1	2.5e-108
WP_001539163.1|374945_376121_-	DUF551 domain-containing protein	NA	A0A1U9HZ41	Salmonella_phage	95.0	4.2e-48
WP_001539165.1|376117_376579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539166.1|376575_377097_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	3.1e-96
WP_001539168.1|377093_377327_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	1.2e-12
WP_001539169.1|377323_377701_-	hypothetical protein	NA	I6R9B7	Salmonella_phage	94.3	4.2e-58
WP_023235266.1|377697_378324_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	97.9	8.1e-107
WP_023235267.1|378310_378487_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	93.1	3.4e-23
WP_023235268.1|378497_378791_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	57.7	1.9e-21
WP_001539174.1|378808_379357_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	95.6	5.8e-101
WP_001539175.1|379365_379872_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	92.3	1.1e-85
WP_001046989.1|379872_380580_-	recombinase	NA	A0A192Y857	Salmonella_phage	94.5	4.1e-131
WP_000902090.1|380576_380720_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_000156731.1|380709_380898_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|380878_381037_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_001539177.1|381243_381444_-	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	100.0	1.6e-32
WP_001539178.1|381512_381770_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	98.0	1.5e-22
WP_001539179.1|381896_382118_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	97.3	5.3e-37
WP_001539180.1|382198_382501_-	hypothetical protein	NA	A0A0M3ULJ5	Salmonella_phage	96.0	5.9e-47
WP_023138238.1|382869_383502_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	2.8e-30
WP_000447947.1|383602_383818_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	69.0	1.1e-18
WP_000424138.1|383926_384217_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_000166968.1|384237_384399_+	hypothetical protein	NA	I6R9C7	Salmonella_phage	100.0	1.0e-21
WP_001539182.1|384385_385234_+	replication protein	NA	C6ZR51	Salmonella_phage	99.3	7.0e-154
WP_001539183.1|385341_387222_+	toprim domain-containing protein	NA	I6S1U6	Salmonella_phage	98.4	0.0e+00
WP_001749496.1|387222_387501_+	hypothetical protein	NA	B9UDH9	Salmonella_phage	90.2	2.8e-43
WP_023235271.1|387574_388015_+	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	98.6	1.3e-79
WP_011264202.1|388011_388884_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	99.7	3.5e-177
WP_000113766.1|389020_389203_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	5.7e-29
WP_000566855.1|389199_389376_+	protein ninF	NA	A0A0M4S6T3	Salmonella_phage	94.8	1.9e-26
WP_001539188.1|389631_390027_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	98.5	3.4e-71
WP_000149925.1|390023_390227_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219132.1|390207_390387_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_001539190.1|390383_390902_+	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	97.1	6.1e-92
WP_000783734.1|391362_391686_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001539192.1|391669_392146_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	98.7	3.2e-87
WP_001539193.1|392142_392580_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.9	2.9e-71
WP_001072462.1|392785_393274_+	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	98.8	2.7e-86
WP_000807788.1|393764_394007_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_023235274.1|394042_394531_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	99.4	5.0e-88
WP_001539195.1|394508_396008_+|terminase	terminase large subunit	terminase	G5DA96	Enterobacteria_phage	99.6	9.1e-306
WP_001539196.1|396008_398174_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_001539198.1|398187_399099_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.3	5.4e-160
WP_001539200.1|399098_400394_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.6	5.2e-241
WP_023235276.1|400438_400675_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	78.4	1.1e-24
WP_001539204.1|400652_401153_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	97.6	3.6e-89
WP_001539206.1|401153_402572_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	98.3	1.5e-273
WP_001539207.1|402575_403214_+	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	95.3	6.1e-86
WP_000627591.1|403213_403669_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	98.7	2.0e-86
WP_001539209.1|403671_404361_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	92.6	4.3e-93
WP_023235277.1|404370_405723_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	90.5	1.4e-220
WP_001539213.1|405722_407636_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	98.9	0.0e+00
WP_001539215.1|407653_407983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011264204.1|408222_409983_+	right-handed parallel beta-helix repeat-containing protein	NA	I6S5Y0	Salmonella_phage	85.9	7.4e-57
413191:413236	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	1003632	1010945	4755700	integrase,protease	Dickeya_phage(16.67%)	7	1004883:1004897	1016133:1016147
WP_001539592.1|1003632_1004751_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125882.1|1004747_1006694_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	1.6e-39
1004883:1004897	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1006823_1007045_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1007368_1007689_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_001539593.1|1007719_1009996_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_001117984.1|1010208_1010406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1010567_1010945_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1016133:1016147	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 3
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	1051962	1156840	4755700	holin,tRNA,protease,lysis,portal,transposase,tail	Enterobacteria_phage(32.0%)	94	NA	NA
WP_110301500.1|1051962_1053217_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_000551246.1|1055696_1057445_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_001539607.1|1057441_1058419_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001539608.1|1058462_1059695_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350061.1|1059746_1059929_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011576.1|1059925_1060672_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436889.1|1060882_1061776_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899553.1|1061755_1062532_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001539611.1|1062667_1063471_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1063463_1064786_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1064766_1065471_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001539613.1|1070283_1072131_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357053.1|1072390_1072939_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1072966_1073614_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011264240.1|1073675_1074866_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_001539614.1|1075050_1076148_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.5	7.0e-98
