The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	296155	311987	5498450	integrase,tail	Enterobacteria_phage(29.41%)	18	290585:290597	313345:313357
290585:290597	attL	AATTTATATTATG	NA	NA	NA	NA
NP_308295.1|296155_297211_-	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
NP_308296.1|297498_298602_+	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
NP_308297.1|298613_299867_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
NP_308298.1|300071_301046_-|integrase	integrase	integrase	U5P434	Shigella_phage	99.3	7.2e-179
NP_308299.1|300936_301182_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
NP_308300.1|301421_301811_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
NP_308301.1|301938_302652_-	hypothetical protein	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
NP_308302.1|302752_302953_+	Cro	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
NP_308303.1|303071_303365_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
NP_308307.1|304627_305422_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
NP_308308.1|305421_306015_+	hypothetical protein	NA	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
NP_308309.1|305986_306430_-	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
NP_308310.1|306450_306861_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
NP_308311.1|306890_307445_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
NP_308312.1|307502_308276_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
NP_308314.1|309099_309843_+	transcriptional regulator	NA	NA	NA	NA	NA
NP_308315.1|309884_310238_-	hypothetical protein	NA	Q9ZXG3	Shigella_phage	70.8	1.6e-40
NP_308316.1|310805_311987_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
313345:313357	attR	CATAATATAAATT	NA	NA	NA	NA
>prophage 2
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	892239	928363	5498450	tail,protease,terminase,portal,holin	Enterobacteria_phage(48.78%)	46	NA	NA
NP_308828.1|892239_892458_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
NP_308829.1|892497_892665_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
NP_308831.1|892979_893510_+	hypothetical protein	NA	NA	NA	NA	NA
NP_308832.1|893720_893942_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
NP_308833.2|894040_894256_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
NP_308834.1|894332_894524_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
NP_308835.1|894496_894679_-	hypothetical protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
NP_308836.1|894675_895356_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
NP_944511.1|895352_895997_-	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	99.5	6.3e-123
NP_308837.1|896053_896236_+	protein NinE	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
NP_308838.1|896232_896403_+	protein NinF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
NP_308839.1|896392_897016_+	protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
NP_308840.1|897012_897678_+	serine/threonin protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
NP_308841.1|897889_898849_-	outer membrane protein	NA	NA	NA	NA	NA
NP_308842.1|899323_900013_+	anti-termination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
NP_308843.2|900223_900940_+	hypothetical protein	NA	NA	NA	NA	NA
NP_308845.1|901805_902021_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
NP_308846.1|902020_902518_+	endolysin	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
NP_308847.1|902514_902982_+	endopeptidase	NA	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
NP_308849.1|902969_903122_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
NP_308850.1|903528_903807_+	hypothetical protein	NA	NA	NA	NA	NA
NP_308851.1|903796_904288_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
NP_308852.1|904287_906390_+|terminase	terminase large subunit	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
NP_308853.1|906386_906599_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
NP_308854.1|906526_907651_+|portal	portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
NP_308855.1|907850_908108_+	hypothetical protein	NA	A5LH29	Enterobacteria_phage	100.0	4.9e-42
NP_308856.1|907956_910080_+|protease	protease/scaffold protein	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
NP_308857.1|910121_910490_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
NP_308858.1|910482_910758_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
NP_308859.1|910769_911348_+|tail	minor tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
NP_308860.1|911344_911746_+|tail	minor tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
NP_308861.1|911756_912500_+|tail	major tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
NP_308862.1|912560_912947_+|tail	minor tail protein	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
NP_308863.1|912955_913285_+|tail	minor tail protein	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
NP_308864.1|913256_916322_+|tail	tail length tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
NP_308865.1|916321_916651_+|tail	minor tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
NP_308866.1|916660_917359_+|tail	minor tail protein	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
NP_308867.1|917508_918108_+|tail	tail assembly protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-120
NP_308868.1|918005_918653_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.4e-108
NP_308869.1|918713_922127_+	host specificity protein	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
NP_308870.1|922197_922797_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
NP_308871.1|922856_924173_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
NP_308872.1|924135_924444_+	hypothetical protein	NA	A0A0N7CBX1	Escherichia_phage	98.0	4.8e-52
NP_308873.1|924620_925601_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
NP_308874.1|925661_926654_+	hypothetical protein	NA	NA	NA	NA	NA
NP_308875.1|927481_928363_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
>prophage 3
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	1146009	1311174	5498450	integrase,transposase,tail,protease,terminase,head,portal,holin	Escherichia_phage(45.07%)	202	1182128:1182187	1271612:1272298
NP_309066.1|1146009_1147770_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
NP_309067.1|1147955_1148408_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309068.1|1148483_1149524_-	outer membrane protein A	NA	NA	NA	NA	NA
NP_309069.1|1149880_1150390_-	SOS cell division inhibitor	NA	NA	NA	NA	NA
NP_309070.1|1150608_1151238_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309071.2|1151200_1153354_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309072.1|1153372_1153819_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309073.1|1153941_1155996_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
NP_309074.2|1156027_1156486_-	methylglyoxal synthase	NA	NA	NA	NA	NA
NP_309075.1|1156581_1157244_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309076.1|1157416_1157830_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309077.2|1157874_1158192_-	heat shock protein HspQ	NA	NA	NA	NA	NA
NP_309078.2|1158249_1159440_-	oxidoreductase	NA	NA	NA	NA	NA
NP_309079.1|1159534_1159813_+	acylphosphatase	NA	NA	NA	NA	NA
NP_309080.2|1159809_1160139_-	sulfur transfer protein TusE	NA	NA	NA	NA	NA
NP_309081.1|1160229_1160889_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
NP_309082.1|1161296_1162316_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
NP_309084.1|1162603_1165075_-	hypothetical protein	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
NP_309085.1|1165168_1165360_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309086.1|1165356_1165545_-	cell division inhibition protein	NA	NA	NA	NA	NA
NP_309087.1|1165811_1166117_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309088.1|1166118_1166304_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309090.1|1166490_1166880_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309092.1|1167021_1167177_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
NP_309094.1|1167454_1167742_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309095.1|1167741_1167933_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309096.2|1167960_1168362_-	regulatory protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
NP_309097.1|1168470_1168743_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
NP_309098.1|1168726_1169152_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309099.1|1169358_1169814_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309100.1|1169892_1170984_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
NP_309101.1|1170990_1171737_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
NP_309102.1|1171758_1172529_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
NP_309103.1|1172544_1172958_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
NP_309104.1|1173309_1174083_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309107.1|1174630_1174843_+	prophage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
NP_309108.1|1175010_1175289_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
NP_309109.2|1175290_1176340_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
NP_309110.1|1176352_1176724_+	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
NP_309111.1|1176713_1177085_+	anti-termination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
NP_309112.1|1177236_1178055_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309114.1|1178801_1179389_+	transcriptional regulator	NA	NA	NA	NA	NA
NP_309115.1|1180156_1182007_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
1182128:1182187	attL	TTGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
NP_309116.1|1182182_1182509_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_309117.1|1182505_1183159_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	73.3	7.1e-114
NP_309119.1|1184143_1184611_-	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
NP_309121.1|1184612_1184726_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
NP_309123.1|1184946_1185480_-	endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
NP_309124.1|1185512_1185707_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309125.1|1185675_1185912_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309126.1|1185860_1186205_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309127.1|1186167_1186374_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
NP_309128.1|1187124_1187400_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
NP_309129.1|1187475_1187856_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
NP_309130.1|1187852_1188200_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
NP_309131.1|1188249_1189788_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
NP_309133.1|1190051_1191980_+|terminase	terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
NP_944588.1|1191963_1192170_+	hypothetical protein	NA	K7PM10	Enterobacteria_phage	56.9	7.9e-11
NP_309134.1|1192166_1193759_+|portal	portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
NP_309135.1|1193748_1195254_+|head,tail	head-tail preconnector protein	head,tail	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
NP_309136.1|1195290_1195638_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
NP_309137.1|1195695_1195962_+|head	major head protein	head	NA	NA	NA	NA
NP_309138.1|1196078_1196684_+	hypothetical protein	NA	Q687F6	Enterobacteria_phage	98.0	7.6e-102
NP_309139.2|1196697_1197129_+|tail	minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
NP_309140.1|1197179_1197569_+|tail	minor tail protein	tail	S5MDP5	Escherichia_phage	81.7	1.1e-37
NP_309141.1|1197549_1200129_+|tail	tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
NP_309142.1|1200125_1200455_+|tail	minor tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
NP_309143.1|1200454_1201153_+|tail	minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
NP_309144.1|1201271_1201907_+|tail	tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.1	1.9e-127
NP_309145.1|1201804_1202485_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	100.0	2.5e-114
