The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_001263	Deinococcus radiodurans R1 chromosome 1, complete sequence	2648638	608447	617563	2648638		Bacillus_phage(50.0%)	10	NA	NA
WP_010887241.1|608447_609449_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	4.4e-06
WP_010887242.1|609506_610175_-	SCO family protein	NA	NA	NA	NA	NA
WP_027479516.1|610294_610825_+	M23 family metallopeptidase	NA	A0A0Y0AH42	Bacillus_phage	39.1	6.6e-09
WP_051618766.1|610925_611747_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	50.0	1.8e-61
WP_010887245.1|611904_612144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081816010.1|612409_614140_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.2	4.9e-53
WP_010887247.1|614141_614738_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.2	3.1e-07
WP_010887248.1|614734_616381_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010887249.1|616377_616944_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027479514.1|616957_617563_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.2	5.2e-10
>prophage 2
NC_001263	Deinococcus radiodurans R1 chromosome 1, complete sequence	2648638	1611697	1676607	2648638	protease,transposase	Lactobacillus_phage(16.67%)	52	NA	NA
WP_010887312.1|1611697_1612120_+|transposase	IS200/IS605-like element ISDra2 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	44.3	1.0e-28
WP_010888231.1|1612106_1613333_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	49.6	1.4e-94
WP_164927972.1|1613271_1614327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034350162.1|1614524_1615625_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	41.2	4.6e-65
WP_010888234.1|1615621_1617394_+	glucose-6-phosphate dehydrogenase	NA	E3SKF6	Synechococcus_phage	38.1	1.6e-83
WP_010888235.1|1617491_1618430_+	glucose-6-phosphate dehydrogenase assembly protein OpcA	NA	NA	NA	NA	NA
WP_027479871.1|1618562_1621361_+	insulinase family protein	NA	A0A2K9V7S4	Bandra_megavirus	30.0	2.0e-19
WP_027479873.1|1623730_1624426_-	VIT family protein	NA	NA	NA	NA	NA
WP_010888240.1|1624594_1625761_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_034350166.1|1625775_1626807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051618799.1|1626899_1628123_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_034350242.1|1629147_1630410_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_010888245.1|1630498_1630933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010888246.1|1630929_1631484_-	DinB family protein	NA	NA	NA	NA	NA
WP_010888247.1|1631518_1632271_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010888248.1|1632421_1633726_+	homoaconitate hydratase family protein	NA	NA	NA	NA	NA
WP_010888249.1|1633790_1634264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010888250.1|1634323_1634698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010888251.1|1634910_1635240_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010888252.1|1635288_1635822_+	3-isopropylmalate dehydratase small subunit 1	NA	NA	NA	NA	NA
WP_010888253.1|1635807_1636182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010888254.1|1636304_1637330_+	DUF1517 domain-containing protein	NA	NA	NA	NA	NA
WP_010888255.1|1637393_1637975_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_164927973.1|1638017_1638155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063653036.1|1638200_1639433_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.7e-36
WP_164927974.1|1639429_1641082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010888257.1|1641151_1642138_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010888258.1|1642221_1642578_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_010888259.1|1642577_1643291_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_162177678.1|1643352_1644435_+|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
WP_034350172.1|1646546_1647992_+	amidase	NA	NA	NA	NA	NA
WP_051618798.1|1648040_1649096_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_010888264.1|1649286_1651101_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.6	2.2e-40
WP_051618797.1|1652101_1654399_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010888267.1|1654521_1655298_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_051618796.1|1655567_1656710_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_010888269.1|1656821_1658633_+	N-acetylmuramoyl-L-alanine amidase	NA	S5M9Y4	Brevibacillus_phage	36.5	4.0e-05
WP_027479881.1|1658646_1660119_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_010888271.1|1660102_1661395_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_027479883.1|1661805_1663698_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.1	6.8e-48
WP_027479884.1|1663701_1663986_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010888275.1|1665726_1666284_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_010888276.1|1666371_1666692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162177673.1|1666771_1666948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010888278.1|1667001_1667496_+	DinB family protein	NA	NA	NA	NA	NA
WP_027479887.1|1667462_1667984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010888282.1|1668837_1669584_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_027479889.1|1669673_1670369_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_165439377.1|1672328_1673054_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	4.0e-33
WP_010888286.1|1673347_1674307_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010887311.1|1674971_1676198_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	49.9	1.6e-95
WP_010887312.1|1676184_1676607_-|transposase	IS200/IS605-like element ISDra2 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	44.3	1.0e-28
>prophage 1
NC_000958	Deinococcus radiodurans R1 plasmid MP1, complete sequence	177466	6494	68919	177466	transposase	Planktothrix_phage(20.0%)	53	NA	NA
WP_010884020.1|6494_7478_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_027480391.1|8085_8949_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081799310.1|8957_9569_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027480393.1|9564_10884_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_034351275.1|10880_11777_+	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_010883990.1|11769_12777_+	histidinol-phosphate aminotransferase family protein	NA	NA	NA	NA	NA
WP_027480394.1|12784_14209_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_027480395.1|14497_14878_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_081816091.1|14878_15139_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034351278.1|15500_16376_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010883993.1|16372_17437_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_165439382.1|17460_18219_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	4.1e-12