WP_000117871.1|1076754_1078155_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.9	1.7e-80
WP_000762342.1|1078355_1078817_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001539615.1|1079134_1080331_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893204.1|1080594_1082031_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_024131270.1|1082108_1083311_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001539617.1|1083516_1084794_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.1e-248
WP_001237031.1|1085128_1085368_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1085410_1086568_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001539619.1|1089582_1089933_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1089954_1090113_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000373338.1|1090511_1090718_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000997167.1|1090750_1091683_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	53.2	9.6e-88
WP_001539621.1|1091679_1092153_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	57.9	2.5e-52
WP_001539622.1|1092303_1092771_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	84.5	7.9e-67
WP_000145711.1|1092784_1093012_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_077905880.1|1092977_1093352_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.1e-62
WP_011264243.1|1093443_1094280_+	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	3.5e-49
WP_000801767.1|1094276_1094972_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.9	1.5e-56
WP_000664367.1|1094985_1095783_+	hypothetical protein	NA	A0A1R3Y5Q8	Salmonella_virus	81.9	1.7e-32
WP_001539628.1|1096302_1096542_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	3.3e-37
WP_000929802.1|1096876_1097479_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096557.1|1097687_1098299_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.1	3.6e-91
WP_000801757.1|1098295_1098436_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_000993185.1|1098432_1099113_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.2e-60
WP_001539630.1|1099233_1099920_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.1	1.8e-131
WP_077905918.1|1100195_1100525_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.2e-55
WP_023234789.1|1100508_1100961_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_001534723.1|1100978_1101458_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.7	5.0e-56
WP_023234790.1|1101665_1102040_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	47.8	3.9e-16
WP_000196190.1|1104131_1104338_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_174565078.1|1104451_1105864_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	54.3	4.7e-86
WP_000478859.1|1105909_1106308_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1106304_1106634_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077905919.1|1106713_1109701_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	1.1e-265
WP_000978295.1|1109697_1110030_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000725267.1|1110128_1110626_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1110742_1111276_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001539637.1|1111365_1112061_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	3.8e-89
WP_000606351.1|1112070_1112808_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1112705_1113410_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_187148223.1|1115955_1116831_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1116869_1117112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001539638.1|1117165_1119604_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.3	1.9e-90
WP_000143167.1|1119603_1120185_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001539639.1|1120749_1121628_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.6	2.2e-171
WP_000334547.1|1122200_1122827_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1122895_1123195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539642.1|1123179_1123866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1124135_1124327_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_011264247.1|1124753_1127366_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	6.3e-20
WP_001539645.1|1127573_1128584_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1128750_1129293_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001539646.1|1129289_1130399_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086477.1|1130497_1132606_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001539647.1|1134540_1135794_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1135798_1137439_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_011264248.1|1137435_1137999_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1138254_1138422_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_001539648.1|1138521_1139040_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001539649.1|1139108_1140869_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1141054_1141507_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001539650.1|1141578_1142631_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288731.1|1142987_1143497_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001539651.1|1143713_1144319_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950883.1|1144305_1146459_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1146477_1146924_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001539652.1|1147047_1149102_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	2.9e-20
WP_000424187.1|1149137_1149596_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|1149690_1150353_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1150526_1150940_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001539653.1|1150984_1151302_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_023234842.1|1151359_1152571_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1152785_1153334_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1153359_1154139_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1154187_1154469_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001539655.1|1154465_1154795_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1154881_1155541_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_001539656.1|1156159_1156840_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	65.9	2.8e-73
>prophage 4
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	1302952	1352248	4755700	terminase,head,holin,tRNA,capsid,portal,integrase,transposase,tail	Salmonella_phage(31.91%)	56	1307007:1307025	1357344:1357362
WP_001539735.1|1302952_1304059_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476069.1|1304112_1304574_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825957.1|1304585_1304915_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023234873.1|1304911_1305493_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_001539738.1|1305664_1306915_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
1307007:1307025	attL	TTTATCAAAACTCCCTCAA	NA	NA	NA	NA