NP_309146.1|1202438_1202645_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309147.1|1202675_1203203_-	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
NP_309148.1|1203336_1206810_+	host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
NP_309149.1|1206877_1207477_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
NP_309150.1|1207535_1208855_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	1.0e-79
NP_309151.1|1208856_1209126_+	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
NP_309152.1|1209250_1209820_-	EspF-like protein	NA	NA	NA	NA	NA
NP_309153.1|1209795_1209978_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309154.1|1210458_1210641_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
NP_309155.1|1211258_1212377_+	hydrogenase-1 small subunit	NA	NA	NA	NA	NA
NP_309156.1|1212373_1214167_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
NP_309157.1|1214185_1214893_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
NP_309158.1|1214889_1215477_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
NP_309159.1|1215473_1215872_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
NP_309160.1|1215868_1216726_+	hydrogenase-1 operon protein HyaF	NA	NA	NA	NA	NA
NP_309161.1|1216859_1218404_+	third cytochrome oxidase subunit I	NA	NA	NA	NA	NA
NP_309162.1|1218415_1219552_+	third cytochrome oxidase subunit II	NA	NA	NA	NA	NA
NP_309163.1|1219736_1221041_+	phosphoanhydride phosphorylase	NA	NA	NA	NA	NA
NP_309164.1|1221160_1223341_-	cryptic autophosphorylating protein tyrosine kinase Etk	NA	NA	NA	NA	NA
NP_309165.2|1223360_1223807_-	phosphotyrosine-protein phosphatase	NA	NA	NA	NA	NA
NP_309166.1|1223794_1224934_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309167.1|1224979_1227076_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309168.1|1227075_1227822_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309169.1|1227818_1228463_-	regulator	NA	NA	NA	NA	NA
NP_309170.2|1228569_1228875_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309171.1|1229316_1229529_-	cold shock-like protein	NA	NA	NA	NA	NA
NP_309172.1|1229814_1230027_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
NP_309173.1|1230200_1230431_+	cold shock gene	NA	NA	NA	NA	NA
NP_309174.1|1230641_1231715_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309175.2|1231786_1234531_-	hybrid sensory histidine kinase TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
NP_309176.1|1234613_1235642_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
NP_309177.1|1235614_1236307_-	DNA-binding transcriptional regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
NP_309178.1|1236436_1237609_+	trimethylamine N-oxide reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
NP_309179.1|1237608_1240155_+	trimethylamine N-oxide reductase subunit	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
NP_309180.1|1240151_1240751_+	chaperone protein TorD	NA	NA	NA	NA	NA
NP_309181.1|1240904_1241210_-	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
NP_309182.1|1241209_1242130_-	curved DNA-binding protein CbpA	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
NP_309185.1|1243937_1245179_+	glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
NP_309186.1|1245216_1245444_-	hypothetical protein	NA	NA	NA	NA	NA
YP_004935383.1|1245464_1246010_-	TrpR binding protein WrbA	NA	NA	NA	NA	NA
NP_309187.1|1246039_1247350_-|integrase	integrase	integrase	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
NP_309188.1|1247402_1247687_-	excisionase	NA	G9L654	Escherichia_phage	100.0	9.1e-50
NP_309189.1|1247772_1248084_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	100.0	2.1e-55
NP_309190.1|1248143_1248488_-	hypothetical protein	NA	Q9XJG9	Enterobacteria_phage	100.0	2.8e-61
NP_309191.1|1248420_1249044_-	hypothetical protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
NP_309192.1|1249047_1249335_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
NP_309193.1|1249336_1249555_-	hypothetical protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
NP_309194.1|1249556_1249844_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	100.0	1.9e-50
NP_309195.1|1249773_1250241_-	hypothetical protein	NA	Q7Y2N7	Escherichia_phage	100.0	1.3e-88
NP_309196.1|1250113_1250887_-	hypothetical protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
NP_309197.1|1250883_1251105_-	C4-type zinc finger TraR	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
NP_309198.1|1251203_1251419_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
NP_309199.1|1251495_1251687_-	hypothetical protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
NP_309200.1|1251659_1251842_-	hypothetical protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
NP_309201.1|1251838_1252519_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
NP_309202.1|1252515_1253301_-	recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
NP_309203.1|1253306_1253723_-	hypothetical protein	NA	A0A0P0ZBR6	Stx2-converting_phage	100.0	2.7e-74
NP_309204.1|1253677_1253947_-	Kil protein	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
NP_309205.1|1253789_1253954_-	regulatory protein cIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
NP_309206.1|1254026_1254395_-	hypothetical protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
NP_309207.1|1254577_1254829_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
NP_309208.1|1254887_1255160_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
NP_309209.1|1255137_1255320_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
NP_309210.1|1255616_1255778_+	hypothetical protein	NA	A0A0P0ZCZ3	Stx2-converting_phage	100.0	2.7e-22
NP_309211.1|1255888_1256410_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
NP_309212.1|1256911_1257565_-	cI repressor protein	NA	Q9KXF4	Enterobacteria_phage	100.0	2.8e-126
NP_309213.1|1257682_1257898_+	CRO	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
NP_309214.1|1258039_1258336_+	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
NP_309215.1|1258368_1258515_+	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
NP_309216.1|1258507_1259407_+	replication protein O	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
NP_309217.1|1259381_1260833_+	replication protein P	NA	Q7Y2K5	Escherichia_phage	100.0	7.7e-278
NP_309218.1|1260832_1261102_+	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
NP_309219.1|1261172_1261451_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
NP_309220.1|1261583_1261799_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
NP_309221.1|1261809_1262046_+	hypothetical protein	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
NP_309222.1|1262002_1262449_+	hypothetical protein	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
NP_309223.1|1262445_1262973_+	DNA methylase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
NP_309224.1|1262969_1263152_+	protein NinE	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
NP_309226.1|1263426_1264161_+	antirepressor protein	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
NP_309227.1|1264235_1264958_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
NP_309228.1|1264957_1265563_+	protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
NP_309229.1|1265559_1265754_+	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
NP_309230.1|1265746_1266181_+	antitermination protein Q	NA	G9L695	Escherichia_phage	100.0	2.8e-82
NP_309231.1|1266429_1266582_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
NP_309232.1|1266964_1267924_+	Shiga toxin 2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
NP_309233.1|1267935_1268205_+	Shiga toxin 2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
NP_309234.1|1268691_1270596_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	100.0	0.0e+00
NP_309235.1|1270402_1271293_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_309236.1|1271289_1271616_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_309237.1|1272077_1272257_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
NP_309238.2|1272297_1272570_+	hypothetical protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
1271612:1272298	attR	GTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAAAAGTGGCGACAAACAACCTGAAACTGGGAACCTTTGGCGCATTTGATAACGAATGGCATACGCTGGCTTTCCGCTTTGCCGGGAATAACAGCCTGCAGGTGACGCCGGTTATTGATGGTCAGGATGGCACACCGTTCACGCTGACGCAGTCACCGGTCAGTGCCTTTGCGGCGGATAAACTGCATGTGACAGACATTACCAGAGGTGCGACTTACCCGGTACTGATAGACAGCATTGCGGTGGAAGTGAACAGCACAGACACTGCGGCATGATAAAAAAACCGCCAGCGACAGGAATGGACGCTGGCGGTGGTGATACCTATGGAGAAAAAATAAAGGAACGATACTTTCGTACTCTGGTTTTTAATGAAAACAGTTCTTATTGTCAACAATAACGGAAAGAAATTATGACATTTCTGAACCAGTTAATGCTGTACTTCTGTACGGTGGTCTGTGTGCTGTATCTCCTTTCGGGTGGGTACAGGGCCATGCGTGACTTCTGGCGCAGACAGATTGACAAAAGGGCCGCTGAGAAAATCAGCGCCAGTCAGTCAGCCGGAAGCAAACCCGAAGAGCCGCTCATTTAGCGGCAACTTTCTTAATCACACCTTTCGACGAGAAAATCCCA	NA	NA	NA	NA
NP_309239.1|1272646_1272862_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
NP_309240.1|1272866_1273400_+	endolysin	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
NP_309241.1|1273670_1274240_+	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_309242.1|1274393_1274858_+	endopeptidase	NA	A0A1I9LJR7	Stx_converting_phage	100.0	5.8e-78
NP_309244.1|1274889_1275183_-	Bor protein	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
NP_309245.2|1275290_1275536_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	8.4e-44
NP_309246.1|1275591_1276398_+|terminase	small subunit terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
NP_309247.1|1276378_1278085_+|terminase	terminase large subunit	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
NP_309248.1|1278084_1280229_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
NP_309249.1|1280386_1281394_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
NP_309250.1|1281417_1282632_+	hypothetical protein	NA	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
NP_309251.1|1282687_1283077_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
NP_309252.1|1283126_1283588_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
NP_309253.1|1283571_1284135_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
NP_309254.1|1284134_1284785_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
NP_309255.1|1284781_1286719_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
NP_309256.1|1286720_1286990_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
NP_309257.1|1287075_1287318_+	hypothetical protein	NA	A0A0N7CHY0	Escherichia_phage	100.0	3.9e-41
NP_309258.1|1287204_1287447_-	outer membrane protein	NA	NA	NA	NA	NA
NP_309259.2|1287612_1289238_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
NP_309260.1|1289234_1290503_+|tail	tail tip fiber protein	tail	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
NP_309261.1|1290517_1290796_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
NP_309262.1|1290801_1291419_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
NP_309263.1|1291509_1292244_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
NP_309264.1|1292673_1293075_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
NP_309265.1|1293168_1293825_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
NP_309266.1|1293827_1294274_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
NP_309267.1|1294283_1294535_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
NP_309268.1|1294545_1295811_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
NP_309269.1|1295880_1304262_+	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
NP_309270.1|1304547_1304733_+	hypothetical protein	NA	A0A1I9LJU5	Stx_converting_phage	100.0	1.5e-29
NP_309271.1|1304812_1305157_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
NP_309272.1|1305276_1305489_-	MokW protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
NP_309273.1|1305722_1306118_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
NP_309274.1|1306117_1306777_-	hypothetical protein	NA	A0A1I9LJU9	Stx_converting_phage	100.0	5.3e-125
NP_309275.1|1306797_1307016_-	hypothetical protein	NA	A0A1I9LJV0	Stx_converting_phage	100.0	4.4e-36
NP_309276.1|1307002_1307287_-	hypothetical protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
