The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010816	Bifidobacterium longum DJO10A, complete sequence	2375792	9046	72258	2375792	integrase,holin,transposase,tRNA,protease	Paramecium_bursaria_Chlorella_virus(21.43%)	43	35016:35075	38407:38505
WP_007053196.1|9046_11656_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.7	1.6e-132
WP_007053197.1|11835_13155_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012471742.1|13297_14800_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007055613.1|14989_16366_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.2	2.8e-59
WP_012471743.1|16451_17210_+	creatininase	NA	NA	NA	NA	NA
WP_041920886.1|17381_19157_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_010081500.1|19362_20823_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_041920887.1|20922_22323_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	31.3	9.5e-31
WP_007053205.1|22358_24158_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012471744.1|24634_25588_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_010081497.1|26214_26985_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.2e-32
WP_012471745.1|27016_27856_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007055631.1|27855_28533_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010081496.1|28538_29639_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012471746.1|29736_31269_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012471747.1|31489_31837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007056226.1|31879_32641_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.8	4.8e-37
35016:35075	attL	TCCGATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCC	NA	NA	NA	NA
WP_007054866.1|35110_36166_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
WP_010081384.1|36162_37128_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007053137.1|37124_38327_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010081561.1|41530_45466_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
38407:38505	attR	GGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAGTTAAACCGACATCGGTTTAATTCCGACCGGGGATGCCA	NA	NA	NA	NA
WP_080504070.1|45492_45993_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_007058714.1|46108_46351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010081559.1|46416_47490_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_010081558.1|47623_50191_+	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	33.3	3.5e-47
WP_012471753.1|50273_51653_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.4	2.8e-83
WP_012471754.1|51711_52434_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	4.3e-35
WP_010081555.1|52430_54128_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.0e-23
WP_012471755.1|54124_55855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007053222.1|56170_57154_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007053223.1|57294_58836_+	sugar ABC transporter ATP-binding protein	NA	M1HYF0	Paramecium_bursaria_Chlorella_virus	23.1	2.3e-14
WP_010081550.1|58837_59908_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007053225.1|59904_60927_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_007053226.1|61149_62607_-	MFS transporter	NA	NA	NA	NA	NA
WP_007053228.1|62905_63892_+	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	26.1	6.9e-12
WP_007053229.1|64016_64436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055619.1|64861_65554_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_012471757.1|65603_65969_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_007053232.1|66067_66373_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_007054001.1|66444_68877_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	3.9e-16
WP_007053234.1|69007_69661_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_007053235.1|69903_70926_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_008783747.1|70986_72258_+|transposase	IS30-like element ISBlo4 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	3.5e-40
>prophage 2
NC_010816	Bifidobacterium longum DJO10A, complete sequence	2375792	1296120	1344982	2375792	integrase,holin,capsid,tail,portal,protease	Bifidobacterium_phage(26.67%)	51	1300799:1300814	1333401:1333416
WP_041920913.1|1296120_1297155_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012472001.1|1297458_1298736_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-29
WP_007051464.1|1298740_1299595_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_007055662.1|1299591_1300542_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_007051466.1|1300553_1301720_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1300799:1300814	attL	GCGCGTCCTTGTTGAT	NA	NA	NA	NA
WP_010081636.1|1301972_1303160_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_012472002.1|1303346_1304348_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010081634.1|1304441_1305359_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_007054771.1|1305541_1305931_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_010081633.1|1306469_1307096_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_010081632.1|1307178_1308153_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_007051473.1|1308401_1309409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007051474.1|1309408_1310488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007051475.1|1310568_1311558_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_007051476.1|1311603_1312374_-	endonuclease NucS	NA	NA	NA	NA	NA
WP_007054766.1|1312461_1312755_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_007051478.1|1312754_1314227_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_007051479.1|1314235_1315159_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_007051480.1|1315162_1316794_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_007054765.1|1316869_1317706_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_007051482.1|1317740_1318259_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003831420.1|1318315_1318543_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_007051483.1|1318646_1319459_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_007051484.1|1319920_1320955_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_041920914.1|1321341_1322166_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	44.4	1.5e-55
WP_003809885.1|1322215_1322488_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_032734597.1|1322528_1322756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472004.1|1322821_1323085_-|holin	holin	holin	C9E2L0	Enterococcus_phage	50.8	4.7e-08
WP_012472005.1|1323165_1324401_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8LTJ6	Lactococcus_phage	43.1	9.2e-38
WP_010080985.1|1324458_1324782_-	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	69.8	5.8e-16
WP_157826313.1|1324909_1325083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080987.1|1325070_1326315_-	reverse transcriptase	NA	D6PSR5	Lactobacillus_phage	28.6	8.4e-31