WP_001539740.1|1307026_1308154_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	59.2	1.2e-121
WP_001339197.1|1308399_1309608_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_011264258.1|1309794_1309944_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	5.3e-09
WP_001539741.1|1310080_1310908_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.2	1.2e-150
WP_001539742.1|1310965_1311322_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	2.5e-60
WP_001624554.1|1311879_1312077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191666.1|1313205_1313430_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_011264260.1|1313458_1314013_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	9.0e-102
WP_001539746.1|1314009_1316490_+	phage regulatory protein	NA	Q8HA97	Salmonella_phage	45.3	1.4e-157
WP_000620702.1|1316486_1316711_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001539747.1|1316707_1317526_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	97.4	9.5e-132
WP_023234881.1|1317527_1318010_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.1e-84
WP_001539748.1|1318009_1318663_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.4	1.6e-113
WP_001539749.1|1318659_1319049_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	4.2e-61
WP_001539751.1|1319065_1319926_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	99.0	4.6e-161
WP_001539752.1|1319933_1320923_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_001539753.1|1320937_1321516_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.1e-49
WP_001539755.1|1321741_1322161_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	75.5	6.0e-58
WP_001294873.1|1322661_1323051_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000226307.1|1323037_1323319_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001539762.1|1323318_1323933_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	91.7	2.3e-106
WP_001539764.1|1323929_1324472_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023234883.1|1324574_1325078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102154.1|1325336_1325882_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.1	7.4e-56
WP_001539769.1|1325853_1327785_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.8e-259
WP_000201415.1|1327768_1327972_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831820.1|1327968_1329549_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_001539774.1|1329538_1331035_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	9.6e-98
WP_001539777.1|1331047_1331395_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	1.4e-20
WP_011264261.1|1331449_1332478_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	6.6e-114
WP_001539780.1|1332535_1332895_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001539781.1|1332905_1333289_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	54.7	1.7e-27
WP_001539782.1|1333321_1334452_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	97.9	8.9e-213
WP_000677089.1|1334557_1335136_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|1335132_1335534_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1335541_1336288_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1336338_1336734_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077905885.1|1336730_1337069_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	2.3e-31
WP_001539789.1|1337040_1340082_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.7	4.5e-296
WP_000447370.1|1340084_1340414_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001539790.1|1340423_1341122_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	3.5e-103
WP_000662740.1|1341128_1341866_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_023236538.1|1341763_1342411_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	7.1e-90
WP_011264263.1|1342473_1345836_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1345874_1346117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011264264.1|1346170_1348849_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	67.1	6.2e-156
WP_023234886.1|1348863_1349382_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	63.4	2.9e-46
WP_024131291.1|1349944_1350181_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	5.5e-08
WP_001539798.1|1350480_1350789_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.4e-25
WP_187148224.1|1350919_1351969_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	61.0	2.1e-115
WP_001539801.1|1351954_1352248_+	Bro-N domain-containing protein	NA	B6SD57	Bacteriophage	53.5	1.7e-19
1357344:1357362	attR	TTTATCAAAACTCCCTCAA	NA	NA	NA	NA
>prophage 5
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	2272255	2281424	4755700	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000195340.1|2272255_2274289_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_001540418.1|2274529_2274988_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	3.2e-52
WP_000950413.1|2275744_2276212_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2276258_2276978_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272854.1|2276974_2278660_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	8.1e-279
WP_011264326.1|2278882_2279614_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	8.5e-100
WP_001261696.1|2279673_2279781_+	protein YohO	NA	NA	NA	NA	NA
WP_000824849.1|2279761_2280493_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569173.1|2280476_2281424_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 6
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	2747232	2792833	4755700	plate,head,holin,lysis,tail	Salmonella_phage(77.59%)	60	NA	NA
WP_000790154.1|2747232_2749032_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_071813888.1|2749436_2750927_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.4	2.8e-254
WP_001540650.1|2751744_2752161_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	90.3	1.0e-65
WP_011264352.1|2752167_2753580_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	81.9	2.0e-206
WP_000049934.1|2753579_2754260_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	97.3	1.2e-127
WP_001540652.1|2754256_2755456_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	98.5	7.0e-216
WP_001540653.1|2755456_2755810_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	1.6e-59
WP_001540654.1|2755945_2756701_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	78.5	1.6e-104
WP_001540655.1|2756764_2757550_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	62.7	1.3e-85
WP_001028071.1|2757614_2758178_-	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	59.0	4.5e-32
WP_000414162.1|2758251_2758410_-	Arc family DNA-binding protein	NA	A0A077KAX5	Edwardsiella_phage	71.4	2.1e-11
WP_000818611.1|2758510_2758888_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	75.4	6.7e-16
WP_000826019.1|2758894_2759230_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042299.1|2759226_2760258_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.7	3.3e-97
WP_000388505.1|2760260_2760563_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346977.1|2760566_2761217_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.9e-56
WP_001540656.1|2761216_2763169_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	64.5	4.0e-168