NP_309277.1|1307283_1307505_-	C4-type zinc finger TraR	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
NP_309278.1|1307552_1308182_-	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
NP_309279.2|1309330_1310659_-	transporter	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
NP_309280.2|1310679_1311174_-	hypothetical protein	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 4
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	1538644	1664600	5498450	integrase,transposase,tail,capsid,protease,terminase,tRNA,head,portal,holin	Enterobacteria_phage(35.65%)	161	1564955:1564975	1602477:1602497
NP_309525.1|1538644_1539466_+	NAD-dependent deacetylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
NP_309526.1|1539621_1540668_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
NP_309527.1|1540664_1541459_-	spermidine/putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
NP_309528.1|1541625_1542744_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
NP_309529.1|1542712_1542982_-	excisionase	NA	NA	NA	NA	NA
NP_309530.1|1543043_1543481_-	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	60.5	5.9e-40
NP_309531.1|1543523_1544081_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309532.1|1544195_1544426_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-07
NP_309533.1|1544663_1545140_-	phage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
NP_309534.1|1545264_1545588_+	hypothetical protein	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
NP_309535.1|1545571_1545997_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309536.1|1546065_1547103_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
NP_309537.1|1546963_1547557_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.5e-81
NP_309538.1|1547590_1548307_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
NP_309539.1|1548303_1548621_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
NP_309540.1|1548617_1548920_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
NP_309541.1|1548909_1549227_+	hypothetical protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
NP_309542.1|1549180_1549498_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
NP_309543.1|1549484_1549922_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
NP_309544.1|1549923_1550115_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
NP_309545.1|1550117_1550705_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
NP_309547.1|1551113_1551326_+	prophage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
NP_309548.1|1551493_1551772_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
NP_309549.1|1551773_1552823_+	hypothetical protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
NP_309550.1|1552835_1553210_+	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
NP_309551.1|1553206_1554028_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
NP_309552.1|1554440_1554941_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309553.1|1554892_1555078_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309554.1|1555106_1557044_+	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
NP_309555.1|1557191_1557374_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
NP_309556.1|1557411_1557681_+	hypothetical protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
NP_309557.1|1557756_1557972_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
NP_309558.1|1557976_1558321_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
NP_309559.1|1558371_1558905_+	endolysin	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
NP_309560.1|1559175_1559745_+	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_309561.1|1559898_1560366_+	endopeptidase	NA	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
NP_309563.1|1560389_1560614_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309564.1|1560610_1560829_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
NP_309565.1|1560970_1561111_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309566.1|1561240_1561426_-	hypothetical protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
NP_309567.1|1561467_1561833_+	Dnase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
NP_944519.1|1561485_1561731_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309568.1|1562122_1562686_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
NP_309569.1|1562682_1564344_+|terminase	large terminase subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
NP_309570.1|1564407_1566345_+|head	major head protein/prohead proteinase	head	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
1564955:1564975	attL	CAACCGTTTTTCATAAGGAAA	NA	NA	NA	NA
NP_944520.1|1566389_1566611_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
NP_309571.1|1566556_1569058_+|portal	portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
NP_309572.1|1569137_1569464_+	hypothetical protein	NA	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
NP_309573.1|1569473_1569824_+|head,tail	head-tail adapotor	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
NP_309574.1|1569820_1570267_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
NP_309575.1|1570263_1570608_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
NP_309576.1|1570666_1571383_+|tail	major tail subunit	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.8e-127
NP_309577.1|1571388_1571763_+|tail	tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
NP_309578.1|1571786_1572068_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
NP_309581.1|1575356_1575698_+|tail	minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
NP_309582.1|1575697_1576396_+|tail	minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
NP_309583.1|1576412_1576667_-	regulatory protein	NA	NA	NA	NA	NA
NP_309584.1|1577189_1578068_+	antirepressor protein	NA	I6R977	Salmonella_phage	77.2	2.5e-93
NP_309585.1|1578121_1578859_+|tail	tail assembly protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
NP_309586.1|1578756_1579041_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	85.7	1.4e-29
NP_309587.1|1579162_1581511_+	secreted effector protein	NA	NA	NA	NA	NA
NP_309588.1|1582101_1585503_+	hypothetical protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
NP_309591.1|1586045_1586951_-|transposase	insertion element IS2 transposase InsD	transposase	Q9ZXG3	Shigella_phage	98.7	6.3e-177
NP_309592.1|1587112_1587274_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	3.5e-22
NP_944521.1|1587284_1587584_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309594.1|1587811_1588087_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309595.1|1588147_1589509_-	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
NP_309596.1|1589629_1589842_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309597.2|1589872_1590703_-	spermidine/putrescine ABC transporter membrane protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.5e-11
NP_309598.1|1590719_1591856_-	putrescine/spermidine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
NP_309599.1|1592105_1593332_+	peptidase T	NA	NA	NA	NA	NA
NP_309600.2|1593380_1594502_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309601.1|1594750_1595980_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
NP_309603.1|1596590_1597334_+	hypothetical protein	NA	NA	NA	NA	NA
NP_944522.1|1597033_1597165_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309604.1|1597359_1597557_+	Icd-like protein	NA	NA	NA	NA	NA
NP_309605.1|1597549_1597735_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309606.1|1597734_1597926_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
NP_309607.1|1597915_1598158_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309608.1|1598163_1598463_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309612.1|1600590_1600935_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309613.1|1600964_1601216_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309614.1|1601212_1601623_+	single stranded DNA-binding protein	NA	NA	NA	NA	NA
NP_309615.1|1601633_1601906_+	transcriptional activator	NA	NA	NA	NA	NA
NP_309616.2|1601952_1602255_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309617.1|1602547_1603705_+|head	major head protein	head	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
1602477:1602497	attR	TTTCCTTATGAAAAACGGTTG	NA	NA	NA	NA
NP_309618.2|1603744_1604317_+|head,protease	prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
NP_309619.1|1604318_1605530_+|head,portal	head portal protein	head,portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
NP_309620.1|1605526_1605865_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
NP_309621.1|1605861_1606158_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
NP_309622.1|1606157_1606598_+	hypothetical protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
NP_309623.1|1606590_1606764_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309624.1|1606887_1607244_+|terminase	terminase small subunit	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
NP_309625.1|1607227_1608889_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
NP_309626.1|1608902_1609184_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309628.1|1610040_1611501_-	sensor protein PhoQ	NA	NA	NA	NA	NA
NP_309629.1|1611500_1612172_-	PhoP family transcriptional regulator	NA	NA	NA	NA	NA
NP_309630.1|1612340_1613711_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
NP_309631.1|1613714_1614356_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309632.2|1614391_1615498_-|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
NP_309633.1|1615551_1616013_-	phosphohydrolase	NA	NA	NA	NA	NA
NP_309634.3|1616022_1616676_-	23S rRNA pseudouridine(2457) synthase	NA	NA	NA	NA	NA
NP_309635.1|1616847_1618098_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
NP_309636.1|1618211_1619354_-	intergrase	NA	O21940	Phage_21	100.0	8.1e-206
NP_309637.1|1619343_1619580_-	excisionase	NA	NA	NA	NA	NA
NP_309638.1|1619683_1620508_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
NP_309639.1|1620504_1621206_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
NP_309640.1|1621202_1621505_+	Ren protein	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
NP_309641.1|1621572_1621905_+	multidrug efflux protein	NA	NA	NA	NA	NA
NP_309642.1|1622149_1623676_+	hypothetical protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
NP_309643.1|1624177_1624633_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
NP_309644.1|1624632_1624803_+	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
NP_309645.1|1624795_1625086_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
NP_309646.1|1625082_1625445_+	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
NP_944523.1|1625441_1625582_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
NP_309647.1|1625578_1626268_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
NP_309648.1|1626577_1626895_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
NP_309649.1|1626881_1627358_+	endolysin	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
NP_309650.1|1627354_1627816_+	endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	2.7e-75
NP_309651.1|1627574_1627757_+	lipoprotein Rz1	NA	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
NP_309652.1|1627847_1628141_-	Bor protein	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
NP_309653.2|1628432_1628843_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
NP_309654.1|1629128_1629335_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
NP_309655.1|1629499_1629694_-	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
NP_309656.1|1630082_1630628_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
NP_309657.1|1630602_1632528_+|terminase	terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
NP_309658.1|1632524_1632731_+|head,tail	head-to-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
NP_309659.1|1632727_1634329_+|portal	portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
NP_309660.1|1634309_1635629_+|capsid	minor capsid protein	capsid	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
NP_309661.1|1635638_1635971_+|capsid	major capsid protein	capsid	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