WP_010080988.1|1326731_1328312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080989.1|1328328_1329051_-	hypothetical protein	NA	I3NL86	Bifidobacterium_phage	57.5	1.3e-39
WP_012472006.1|1329037_1329205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080991.1|1329204_1329801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080992.1|1329810_1333530_-|tail	phage tail protein	tail	I3NL88	Bifidobacterium_phage	59.8	9.5e-179
1333401:1333416	attR	GCGCGTCCTTGTTGAT	NA	NA	NA	NA
WP_010080993.1|1333549_1334332_-	hypothetical protein	NA	I3NL89	Bifidobacterium_phage	38.9	4.9e-45
WP_010080994.1|1334350_1337419_-	tape measure protein	NA	R9QN01	Lactococcus_phage	41.6	8.1e-75
WP_010080995.1|1337420_1337813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080996.1|1337824_1338145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472008.1|1338204_1338795_-	hypothetical protein	NA	A0A141E164	Streptococcus_phage	38.0	9.2e-20
WP_010080999.1|1338825_1339191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010081000.1|1339187_1339463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010081001.1|1339474_1339810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010081002.1|1339806_1340259_-	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	50.8	9.5e-25
WP_010081003.1|1340270_1340585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010081004.1|1340584_1341490_-|capsid	phage major capsid protein	capsid	A0A2K9VJQ1	Propionibacterium_phage	33.0	1.6e-34
WP_010081005.1|1341535_1342069_-	helicase	NA	NA	NA	NA	NA
WP_010081006.1|1342179_1343535_-	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	47.1	2.7e-14
WP_010081007.1|1343458_1344982_-|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	34.0	4.9e-57
>prophage 3
NC_010816	Bifidobacterium longum DJO10A, complete sequence	2375792	2083276	2156348	2375792	integrase,tRNA,transposase	Tupanvirus(16.67%)	57	2146514:2146539	2158046:2158071
WP_007053815.1|2083276_2084440_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010081460.1|2084537_2085662_+	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
WP_012472159.1|2085676_2087215_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_012472160.1|2087342_2087975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004268639.1|2088166_2088256_+	AURKAIP1/COX24 domain-containing protein	NA	NA	NA	NA	NA
WP_007056729.1|2088408_2089107_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_081966502.1|2089237_2090128_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	38.4	1.0e-17
WP_010081457.1|2090521_2092138_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	37.1	2.7e-82
WP_010081456.1|2092271_2092694_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_013582920.1|2092924_2094022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010081455.1|2094729_2096406_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_007052322.1|2096492_2098043_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_012472162.1|2098541_2100908_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_008782955.1|2100925_2101765_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_007053825.1|2101769_2102951_-	NAD(+)/NADH kinase	NA	NA	NA	NA	NA
WP_008782953.1|2103184_2104471_+|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	34.2	6.4e-58
WP_012472164.1|2105458_2106775_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_008782951.1|2106965_2107937_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010081657.1|2107936_2108887_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010081656.1|2109102_2111358_+	1,3-beta-galactosyl-N-acetylhexosamine phosphorylase	NA	NA	NA	NA	NA
WP_010081655.1|2111386_2112466_+	N-acetylhexosamine 1-kinase	NA	NA	NA	NA	NA
WP_010081654.1|2112512_2114060_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_007052336.1|2114129_2115152_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	42.0	4.0e-71
WP_007055360.1|2115199_2115895_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007052338.1|2115891_2117175_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_156628927.1|2117288_2119010_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_010081652.1|2119039_2119747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472166.1|2119835_2121437_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010081650.1|2121544_2122177_-	DUF4125 family protein	NA	NA	NA	NA	NA
WP_010081649.1|2122252_2124616_-	DUF4037 domain-containing protein	NA	NA	NA	NA	NA
WP_007053838.1|2124702_2125893_-	MFS transporter	NA	NA	NA	NA	NA
WP_007053839.1|2126393_2128076_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	34.9	9.8e-75
WP_007056736.1|2128137_2129103_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_007052347.1|2129162_2129903_+	phosphoglyceromutase	NA	NA	NA	NA	NA
WP_007053841.1|2130263_2130938_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_007055303.1|2131128_2132322_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_007052350.1|2132446_2132701_-	DUF2530 domain-containing protein	NA	NA	NA	NA	NA
WP_007052351.1|2132830_2133973_-	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_007052353.1|2134366_2135323_+	CHAP domain-containing protein	NA	A0A1P8CMP9	Staphylococcus_phage	40.6	1.8e-09
WP_007052354.1|2135535_2136282_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_007053845.1|2136427_2137180_+	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	36.6	5.1e-07
WP_007052357.1|2137347_2138385_+	universal stress protein	NA	NA	NA	NA	NA
WP_007052358.1|2138443_2138857_-	OsmC family protein	NA	NA	NA	NA	NA
WP_007052359.1|2139057_2139858_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	64.8	5.0e-101
WP_007052360.1|2139967_2140630_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	43.6	1.6e-20
WP_007052361.1|2140753_2141272_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_007052362.1|2141450_2141783_-	branched-chain amino acid transporter permease	NA	NA	NA	NA	NA
WP_010081666.1|2141779_2142607_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010081665.1|2143285_2144509_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012472169.1|2145128_2145773_-	hypothetical protein	NA	NA	NA	NA	NA
2146514:2146539	attL	GGCCTATAGGAACTTTTGTGGTGCTT	NA	NA	NA	NA
WP_012472066.1|2146819_2147584_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.2	6.5e-34
WP_012472171.1|2147580_2149104_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007056226.1|2150255_2151017_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.8	4.8e-37
WP_171845164.1|2151013_2152507_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007053137.1|2153131_2154334_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010081384.1|2154330_2155296_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007054866.1|2155292_2156348_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
2158046:2158071	attR	AAGCACCACAAAAGTTCCTATAGGCC	NA	NA	NA	NA