WP_001540657.1|2763346_2763799_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	77.2	8.5e-58
WP_000535993.1|2763802_2764246_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	6.0e-56
WP_001540658.1|2764258_2765404_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	1.7e-163
WP_000389380.1|2765407_2765971_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	7.6e-80
WP_001540659.1|2765945_2766335_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.9	1.1e-66
WP_000008736.1|2766321_2766876_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.8e-94
WP_001125676.1|2766872_2767280_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	3.0e-70
WP_001040692.1|2767245_2767614_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	98.4	5.7e-60
WP_001540662.1|2767655_2768597_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.0	3.8e-177
WP_011264354.1|2768608_2769106_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	3.3e-87
WP_001540664.1|2769110_2770343_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	98.5	9.0e-227
WP_137075829.1|2770357_2771095_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	87.6	1.1e-99
WP_001540667.1|2770979_2772449_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.0	2.4e-279
WP_001540668.1|2772448_2774071_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.3	0.0e+00
WP_023235155.1|2774073_2774703_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.5	2.7e-110
WP_001064345.1|2774765_2775290_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	96.5	9.8e-90
WP_001540671.1|2775507_2775957_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	83.2	2.0e-59
WP_000984586.1|2775974_2776427_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_077905929.1|2776410_2776740_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	98.2	6.4e-55
WP_001540676.1|2777015_2777702_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.7	3.9e-131
WP_001540678.1|2778062_2778512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2778647_2778773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2779171_2779969_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_023235158.1|2779958_2780105_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	85.4	4.1e-14
WP_001096557.1|2780101_2780713_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.1	3.6e-91
WP_001540681.1|2780921_2781524_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	100.0	2.6e-110
WP_001540683.1|2781558_2781807_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	8.0e-42
WP_011264355.1|2781923_2782157_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	4.7e-36
WP_001540684.1|2782671_2782953_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	90.9	1.5e-15
WP_000224241.1|2782963_2783221_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_001276150.1|2783223_2783487_-	hypothetical protein	NA	A0A2H4A316	Salmonella_phage	85.7	4.5e-19
WP_001540687.1|2783834_2784182_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	7.2e-57
WP_001540688.1|2784192_2784942_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	6.2e-138
WP_001540689.1|2784944_2785928_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001538023.1|2786012_2786387_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_000869364.1|2786352_2786589_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2786718_2787123_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2787521_2787680_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2787701_2788052_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_001540692.1|2788178_2791106_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539618.1|2791068_2792226_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2792268_2792508_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_024131350.1|2792548_2792833_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	85.1	1.6e-41
>prophage 7
NC_006905	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete sequence	4755700	4345930	4399576	4755700	plate,holin,tRNA,transposase,tail	Burkholderia_phage(40.91%)	55	NA	NA
WP_001339197.1|4345930_4347139_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000421790.1|4348687_4349377_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|4349448_4349550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541282.1|4349584_4350124_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_001541283.1|4350170_4351040_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_024131392.1|4351036_4351309_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000881654.1|4351406_4352348_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_000587743.1|4352609_4353338_-	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
WP_000084338.1|4354075_4354531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151757.1|4354527_4355142_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368206.1|4355148_4356807_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	1.8e-52
WP_000359503.1|4356809_4357442_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951730.1|4357434_4358550_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4358540_4358900_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_024131394.1|4359063_4360245_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	27.9	2.2e-28
WP_000703637.1|4360610_4361540_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_000593182.1|4361536_4361899_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_001541288.1|4362225_4362948_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818153.1|4362957_4364001_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	1.2e-75
WP_001269715.1|4363988_4364198_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	58.8	2.6e-17
WP_001541291.1|4364197_4365151_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001185655.1|4367601_4367730_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003641.1|4367689_4368007_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4368058_4368583_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729853.1|4368582_4370010_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000875314.1|4369999_4370197_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_001541292.1|4370193_4370649_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777267.1|4370807_4371122_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_001541293.1|4371134_4371740_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	8.4e-61
WP_001226439.1|4371742_4372030_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615249.1|4372604_4372952_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	1.7e-21
WP_001541295.1|4373083_4374433_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001541296.1|4374777_4376427_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4376870_4377113_+	outer membrane protein	NA	NA	NA	NA	NA
WP_001541298.1|4377146_4377815_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977962.1|4377811_4378549_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001541299.1|4378548_4380645_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4380787_4381198_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4381363_4382254_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382570.1|4382268_4383813_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_011264450.1|4383944_4385135_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4385496_4386606_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973642.1|4386694_4388053_+	maltoporin	NA	NA	NA	NA	NA