NP_309662.1|1636026_1637052_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
NP_309663.1|1637093_1637492_+	DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
NP_309664.1|1637503_1637857_+|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
NP_309665.1|1637868_1638447_+|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
NP_309666.1|1638443_1638839_+|tail	minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
NP_309667.1|1638846_1639587_+|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
NP_309668.1|1639602_1640025_+|tail	minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
NP_309669.1|1640006_1640441_+|tail	minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
NP_309670.1|1640433_1642983_+|tail	tail length tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
NP_309671.1|1642979_1643309_+|tail	minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
NP_309672.1|1643308_1644007_+|tail	minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
NP_309673.1|1644012_1644756_+|tail	tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
NP_309674.1|1644653_1645325_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
NP_309675.1|1645385_1648784_+	host specificity protein	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
NP_309676.1|1648850_1649450_+	membrane protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
NP_309677.1|1649514_1652430_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
NP_309678.1|1652429_1653011_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
NP_309679.1|1653130_1654021_-	catalase	NA	NA	NA	NA	NA
NP_309680.1|1654039_1654546_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309681.1|1654582_1655083_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309682.1|1655161_1655344_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309683.1|1655841_1656273_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309684.1|1656566_1656815_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
NP_309685.1|1656890_1657271_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
NP_309686.1|1657267_1657615_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
NP_309687.1|1657664_1659203_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
NP_309689.1|1659505_1660990_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309690.1|1661176_1662130_-|protease	outer membrane protease	protease	NA	NA	NA	NA
NP_309691.1|1662628_1663213_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309692.1|1663386_1663713_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_309693.1|1663709_1664600_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
>prophage 5
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	1757548	1831088	5498450	integrase,tail,protease,terminase,head,portal,holin	Stx2-converting_phage(38.0%)	75	1757385:1757412	1815560:1815587
1757385:1757412	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
NP_309784.1|1757548_1758679_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
NP_309785.1|1758656_1758905_-	excisionase	NA	NA	NA	NA	NA
NP_309786.1|1758969_1761441_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
NP_309787.1|1761533_1761725_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309788.1|1761721_1761910_-	DicB	NA	NA	NA	NA	NA
NP_309789.1|1762383_1762617_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309790.1|1762594_1763002_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
NP_309791.1|1763024_1763243_-	hypothetical protein	NA	NA	NA	NA	NA
NP_944527.1|1763315_1763615_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309792.1|1763878_1764286_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
NP_309793.1|1764362_1764590_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
NP_309794.1|1764573_1765125_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309795.1|1765096_1766137_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
NP_309796.1|1765925_1766591_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
NP_309799.1|1768218_1768977_+	colonization factor	NA	NA	NA	NA	NA
NP_309800.1|1769255_1769468_+	prophage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
NP_309801.1|1769688_1769946_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309802.1|1770015_1770294_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
NP_309803.1|1770295_1771342_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
NP_309804.1|1771354_1771714_+	endonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
NP_309805.1|1771722_1772253_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
NP_309806.1|1772371_1772692_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
NP_309807.1|1772842_1773901_+	DNA methylase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
NP_309808.1|1774697_1776551_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
NP_309809.1|1776700_1776916_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
NP_309810.1|1776920_1777265_+	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
NP_309811.1|1777315_1777849_+	endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
NP_309812.1|1778119_1778689_+	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_309813.1|1778842_1779310_+	endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
NP_309815.1|1779672_1779900_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
NP_309816.1|1779941_1780307_+	Dnase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
NP_944528.1|1779959_1780205_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309818.1|1780596_1781160_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
NP_309819.1|1781156_1782818_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
NP_309820.1|1782881_1784819_+|head,protease	major head protein/prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
NP_309822.1|1785030_1787610_+|portal	portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
NP_309823.1|1787612_1787939_+	hypothetical protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
NP_309824.1|1787948_1788299_+|head,tail	head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
NP_309825.1|1788295_1788742_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
NP_309826.1|1788738_1789083_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
NP_309827.1|1789012_1789858_+|tail	major tail subunit	tail	A0A0N7KZJ9	Stx2-converting_phage	97.9	5.3e-154
NP_309828.1|1789863_1790238_+|tail	tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
NP_309829.1|1790261_1790543_+	hypothetical protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
NP_309830.1|1790595_1793676_+|tail	tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
NP_309831.1|1793668_1794010_+|tail	minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
NP_309832.1|1794009_1794447_+|tail	minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
NP_309833.1|1794634_1798111_+	host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
NP_309834.1|1798178_1798778_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
NP_309835.1|1798929_1800243_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
NP_309836.1|1800244_1800514_+	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
NP_309839.1|1801540_1802866_-	hypothetical protein	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
NP_309840.1|1803526_1804219_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	88.6	1.3e-110
NP_309841.1|1804692_1805604_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
NP_309842.1|1805669_1806239_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309845.1|1807204_1808743_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
NP_309846.1|1808792_1809140_-	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
NP_309847.1|1809136_1809517_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
NP_309848.1|1809856_1810135_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309851.1|1810845_1811493_-	hypothetical protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
NP_309852.1|1811676_1812267_+	bfpT-regulated chaperone-like protein	NA	NA	NA	NA	NA
NP_309856.1|1815737_1816244_-	hypothetical protein	NA	NA	NA	NA	NA
1815560:1815587	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
NP_309857.1|1816289_1816790_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309858.2|1816875_1817055_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309859.1|1817435_1818242_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
NP_309860.1|1818241_1819435_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
NP_309861.1|1819446_1820808_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
NP_309862.1|1820808_1822404_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
NP_309863.1|1822403_1823966_-	anthranilate synthase component I	NA	NA	NA	NA	NA
NP_309865.1|1824239_1825121_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309866.4|1825117_1825738_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309867.1|1825765_1827349_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309868.1|1827561_1828434_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
NP_309869.1|1828473_1829064_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
NP_309870.1|1829060_1829819_-	short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
NP_309871.1|1830038_1831088_+|protease	periplasmic protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	1909208	1973142	5498450	transposase,tail,protease,terminase,tRNA,head,portal,holin	Escherichia_phage(40.3%)	79	NA	NA
NP_309945.1|1909208_1910099_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_309946.1|1910095_1910422_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_309947.1|1910447_1911245_-	pump protein	NA	NA	NA	NA	NA
NP_309948.1|1911281_1912727_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309949.2|1912726_1914037_-	aminohydrolase	NA	NA	NA	NA	NA
NP_309950.1|1914212_1915121_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
NP_309951.1|1915450_1916014_+	hypothetical protein	NA	NA	NA	NA	NA
NP_309952.2|1916034_1917267_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
NP_309953.1|1917521_1918505_+	zinc transporter	NA	NA	NA	NA	NA
NP_309954.1|1918982_1920356_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
NP_309955.1|1920484_1921420_-|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
NP_309956.1|1921471_1922707_-|transposase	transposase	transposase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
NP_309957.2|1922708_1922924_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
NP_309958.1|1923023_1923212_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
NP_309959.1|1923249_1923399_-	restriction alleviation and modification protein	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
NP_309960.1|1923454_1924264_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
NP_309961.1|1924256_1926857_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
NP_309962.1|1926958_1927234_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
NP_944530.1|1927308_1927485_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	72.4	4.4e-18
NP_309963.1|1927478_1927712_-	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.8e-36
NP_309964.2|1928141_1928630_+	phage superinfection exclusion protein	NA	NA	NA	NA	NA
NP_309965.1|1928626_1928782_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
NP_309967.1|1928792_1928972_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309968.1|1929214_1929526_-	transcriptional regulator	NA	G8C7L8	Escherichia_phage	42.4	1.5e-08
NP_309969.1|1929713_1929968_+	regulatory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
NP_309970.1|1929964_1930387_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
NP_309971.1|1930464_1931253_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
NP_309972.1|1931259_1932006_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
NP_309973.1|1931977_1932790_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.5e-121
NP_309975.1|1932805_1933228_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
NP_309976.1|1933333_1933546_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
NP_309977.1|1933797_1934061_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
NP_309978.1|1934071_1934233_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