WP_010884024.1|18226_18967_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_063653101.1|19120_20305_+|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_149358004.1|20380_21082_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.2e-35
WP_149358003.1|21042_21387_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010884015.1|21675_22659_-|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_010884041.1|23270_23822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884042.1|23993_25103_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_051618919.1|25218_26091_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010883996.1|26096_26522_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_162150137.1|26535_26916_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883998.1|27009_28065_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883999.1|28061_29795_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.0e-26
WP_162177803.1|29787_31023_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	3.4e-16
WP_010884016.1|31160_32072_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	32.1	2.8e-07
WP_034351178.1|32068_33019_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A240F4U1	Ochrobactrum_phage	32.5	1.1e-11
WP_010884075.1|33419_33740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162177804.1|34744_36379_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010884003.1|36400_37060_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	7.9e-12
WP_010884043.1|37219_38176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884044.1|39588_41664_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_164928030.1|41816_42122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164928031.1|42169_44539_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_010884062.1|44539_44977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164928032.1|44900_47798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884004.1|47826_49563_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063653100.1|49617_50874_+	MFS transporter	NA	NA	NA	NA	NA
WP_155896399.1|50946_51114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884006.1|51332_52883_+	sensor domain-containing diguanylate cyclase	NA	A0A2D0W9B6	Bordetella_phage	48.7	4.6e-10
WP_027480382.1|53286_55053_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_010884048.1|55472_55931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884017.1|55927_56575_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.4e-23
WP_010884049.1|56571_57780_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_162177805.1|58133_60134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884007.1|60424_60826_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_081816081.1|60822_61461_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_027480379.1|61415_62414_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_010884051.1|62873_63404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149358002.1|64247_64763_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010884019.1|65290_66274_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063653099.1|66278_67454_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063653036.1|67686_68919_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.7e-36
>prophage 2
NC_000958	Deinococcus radiodurans R1 plasmid MP1, complete sequence	177466	110037	154050	177466	integrase,transposase	Bacillus_phage(33.33%)	37	122244:122269	156528:156553
WP_010883957.1|110037_111393_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.0	4.0e-10
WP_010883958.1|111389_112049_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	2.8e-25
WP_010883959.1|112248_112974_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	24.6	1.4e-06
WP_162150140.1|113156_114188_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	1.2e-14
WP_010884030.1|114491_115520_+	RNA ligase (ATP)	NA	D4N471	Pseudomonas_phage	24.3	9.4e-12
WP_165439381.1|115842_116235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884031.1|116274_116613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034351235.1|116782_117571_+	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	40.8	4.9e-61
WP_010884033.1|117654_118896_-	AAA family ATPase	NA	D5GVP0	Campylobacter_virus	31.4	7.2e-06
WP_010884064.1|118871_119729_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	38.4	7.6e-39
WP_010884034.1|119725_120358_-	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.0	5.5e-55
WP_081816080.1|120550_121432_-	hypothetical protein	NA	A0A1V0SK86	Klosneuvirus	27.6	6.6e-30
WP_010884020.1|121855_122839_-|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
122244:122269	attL	ACGAGGTCACCTGTGGGTGACCTCGT	NA	NA	NA	NA
WP_063653103.1|123064_124240_+|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010883962.1|124397_125432_+|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	1.3e-08
WP_162177816.1|125865_126348_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010883964.1|126504_126930_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	33.3	5.1e-12
WP_027480402.1|126914_129002_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	47.8	1.1e-189
WP_027480401.1|129058_130054_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A142F1R6	Bacillus_phage	50.8	7.3e-86
WP_010884021.1|130046_130310_+	thioredoxin	NA	NA	NA	NA	NA
WP_162177815.1|130368_132678_+	glycerophosphodiester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	36.0	3.2e-07
WP_027480400.1|132891_133458_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_076611356.1|134956_136141_+|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884035.1|136548_137262_-	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_010884022.1|137626_138610_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027480426.1|138625_139579_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010883969.1|139862_141131_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.6	7.3e-38
WP_010883970.1|142426_143236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.7e-16
WP_162177814.1|143232_144201_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_010883972.1|144260_145235_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_162177813.1|145231_146143_-	SIP domain-containing protein	NA	NA	NA	NA	NA
WP_010883974.1|146151_147126_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010883975.1|147468_147990_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010883976.1|148519_149833_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010883977.1|149829_151131_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_027480398.1|151574_152354_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.9	3.9e-42
WP_063653090.1|152865_154050_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
156528:156553	attR	ACGAGGTCACCTGTGGGTGACCTCGT	NA	NA	NA	NA