WP_011264451.1|4388216_4389134_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4389314_4389812_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455248.1|4389825_4390698_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4390796_4393217_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4393387_4393756_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4393864_4394473_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001541301.1|4394651_4395977_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_010989093.1|4395973_4396087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4396108_4396318_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4396417_4396933_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039346.1|4397179_4398490_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182218.1|4398577_4399576_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NC_006856	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence	138742	5813	58336	138742	integrase,transposase	Escherichia_phage(43.48%)	54	11322:11381	46478:47299
WP_001138073.1|5813_8786_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001011939.1|10013_10655_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|10804_11305_-	hypothetical protein	NA	NA	NA	NA	NA
11322:11381	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|11384_12089_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001774155.1|12954_13440_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.5e-49
WP_001067855.1|13479_14184_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105636.1|15841_17536_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|17553_17916_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|17912_18149_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|18184_18853_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|20242_20947_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|21136_21952_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_024131417.1|22102_22822_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.9e-137
WP_000845054.1|23419_24433_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001083725.1|24577_25075_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|25186_25477_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|25482_26274_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|26437_26785_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|26778_27618_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|27745_28246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|28214_29207_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|29384_30089_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000238872.1|31623_32112_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001245143.1|32104_33088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000891983.1|33091_34006_-	response regulator	NA	NA	NA	NA	NA
WP_187148225.1|34319_34475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|34486_35191_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011264039.1|35249_35489_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|35634_36498_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|36535_36781_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|37249_38041_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|38043_38319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|39220_39553_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|39722_40514_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|40606_41866_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|42127_42919_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|42976_43585_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|43680_44523_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|44689_45703_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|45905_46256_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|46540_47245_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|47250_47391_+	hypothetical protein	NA	NA	NA	NA	NA
46478:47299	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGC	NA	NA	NA	NA
WP_001446887.1|47876_48614_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|48610_48835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|48956_49133_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000134999.1|50173_50815_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|51972_52677_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001055569.1|52736_53264_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
WP_001493811.1|53263_53968_-	IncI1-type conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_011264042.1|53967_55257_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_001191880.1|55259_56243_-	IncI1-type conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000138552.1|56253_56946_-	DotI/IcmL family type IV secretion protein	NA	NA	NA	NA	NA
WP_001055900.1|56942_57290_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_001067858.1|57631_58336_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NC_006856	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence	138742	119642	128444	138742	transposase	Escherichia_phage(57.14%)	11	NA	NA
WP_000331736.1|119642_120368_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.2	4.4e-40
WP_000750474.1|120467_120878_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000208727.1|120980_121940_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000633445.1|122085_123174_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	61.7	9.7e-124
WP_001067852.1|123236_123941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000557466.1|124204_125278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550473.1|125321_125471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534857.1|125812_126052_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_000323025.1|126051_126339_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001531258.1|126642_127425_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|127421_128444_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
>prophage 1
NC_006855	Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSCV50, complete sequence	49558	35264	42168	49558	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925627.1|35264_35687_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_001541560.1|35686_36961_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	4.7e-154
WP_000064274.1|37042_38017_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000427676.1|38016_39222_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|39636_40578_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|40609_41176_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001541563.1|41232_41568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|41751_42168_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