NP_309979.1|1934311_1934557_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
NP_309980.1|1934988_1936140_+	methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
NP_309981.1|1936107_1937097_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309982.1|1937096_1938488_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309983.1|1938987_1939587_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
NP_309984.1|1939586_1939877_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
NP_309985.1|1939873_1940428_+	antitermination protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
NP_309986.1|1940989_1941421_+	hypothetical protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
NP_309987.1|1941417_1941585_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
NP_309988.1|1941995_1943849_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
NP_309989.1|1943998_1944214_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
NP_309990.1|1944218_1944563_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
NP_309991.1|1944613_1945147_+	endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
NP_309992.1|1945417_1945987_+	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_309993.1|1946140_1946608_+	endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
NP_309994.1|1946970_1947198_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
NP_309995.1|1947239_1947605_+	DNase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
NP_944531.1|1947257_1947503_-	hypothetical protein	NA	NA	NA	NA	NA
NP_309997.1|1947894_1948458_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
NP_309998.1|1948454_1950116_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
NP_309999.1|1950179_1952117_+|head,protease	phage major head protein/prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
NP_944532.1|1952161_1952383_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
NP_310001.1|1952328_1953693_+|portal	portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.5	6.4e-258
NP_310002.1|1953689_1954913_+	hypothetical protein	NA	A0A0P0ZCZ4	Stx2-converting_phage	98.0	9.9e-101
NP_310003.1|1954909_1955236_+	hypothetical protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
NP_310004.1|1955245_1955596_+|head,tail	head-tail adaptor	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
NP_310005.1|1955592_1956039_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
NP_310006.1|1956035_1956380_+	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
NP_310007.1|1956448_1957165_+|tail	major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
NP_310008.1|1957170_1957545_+|tail	tail assembly chaperon	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
NP_310009.1|1957568_1957850_+	hypothetical protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
NP_310010.1|1957901_1960982_+|tail	tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
NP_310011.1|1960974_1961316_+|tail	minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
NP_310012.1|1961315_1962014_+|tail	minor tail protein	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
NP_310013.1|1962024_1962768_+|tail	tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
NP_310014.1|1962665_1963346_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.1	5.7e-106
NP_310015.1|1963299_1963506_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310016.1|1963536_1964064_-	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
NP_310017.1|1964197_1967695_+	host specificity protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
NP_310018.1|1967765_1968365_+	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
NP_310019.1|1968657_1969743_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.4	1.1e-37
NP_310020.1|1969672_1970014_+	hypothetical protein	NA	G3CFN8	Escherichia_phage	92.9	2.1e-56
NP_310021.1|1970126_1970702_+	hypothetical protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
NP_310022.1|1970774_1971404_+	hypothetical protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
NP_310023.1|1971485_1972127_+	hypothetical protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
NP_310024.2|1972707_1973142_-	filament protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 7
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	2155110	2253837	5498450	integrase,transposase,tail,capsid,protease,terminase,head,portal,holin	Enterobacteria_phage(30.63%)	134	2158174:2158233	2203952:2204235
NP_310177.1|2155110_2155314_+	hypothetical protein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
NP_310178.1|2155349_2156810_-	oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
NP_310179.1|2156898_2158182_-	transporter	NA	NA	NA	NA	NA
2158174:2158233	attL	GAAATCCATAATTCATAGATGTTTTTTACTATTCTGTGGGTTTTTGGGTGTTTTCTAAGT	NA	NA	NA	NA
NP_310180.1|2158313_2158556_+	damage-inducible protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
NP_310181.1|2158717_2159359_-	hypothetical protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
NP_310182.1|2159440_2160070_-	hypothetical protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
NP_310183.1|2160142_2160718_-	hypothetical protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
NP_310184.1|2160831_2161101_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	6.4e-45
NP_310186.2|2161514_2162324_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	2.1e-59
NP_310187.1|2162388_2162988_-	outer host membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
NP_310188.1|2163055_2166535_-	host specificity protein	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
NP_310189.1|2166775_2167453_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
NP_310190.1|2167350_2168034_-|tail	tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	5.2e-107
NP_944539.1|2167862_2168093_-	hypothetical protein	NA	Q9EYE4	Enterobacteria_phage	100.0	5.1e-35
NP_310191.1|2168103_2168802_-|tail	minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
NP_310192.1|2168801_2169131_-|tail	minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
NP_310193.1|2169127_2171740_-|tail	tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
NP_310194.1|2171720_2172134_-|tail	minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
NP_310195.1|2172160_2172583_-|tail	minor tail protein	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
NP_310196.1|2172596_2173349_-	hypothetical protein	NA	Q687F6	Enterobacteria_phage	100.0	5.8e-136
NP_310197.1|2173356_2173752_-|tail	minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
NP_310198.1|2173748_2174282_-|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
NP_310199.1|2174296_2174650_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
NP_310200.1|2174661_2175060_-	DNA-packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
NP_310201.1|2175101_2176127_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
NP_310202.1|2176182_2176515_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
NP_310203.1|2176524_2177844_-|capsid	minor capsid protein	capsid	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
NP_310204.1|2177824_2179426_-|portal	portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
NP_310205.1|2179422_2179629_-|head,tail	head-to-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
NP_310206.1|2179625_2181551_-|terminase	terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
NP_310207.1|2181525_2182071_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
NP_310208.1|2182457_2182682_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
NP_310209.1|2182763_2183078_-	transcriptional regulator	NA	NA	NA	NA	NA
NP_310210.1|2183541_2184000_-	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	83.4	4.4e-62
NP_310212.1|2184157_2184727_-	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
NP_310213.1|2184997_2185531_-	endolysin	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
NP_310214.1|2185581_2185926_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
NP_310215.1|2185930_2186137_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
NP_944540.1|2186144_2186306_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310216.1|2186627_2188436_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.8	0.0e+00
NP_310217.1|2188913_2189345_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
NP_310218.1|2189795_2190383_-	transcriptional regulator	NA	NA	NA	NA	NA
NP_310219.1|2190644_2190842_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
NP_310220.1|2191066_2191621_-	anti-terminator protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
NP_310221.1|2191683_2191989_-	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
NP_310222.2|2192001_2193051_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
NP_310223.1|2193052_2193325_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
NP_310224.1|2193446_2193791_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
NP_310225.1|2193910_2194123_-	MokW protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
NP_310226.1|2194356_2194914_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
NP_310227.1|2194915_2195134_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
NP_310228.1|2195261_2195573_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
NP_310229.1|2195565_2195793_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
NP_310230.1|2195789_2196071_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
NP_310231.1|2196103_2196838_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.4e-72
NP_310232.1|2196853_2197516_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
NP_310233.1|2197307_2198351_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
NP_310234.1|2198419_2198845_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310235.1|2198828_2199071_-	regulatory protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
NP_310236.1|2199276_2199801_+	repressor protein	NA	A0A1W6JP50	Morganella_phage	32.9	1.3e-12
NP_310237.1|2200012_2200246_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	7.8e-07
NP_310238.1|2200257_2200896_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
NP_310239.1|2200896_2201106_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310240.1|2201154_2201415_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310241.1|2201670_2201859_+	cell division inhibitor	NA	NA	NA	NA	NA
NP_310242.1|2201855_2202044_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310243.1|2202136_2203381_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
NP_310244.1|2203362_2203914_+|integrase	integrase	integrase	Q859D2	Escherichia_coli_phage	63.0	6.5e-60
NP_310245.1|2204019_2204274_+	hypothetical protein	NA	H6WZN4	Escherichia_phage	82.5	3.4e-11
2203952:2204235	attR	GAAATCCATAATTCATAGATGTTTTTTACTATTCTGTGGGTTTTTGGGTGTTTTCTAAGTTTTTTCAGATGGTTGTATTTTTTCTAAAAATCCCTAATCTCGATTTTGCTGTTTATTTGAGGCCTTTTTATGTCCCATATATGCCCCACAGATACCCCGCAGCCAAAATCAACAAAATGCCAAAAGGTTCTGTTCCTGCCCTGCAACAAGAAATGCTGCGACGTGTCAGTAAACGTTATGACGATGTAGAAGTGATCATCAAATCCACCAGCAACGATGGCCTT	NA	NA	NA	NA
NP_310246.1|2204276_2205167_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_310247.1|2205163_2205490_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_310248.1|2205696_2206566_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.2e-47
NP_310249.1|2206609_2206990_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
NP_310250.1|2206986_2207334_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
NP_310251.1|2207383_2208922_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
NP_310253.1|2209504_2209876_-	hypothetical protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
NP_310254.1|2210139_2210487_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
NP_310256.1|2210865_2211375_-	hypothetical protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
NP_310257.1|2211554_2211824_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	98.9	6.4e-45
NP_310258.1|2211825_2213049_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
NP_310259.1|2213113_2213713_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
NP_310263.1|2217596_2218277_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	1.7e-110
