The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009663	Sulfurovum sp. NBC37-1, complete genome	2562277	1770116	1775868	2562277		Escherichia_phage(16.67%)	8	NA	NA
WP_012083474.1|1770116_1770650_-	GDP-mannose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	37.2	1.2e-13
WP_012083475.1|1770646_1771513_-	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	33.5	7.2e-13
WP_012083476.1|1771505_1772081_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	41.1	5.8e-27
WP_012083477.1|1772096_1772351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012083478.1|1772368_1773118_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_012083479.1|1773117_1773714_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	41.4	4.8e-24
WP_012083480.1|1773703_1774429_-	adenylyl-sulfate kinase	NA	A0A1B0XTK5	Freshwater_phage	38.7	2.1e-05
WP_012083481.1|1774428_1775868_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.3	4.0e-32
>prophage 2
NC_009663	Sulfurovum sp. NBC37-1, complete genome	2562277	1989492	2050459	2562277	protease,tRNA,transposase	uncultured_virus(20.0%)	50	NA	NA
WP_012083690.1|1989492_1990452_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012083692.1|1990469_1991267_-	glutamate racemase	NA	NA	NA	NA	NA
WP_012083694.1|1991279_1992605_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_012083696.1|1992814_1994176_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_148154693.1|1994326_1994716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012083698.1|1994787_1997205_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.4	1.2e-102
WP_012083699.1|1997353_1997605_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_012083700.1|1997821_1998403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012083701.1|1998415_1999456_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.8	7.2e-84
WP_012083702.1|1999568_2000993_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.2	2.1e-54
WP_012083703.1|2000989_2002204_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012083704.1|2002338_2003166_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.0	1.5e-68
WP_012083705.1|2003853_2005059_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	35.7	1.0e-57
WP_012083706.1|2005042_2005477_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012083707.1|2006113_2007430_+	sugar transferase	NA	NA	NA	NA	NA
WP_012083708.1|2007435_2007885_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_012083709.1|2010335_2012042_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.4e-57
WP_012083710.1|2012098_2012845_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041672750.1|2012849_2013710_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_041673080.1|2013881_2014610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148154695.1|2014856_2015846_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_012083714.1|2016408_2018013_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_041672751.1|2018225_2018495_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SD74	Indivirus	39.2	2.6e-06
WP_012083715.1|2018810_2019422_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_012083716.1|2019458_2020172_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_012083717.1|2020161_2020992_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012083718.1|2020984_2023000_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.1	4.2e-104
WP_012083719.1|2023000_2023720_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011980420.1|2023940_2025263_-|transposase	IS1380-like element ISSlsp1 family transposase	transposase	NA	NA	NA	NA
WP_012083720.1|2025650_2027207_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_012083721.1|2027300_2028545_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.6	8.9e-81
WP_012083722.1|2028730_2031109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012083723.1|2031124_2031664_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012083724.1|2031922_2033908_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_050748054.1|2033993_2034584_-|transposase	transposase	transposase	K4I1H9	Acidithiobacillus_phage	31.1	4.4e-06
WP_012083725.1|2035412_2035655_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_012083726.1|2035844_2036105_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.7	1.0e-15
WP_012083727.1|2036144_2037773_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	58.6	1.8e-166
WP_012083728.1|2037831_2039646_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_148154831.1|2039699_2040959_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	39.8	1.6e-45
WP_050748055.1|2041044_2041812_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012083731.1|2041771_2042764_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	30.5	6.1e-24
WP_012083732.1|2042866_2043295_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_012083733.1|2043284_2043674_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_012083734.1|2043675_2046396_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	27.9	1.6e-29
WP_012083735.1|2046444_2046678_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
WP_012083736.1|2046716_2047595_-	homoserine kinase	NA	NA	NA	NA	NA
WP_012083737.1|2047609_2048077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012083738.1|2048057_2048942_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_011980420.1|2049136_2050459_+|transposase	IS1380-like element ISSlsp1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009663	Sulfurovum sp. NBC37-1, complete genome	2562277	2506758	2558215	2562277	tRNA,integrase,transposase	Shigella_phage(16.67%)	52	2521087:2521110	2543705:2543728
WP_012084191.1|2506758_2507988_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.6	5.3e-78
WP_012084193.1|2507984_2508521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084194.1|2508721_2508904_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012084195.1|2509129_2509513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084196.1|2509520_2510282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041672796.1|2510614_2510812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084198.1|2511029_2511248_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012084199.1|2511387_2511576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084200.1|2511575_2511845_+	DUF2693 domain-containing protein	NA	NA	NA	NA	NA
WP_012084201.1|2511878_2512100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050748034.1|2513493_2514186_+|transposase	transposase	transposase	K4ICS3	Acidithiobacillus_phage	41.3	1.2e-31
WP_148154715.1|2514257_2514593_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012084202.1|2515134_2516184_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_012084203.1|2516272_2518087_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.5	1.6e-115
WP_041673145.1|2518140_2518635_+	translation initiation factor IF-3	NA	A0A1C3S7H2	Escherichia_phage	34.2	9.4e-10
WP_041673146.1|2518699_2520388_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
2521087:2521110	attL	TCCCCACATATTCCCCACACCAAA	NA	NA	NA	NA
WP_148154717.1|2521940_2522567_+	gamma-glutamylcyclotransferase	NA	A0A0B5A1G2	Pseudomonas_phage	37.7	2.1e-06
WP_012084207.1|2522596_2523010_+	very short patch repair endonuclease	NA	NA	NA	NA	NA
WP_012084208.1|2523075_2524533_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012084209.1|2524534_2527306_+	Z1 domain-containing protein	NA	NA	NA	NA	NA
WP_012084210.1|2527292_2528264_+	PD-(D/E)XK motif protein	NA	NA	NA	NA	NA
WP_012084211.1|2528256_2530311_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	26.5	7.4e-08
WP_012084212.1|2530310_2530988_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012084213.1|2530992_2531886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084214.1|2531875_2533591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084215.1|2533577_2534555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148154850.1|2534544_2535585_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	35.7	5.7e-49
WP_012084217.1|2535924_2536305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084218.1|2536317_2536611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084219.1|2536652_2536886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158298198.1|2536894_2537062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084220.1|2537173_2537419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012084221.1|2537415_2537862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084222.1|2537885_2538176_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	36.6	1.1e-05
WP_041673150.1|2538162_2538495_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	47.5	6.5e-15
WP_012084224.1|2538535_2540143_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_012084225.1|2540139_2540493_-	DNA transfer system protein TraJ	NA	NA	NA	NA	NA
WP_012084226.1|2540489_2540711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084227.1|2540867_2541383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012084228.1|2541389_2541998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084229.1|2541991_2542492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084230.1|2542560_2543661_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059WLJ1	Vibrio_phage	36.0	6.1e-49
WP_011980440.1|2544388_2545594_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	35.9	5.4e-59
2543705:2543728	attR	TCCCCACATATTCCCCACACCAAA	NA	NA	NA	NA
WP_012084231.1|2545839_2546751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084232.1|2546856_2547954_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	35.9	3.6e-41
WP_012084233.1|2547975_2549856_-	amidohydrolase	NA	NA	NA	NA	NA
WP_041672798.1|2549872_2550088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012084234.1|2550254_2553122_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012084235.1|2553131_2553731_-	porin family protein	NA	NA	NA	NA	NA
WP_012084236.1|2553815_2554502_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_158298200.1|2554494_2556063_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083760499.1|2558023_2558215_-|transposase	transposase	transposase	NA	NA	NA	NA