NP_310264.1|2218174_2218849_-|tail	tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.9	6.4e-134
NP_310265.1|2218928_2219627_-|tail	minor tail protein	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
NP_310266.1|2219626_2219968_-|tail	minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
NP_310267.1|2219960_2223203_-|tail	tail length tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
NP_310268.1|2223250_2223532_-|tail	tail protein	tail	A0A0P0ZED8	Stx2-converting_phage	100.0	1.8e-45
NP_310269.1|2223555_2223930_-|tail	tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
NP_310270.1|2223944_2224661_-|tail	major tail subunit	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
NP_310271.1|2224726_2225071_-	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
NP_310272.1|2225067_2225514_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
NP_310273.1|2225510_2225861_-|head,tail	head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
NP_310274.1|2225870_2226197_-	hypothetical protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
NP_310275.1|2226199_2228779_-|portal	portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
NP_944541.1|2228724_2228946_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
NP_310277.1|2228990_2230928_-|head,protease	major head protein/prohead protease	head,protease	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
NP_310278.1|2230991_2232653_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
NP_310279.1|2232649_2233213_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
NP_310280.1|2233396_2233540_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310281.1|2233502_2233868_-	Dnase	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
NP_310282.1|2233909_2234137_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
NP_310283.1|2234499_2234967_-	endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
NP_310285.1|2235120_2235690_-	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_310286.1|2235960_2236494_-	endolysin	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
NP_310287.1|2236544_2236889_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
NP_310288.1|2236893_2237100_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
NP_944542.1|2237107_2237254_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310289.1|2237548_2239399_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
NP_310290.1|2239447_2239576_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310291.1|2239720_2239987_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310292.1|2239877_2240306_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
NP_310294.1|2240945_2241635_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
NP_310295.1|2241631_2241991_-	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
NP_310296.1|2242003_2243053_-	hypothetical protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
NP_944589.1|2243500_2243713_-	hypothetical protein	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
NP_310297.1|2243757_2243913_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
NP_310298.1|2243901_2244006_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310299.1|2244121_2244706_-	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
NP_310300.1|2244762_2245158_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
NP_310301.1|2245173_2245842_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	1.0e-62
NP_944543.1|2245763_2245943_-	hypothetical protein	NA	A0A088CE47	Shigella_phage	88.9	5.6e-13
NP_310302.1|2245968_2246709_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
NP_310303.2|2246715_2247678_-	replication protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
NP_310304.1|2247700_2248126_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310305.1|2248122_2248425_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
NP_310306.1|2248459_2248894_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310307.1|2248878_2249106_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310308.1|2249107_2249386_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310309.1|2249590_2249755_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310310.1|2249681_2250038_+	hypothetical protein	NA	NA	NA	NA	NA
NP_944544.1|2250109_2250328_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310311.1|2250896_2251085_+	inhibitor of cell division	NA	NA	NA	NA	NA
NP_310312.1|2251081_2251273_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310313.1|2251365_2253837_+	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
>prophage 8
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	2561991	2612026	5498450	integrase,tRNA,transposase,tail	Enterobacteria_phage(62.07%)	56	2555215:2555230	2613189:2613204
2555215:2555230	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
NP_310613.1|2561991_2563725_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
NP_310614.1|2563901_2564390_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310615.1|2564509_2564902_-	flagellar protein	NA	NA	NA	NA	NA
NP_310616.1|2564901_2566980_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
NP_310617.1|2566972_2568121_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
NP_310618.1|2568322_2568967_-	chemotaxis protein CheZ	NA	NA	NA	NA	NA
NP_310619.1|2568977_2569367_-	chemotaxis regulatory protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
NP_310620.1|2569381_2570431_-	chemotaxis-specific methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
NP_310621.1|2570433_2571294_-	chemotaxis methyltransferase CheR	NA	NA	NA	NA	NA
NP_310622.1|2571312_2572914_-	methyl-accepting protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
NP_310623.1|2572959_2574621_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
NP_310624.1|2574763_2575267_-	purine-binding chemotaxis protein	NA	NA	NA	NA	NA
NP_310625.1|2575287_2577252_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
NP_310626.1|2577256_2578183_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
NP_310627.1|2578179_2579067_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
NP_310628.1|2579193_2579772_-	transcriptional activator FlhC	NA	NA	NA	NA	NA
NP_310629.2|2579774_2580125_-	transcriptional activator FlhD	NA	NA	NA	NA	NA
NP_310630.1|2580904_2581333_+	universal stress protein UspC	NA	NA	NA	NA	NA
NP_310631.1|2581339_2582764_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
NP_310632.1|2582738_2583539_-	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
NP_310635.1|2584706_2586221_-	L-arabinose transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
NP_310636.1|2586290_2587280_-	L-arabinose-binding periplasmic protein	NA	NA	NA	NA	NA
NP_310637.1|2588076_2588580_+	ferritin	NA	NA	NA	NA	NA
NP_944547.1|2588659_2588911_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310639.1|2589373_2589697_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310640.1|2589867_2590365_+	ferritin	NA	NA	NA	NA	NA
NP_310641.1|2590401_2590641_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310642.1|2590832_2592044_+	tyrosine-specific transporter	NA	NA	NA	NA	NA
NP_310643.1|2592105_2592771_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310644.1|2593127_2594129_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
NP_310645.1|2594134_2594482_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310646.1|2594511_2595162_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310647.1|2595177_2595582_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
NP_944548.1|2595657_2595864_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310649.1|2595880_2596084_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
NP_310650.1|2596105_2596456_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
NP_310651.1|2596466_2596745_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
NP_310652.1|2596756_2596999_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
NP_310653.1|2597201_2597618_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310654.1|2597641_2597845_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
NP_310655.1|2597841_2598108_+	hypothetical protein	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
NP_310656.1|2598104_2598404_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
NP_310658.1|2598726_2598957_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
NP_310659.1|2599029_2599395_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
NP_310660.1|2599539_2602224_+	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
NP_310661.1|2602300_2603260_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
NP_310662.1|2603264_2603579_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
NP_310663.1|2603598_2604288_-|transposase	transposase	transposase	H6WZH1	Escherichia_phage	99.6	1.3e-126
NP_310664.1|2604287_2604614_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	1.8e-54
NP_310665.1|2605244_2605721_-	hypothetical protein	NA	A0A1L2JYI5	Streptococcus_phage	34.4	8.5e-08
NP_310666.2|2605973_2606468_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.2e-86
NP_310669.1|2609264_2609501_-|tail	phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
NP_310670.1|2609428_2609794_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
NP_310671.1|2609848_2610361_-|tail	tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
NP_310672.1|2610360_2611545_-|tail	tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
NP_310673.1|2611702_2612026_+|tail	tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
2613189:2613204	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	2650868	2663362	5498450		Bacillus_phage(25.0%)	14	NA	NA
NP_310721.1|2650868_2652563_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
NP_310722.1|2652733_2652916_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310723.1|2652994_2653912_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310724.1|2654084_2655005_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310725.1|2654993_2655464_-	DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
NP_310726.1|2655444_2656863_-	DNA cytosine methylase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
NP_310727.1|2656929_2657625_-	hypothetical protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
NP_310728.1|2657720_2658047_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310729.1|2658595_2659240_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	60.6	5.8e-60
NP_310730.1|2659206_2659782_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	46.1	3.1e-36
NP_310731.1|2659862_2660213_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310732.1|2660373_2661225_+	chaperone protein HchA	NA	NA	NA	NA	NA
NP_310733.1|2661332_2662691_-	2-component sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
NP_310734.2|2662690_2663362_-	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 10
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	2670960	2711983	5498450	integrase,transposase,tail,terminase,head,portal,holin	Enterobacteria_phage(35.71%)	52	2705411:2705425	2717683:2717697
NP_310744.1|2670960_2672274_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
NP_310745.1|2672338_2672938_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
NP_310748.1|2676724_2677402_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
NP_310749.1|2677299_2677869_-|tail	tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	1.6e-114
NP_310750.1|2678053_2678752_-|tail	minor tail protein	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
NP_310751.1|2678751_2679081_-|tail	minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
NP_310754.1|2681636_2681942_-|tail	minor tail protein	tail	S5MDP5	Escherichia_phage	76.9	1.9e-21
NP_310755.1|2682076_2682508_-|tail	minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
NP_310756.2|2682521_2683184_-	hypothetical protein	NA	Q687F6	Enterobacteria_phage	97.7	1.6e-113
NP_310757.1|2683243_2683510_-|head	major head protein	head	NA	NA	NA	NA
NP_310758.1|2683567_2683915_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
NP_310759.1|2683951_2685457_-|head,tail	head-tail preconnector protein	head,tail	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
NP_310760.1|2685446_2687039_-|portal	portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
NP_310761.1|2687035_2687242_-|head	head completion protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
NP_310762.1|2687225_2689154_-|terminase	terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
NP_310763.1|2689125_2689635_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
NP_310764.1|2690335_2690650_-	transcriptional regulator	NA	NA	NA	NA	NA
NP_944549.1|2690891_2691032_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310765.1|2691114_2691582_-	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	88.3	7.2e-68
NP_310767.2|2691733_2691949_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310768.1|2692071_2692605_-	endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
NP_310769.1|2692655_2693000_-	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
NP_310770.1|2693004_2693211_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
NP_310771.1|2693530_2693857_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_310772.1|2693853_2694744_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_310773.1|2694825_2696676_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
NP_310775.1|2696989_2697157_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
NP_310776.1|2697153_2697582_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
NP_310777.1|2698215_2698905_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
NP_310778.1|2698901_2699261_-	crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
NP_310779.1|2699273_2700323_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
NP_310780.1|2700324_2700603_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
NP_310781.1|2700770_2700983_-	prophage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
NP_310782.1|2701169_2701274_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310783.1|2701383_2701947_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
NP_310784.1|2702073_2702385_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
NP_310785.1|2702381_2702570_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	45.3	1.7e-07
NP_310786.1|2702566_2702923_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
NP_310787.1|2702919_2703144_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
NP_310788.1|2703165_2703864_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
NP_310789.1|2703898_2704561_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	7.8e-84
NP_310790.1|2704352_2705390_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
2705411:2705425	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
NP_310791.1|2705458_2705884_-	hypothetical protein	NA	NA	NA	NA	NA
NP_310792.1|2705880_2706108_-	cell division control protein	NA	NA	NA	NA	NA
NP_310793.1|2706202_2706850_+	repressor protein	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
NP_310794.1|2707124_2707277_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
NP_310795.1|2707757_2707946_+	cell division inhibition protein	NA	NA	NA	NA	NA
NP_310796.1|2707942_2708131_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310797.1|2708226_2710425_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	42.5	5.5e-41
NP_310798.1|2710378_2710699_+	hypothetical protein	NA	K7PLW7	Enterobacteria_phage	69.0	1.5e-29
NP_310799.1|2710757_2710961_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310800.1|2710960_2711983_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
2717683:2717697	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
>prophage 11
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	2870029	2946279	5498450	integrase,transposase,tail,protease,terminase,tRNA,portal,holin	Enterobacteria_phage(67.5%)	86	2895905:2895925	2943785:2943805
NP_310947.1|2870029_2872063_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
NP_310952.1|2879020_2882650_+	regulator	NA	NA	NA	NA	NA
NP_310953.1|2882711_2883029_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310954.2|2884269_2885358_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310957.1|2887640_2888777_+	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
NP_310958.1|2888773_2891011_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
NP_310959.1|2890817_2891708_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_310960.1|2891704_2892031_-|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	100.0	3.7e-55
NP_310961.2|2892214_2892676_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
NP_310962.1|2892717_2893188_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
NP_310963.2|2893234_2893954_-	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
NP_310964.1|2893950_2895636_-	2-component sensor protein	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2895905:2895925	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
NP_310966.1|2896150_2896399_+	hypothetical protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
NP_310967.1|2896766_2897075_-	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	100.0	4.3e-53
NP_310968.1|2897037_2898351_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
NP_310969.1|2898415_2899015_-	outer membrane protein Lom	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
NP_310972.1|2902795_2903473_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
NP_310973.1|2903370_2904114_-|tail	tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
NP_310974.1|2904124_2904823_-|tail	minor tail protein	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
NP_310975.1|2904822_2905152_-|tail	minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
NP_310976.1|2905148_2907794_-|tail	tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
NP_310977.1|2907837_2908146_-|tail	minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
NP_310978.1|2908172_2908595_-|tail	minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
NP_310979.1|2908608_2909361_-	hypothetical protein	NA	Q687F6	Enterobacteria_phage	100.0	5.8e-136
NP_310980.1|2909368_2909767_-|tail	minor tail protein U	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
NP_310981.1|2909779_2910403_-|tail	minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
NP_310982.1|2910405_2910687_-	hypothetical protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
NP_310983.1|2910679_2911006_-	hypothetical protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
NP_310984.1|2911093_2912110_-	hypothetical protein	NA	Q8VNN5	Enterobacteria_phage	100.0	1.1e-190
NP_310985.1|2912255_2912582_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	100.0	3.7e-55
NP_310986.1|2912578_2913469_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_310987.1|2913471_2914578_-|protease	protease/scaffold protein	protease	Q8VNN5	Enterobacteria_phage	92.4	9.1e-178
NP_310988.1|2914375_2915878_-|portal	portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
NP_310989.1|2915877_2916114_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.7	1.7e-33
NP_310990.1|2916086_2918210_-|terminase	terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
NP_310991.1|2918206_2918683_-	hypothetical protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
NP_944551.1|2918739_2918988_+	hypothetical protein	NA	NA	NA	NA	NA
NP_310992.1|2919137_2919605_-	endopeptidase	NA	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
NP_310994.1|2919758_2920328_-	antirepressor protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
NP_310995.1|2920598_2921132_-	endolysin	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
NP_310996.1|2921136_2921352_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
NP_310997.1|2921429_2921675_-	hypothetical protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
NP_310998.1|2921715_2921895_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
NP_310999.1|2922032_2923979_-	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
NP_311000.1|2924489_2924759_-	Shiga toxin I subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
NP_311001.1|2924768_2925716_-	Shiga toxin I subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
NP_311002.1|2926222_2926657_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
NP_311003.1|2926649_2926844_-	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
NP_311004.1|2926840_2927446_-	hypothetical protein	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
NP_311005.1|2927438_2927648_-	hypothetical protein	NA	G9L691	Escherichia_phage	97.1	3.5e-30
NP_311006.1|2927607_2928009_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
NP_311007.1|2928011_2928188_-	protein NinE	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
NP_311008.1|2928184_2928712_-	DNA methylase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
NP_311009.1|2928708_2929155_-	hypothetical protein	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
NP_311010.1|2929111_2929537_-	hypothetical protein	NA	Q8SC44	Stx2_converting_phage	100.0	2.4e-78
NP_311011.1|2929706_2929985_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
NP_311012.1|2930055_2930346_-	Ren protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
NP_311013.1|2930342_2931044_-	phage replication protein P	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
NP_311014.1|2931040_2931979_-	phage replication protein O	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
NP_311015.1|2932011_2932308_-	regulatory protein CII	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
NP_311016.1|2932422_2932641_-	regulatory protein	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
NP_311017.1|2932758_2933397_+	prophage repressor CI	NA	K7PH19	Enterobacteria_phage	100.0	5.0e-120
NP_311018.1|2933519_2933801_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
NP_311019.1|2933807_2934359_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
NP_311021.1|2934871_2935144_+	regulatory protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
NP_311022.1|2935160_2935742_-	superinfection exclusion protein	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
NP_311023.1|2936002_2936371_+	single-stranded DNA binding protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
NP_311024.1|2936443_2936608_+	regulatory protein cIII	NA	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
NP_311025.1|2936450_2936720_+	Kil protein	NA	Q9EYA7	Enterobacteria_phage	100.0	1.3e-42
NP_311028.1|2937097_2937883_+	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
NP_311029.1|2937879_2938557_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
NP_311030.1|2938550_2938739_+	hypothetical protein	NA	G3CFH8	Escherichia_phage	100.0	1.2e-29
NP_311031.1|2938711_2938903_+	hypothetical protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
NP_311032.1|2938913_2939195_+	hypothetical protein	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
NP_311033.1|2939293_2939515_+	C4-type zinc finger protein	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
NP_311034.1|2939511_2940459_+	hypothetical protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
NP_944552.1|2940686_2940974_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
NP_311036.1|2940970_2941327_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
NP_311037.1|2941323_2941686_+	hypothetical protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
NP_311038.1|2941773_2942016_+	hypothetical protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
NP_944553.1|2942019_2942154_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
NP_311039.1|2942172_2942427_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
NP_311040.1|2942460_2943747_+|integrase	integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
NP_311041.1|2943821_2944469_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.4	5.6e-95
2943785:2943805	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
NP_311042.1|2944616_2945348_-	transport system permease	NA	NA	NA	NA	NA
NP_311043.1|2945352_2946279_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	3191899	3197043	5498450	integrase	Enterobacteria_phage(50.0%)	6	3182350:3182366	3194314:3194330
3182350:3182366	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
NP_311257.1|3191899_3192832_+	transport	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
NP_311258.1|3193143_3194301_+|integrase	prophage Sf6-like integrase	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
NP_311259.1|3194475_3195612_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3194314:3194330	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
NP_311260.1|3195621_3196302_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
NP_311261.1|3196288_3196756_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
NP_311262.1|3196755_3197043_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.9	7.6e-44
>prophage 13
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	3474904	3489655	5498450	transposase,holin	Enterobacteria_phage(31.25%)	20	NA	NA
NP_311509.1|3474904_3475387_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
NP_311510.1|3476232_3476481_+	DNA damage-inducible protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
NP_311512.1|3476982_3477573_-	chaperone-like protein	NA	NA	NA	NA	NA
NP_311513.1|3477755_3478406_+	hypothetical protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
NP_311514.1|3478484_3479543_+	hypothetical protein	NA	NA	NA	NA	NA
NP_311515.1|3479672_3480095_-	hypothetical protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
NP_311516.1|3480255_3480645_-	hypothetical protein	NA	Q6H9S8	Enterobacteria_phage	96.1	5.1e-67
NP_311517.1|3480742_3481069_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_311518.1|3481065_3481956_+|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_311519.1|3481762_3482260_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	97.5	2.0e-44
NP_311520.1|3482456_3482804_-	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
NP_311521.1|3482800_3483181_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
NP_311523.1|3483537_3483882_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
NP_311524.1|3483886_3484102_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
NP_311525.1|3484251_3486105_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
NP_311526.1|3486345_3486675_+	hypothetical protein	NA	NA	NA	NA	NA
NP_311527.2|3486765_3487482_-	hypothetical protein	NA	NA	NA	NA	NA
NP_311528.1|3487761_3488385_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
NP_311529.1|3488381_3489047_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
NP_311530.1|3489043_3489655_-	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 14
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	3869374	3875566	5498450	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
NP_311889.1|3869374_3870265_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_311890.1|3870261_3870588_-|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_311891.1|3870593_3870710_-	hypothetical protein	NA	NA	NA	NA	NA
NP_311892.1|3870778_3871126_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	3.1e-60
NP_311893.1|3871322_3872714_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	6.5e-274
NP_311895.1|3872936_3873287_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
NP_311896.1|3873499_3874903_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	65.1	5.0e-173
NP_311898.1|3875221_3875566_+	hypothetical protein	NA	Q716C1	Shigella_phage	54.7	1.7e-18
>prophage 15
NC_002695	Escherichia coli O157:H7 str. Sakai, complete genome	5498450	5041092	5079469	5498450	transposase,tail,protease,head,portal	Shigella_phage(55.0%)	57	NA	NA
NP_312970.1|5041092_5041623_-	regulatory protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
NP_312971.1|5041813_5042062_+	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
NP_312972.1|5042063_5044154_+|transposase	phage transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
NP_312973.1|5044224_5045157_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
NP_312974.1|5045159_5045381_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312975.1|5045393_5045648_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312976.1|5045649_5045931_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
NP_312977.1|5045927_5046200_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312978.1|5046204_5046498_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312979.1|5046509_5047040_+	host-nuclease inhibitor protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
NP_312980.1|5047137_5047680_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
NP_312981.1|5047683_5048217_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
NP_312982.1|5048216_5048732_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
NP_312983.1|5048996_5049287_+	hypothetical protein	NA	NA	NA	NA	NA
NP_944579.1|5049283_5049469_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312984.1|5049465_5049840_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312985.1|5049832_5050030_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
NP_312986.1|5050019_5050316_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312987.1|5050312_5050822_+	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
NP_312988.1|5050891_5051317_+	transcriptional regulator	NA	NA	NA	NA	NA
NP_312989.1|5051388_5051889_+	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
NP_312991.1|5052107_5052554_+	hypothetical protein	NA	B6SD19	Bacteriophage	48.0	1.2e-11
NP_312992.1|5052563_5052791_+	C4-type zinc finger TraR	NA	NA	NA	NA	NA
NP_312993.1|5052771_5053080_+	hypothetical protein	NA	NA	NA	NA	NA
NP_312994.1|5053076_5053367_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
NP_312995.1|5053369_5053951_+	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
NP_312996.1|5053950_5055615_+|portal	portal protein	portal	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
NP_312997.1|5055677_5057204_+	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	58.0	3.1e-160
NP_312998.1|5057187_5058513_+	hypothetical protein	NA	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
NP_312999.1|5058631_5059105_+	virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
NP_313000.1|5059281_5060406_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
NP_313001.1|5060405_5061353_+|head	major head subunit	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
NP_313002.1|5061396_5061783_+	hypothetical protein	NA	NA	NA	NA	NA
NP_313003.1|5061779_5062199_+	hypothetical protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
NP_313004.1|5062195_5062756_+	hypothetical protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
NP_313005.1|5062756_5063002_+	hypothetical protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
NP_313006.1|5062998_5064501_+|tail	tail sheath protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
NP_313007.1|5064509_5064875_+	hypothetical protein	NA	C9DGP8	Escherichia_phage	51.7	2.0e-25
NP_313008.1|5064889_5065366_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
NP_313009.1|5065492_5067568_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
NP_313010.1|5067533_5068904_+	DNA circulation protein	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
NP_313011.1|5068887_5070012_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
NP_313012.1|5070001_5070616_+	hypothetical protein	NA	A0A0C4UQZ3	Shigella_phage	50.8	8.0e-51
NP_313013.1|5070608_5071046_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
NP_313014.1|5071042_5072128_+	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
NP_313015.1|5072118_5072679_+	hypothetical protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
NP_313016.1|5072678_5073590_+|tail	tail fiber	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
NP_313017.1|5073624_5074146_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
NP_313018.1|5074225_5074429_-|tail	tail fiber protein	tail	NA	NA	NA	NA
NP_313019.1|5074650_5075211_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
NP_313020.1|5075310_5077350_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
NP_313021.1|5077496_5077679_+	hypothetical protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
NP_313022.1|5077714_5077960_+	hypothetical protein	NA	NA	NA	NA	NA
NP_313023.1|5077998_5078310_-	hypothetical protein	NA	NA	NA	NA	NA
NP_313024.1|5078577_5078778_+	translational regulator	NA	NA	NA	NA	NA
NP_944580.1|5078680_5078917_-	hypothetical protein	NA	NA	NA	NA	NA
NP_313025.1|5078731_5079469_+	DNA modification protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
>prophage 1
NC_002128	Escherichia coli O157:H7 str. Sakai plasmid pO157, complete sequence	92721	29207	80576	92721	transposase	Macacine_betaherpesvirus(17.65%)	47	NA	NA
NP_052636.1|29207_30014_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
NP_052637.1|30735_31626_-|transposase	transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
NP_052638.1|31622_31949_-	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
NP_052640.1|32836_34003_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
NP_052641.1|34002_34974_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
NP_052642.1|36273_37998_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
NP_052643.1|38074_38977_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052644.1|38980_39286_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052645.1|39362_40046_+	putative methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
NP_958723.1|40046_40268_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052646.1|40161_40716_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052647.1|40761_41538_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052648.1|41410_41983_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052649.1|42078_42381_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052650.1|42427_42850_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052651.1|43156_43546_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052652.1|44033_44264_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052653.1|44315_45677_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052654.1|45723_46287_+	hypothetical protein	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
NP_052655.1|46372_46828_-	hypothetical protein	NA	NA	NA	NA	NA
NP_052656.1|47129_47582_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
NP_958724.1|47638_47872_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052657.1|47937_49896_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
NP_052658.1|49950_50385_+	plasmid SOS inhibition protein B	NA	NA	NA	NA	NA
NP_052659.1|50381_51143_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
NP_052660.1|51374_51533_+	small toxic polypeptide	NA	NA	NA	NA	NA
NP_052661.1|51714_53688_+	NikB	NA	NA	NA	NA	NA
NP_052662.1|53755_54187_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052663.1|54760_55120_-|transposase	transposase Tra5	transposase	A0A0P0I4A4	Acinetobacter_phage	40.5	1.3e-08
NP_052664.1|55301_55712_+|transposase	transposase	transposase	U5N3F9	Enterobacteria_phage	91.3	3.3e-40
NP_052665.1|55980_65490_+	toxin B	NA	NA	NA	NA	NA
NP_052666.1|65581_65854_+|transposase	transposase Tra5	transposase	NA	NA	NA	NA
NP_052667.1|65780_66284_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	96.4	8.9e-40
NP_052669.1|67748_68495_+	conjugal transfer pilus acetylation protein TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
NP_052670.1|68553_69414_+	hypothetical protein	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
NP_052671.1|69516_70077_+	conjugal transfer fertility inhibition protein FinO	NA	NA	NA	NA	NA
NP_958725.1|70209_70422_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052672.1|70666_71128_+	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
NP_958726.1|71173_71383_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052673.1|71420_71759_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052674.1|71998_72253_+	replication protein	NA	NA	NA	NA	NA
NP_052675.1|72555_73413_+	replication protein	NA	NA	NA	NA	NA
NP_052676.1|74324_74609_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052677.1|74608_74884_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052678.1|74978_75185_+	hypothetical protein	NA	NA	NA	NA	NA
NP_052681.1|76061_76526_-|transposase	transposase	transposase	NA	NA	NA	NA
NP_052684.1|79688_80576_+|transposase	transposase	transposase	H6WZH1	Escherichia_phage	99.7	1.6e-169
