The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011415	Escherichia coli SE11, complete genome	4887515	197070	259463	4887515	tRNA,protease,plate,transposase	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|197070_198423_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198452_200885_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|201006_201492_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201495_202521_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202625_203081_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203084_203873_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203872_205021_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205017_205614_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205650_209133_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209145_210105_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|210203_212345_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212401_212791_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212855_214154_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214202_214463_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214449_214650_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214815_215361_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635316.1|215357_215780_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215793_216504_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399647.1|216753_217734_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|218814_220533_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|220644_221352_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|221348_221753_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|221870_222686_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|222725_223379_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|223371_224403_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|224590_225163_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|230921_231725_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|231721_232636_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|232876_233677_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|233754_234525_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|234572_235931_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052710.1|236002_236758_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|236791_237514_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|237510_237978_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|238042_238774_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|239313_240099_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|240235_240715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908051.1|240724_241639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|241682_242165_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|242188_243541_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122985538.1|243551_246986_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240521.1|247094_248507_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|248511_249255_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614422.1|249251_252215_-	AAA family ATPase	NA	H6X3M6	Enterobacteria_phage	26.2	4.6e-75
WP_000343302.1|252223_252985_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|252989_254321_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080152.1|254323_254848_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|254844_256125_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|256149_257232_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|257195_259046_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611738.1|259049_259463_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NC_011415	Escherichia coli SE11, complete genome	4887515	598110	667150	4887515	transposase,capsid,portal,lysis,tRNA,integrase,tail,protease,head,terminase	Enterobacteria_phage(56.36%)	79	608272:608318	658624:658670
WP_000912345.1|598110_599496_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|599531_600053_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|600160_600373_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|600374_601241_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|601721_602264_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|602483_603176_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_012565038.1|603206_605816_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691080.1|605828_606836_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|606846_607362_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|607364_607997_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
608272:608318	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_012565039.1|608331_609495_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	2.2e-198
WP_000488407.1|609693_609972_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000248037.1|610605_611184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205067.1|611180_611783_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001001031.1|611794_613039_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	34.0	7.1e-46
WP_000149540.1|613035_613194_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	2.6e-22
WP_000186835.1|613190_613871_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	4.6e-132
WP_000100847.1|613867_614653_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995420.1|614658_614955_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_023148105.1|615030_615321_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001444023.1|615786_616107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|616242_616506_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001295669.1|616588_617281_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|617391_617619_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182880.1|617649_618189_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	4.0e-62
WP_000147899.1|618185_619205_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.4e-111
WP_000788786.1|619201_619903_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_000145915.1|619899_620202_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|620269_620602_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|620693_620801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|620858_622385_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_024210445.1|622496_622826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000986835.1|622885_623137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053030.1|623307_623763_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224919.1|623762_623933_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|623925_624216_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|624212_624575_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|624571_624712_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|624797_625181_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|625370_626468_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|627056_627272_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|627271_627769_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|627985_628168_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|628258_628552_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|628914_629109_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|629498_630044_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|630018_631944_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|631940_632147_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358553.1|632143_633745_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000123248.1|633725_635045_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|635054_635387_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|635442_636468_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158875.1|636509_636905_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|636916_637270_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|637281_637860_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|637856_638252_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001358372.1|638259_639000_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000479127.1|639015_639438_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	87.1	1.2e-61
WP_000459457.1|639419_639854_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840305.1|639846_642408_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847376.1|642404_642734_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_001152639.1|642733_643432_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|643437_644181_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_123371363.1|644117_644750_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	88.1	1.1e-92
WP_000515783.1|644810_648308_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	96.6	0.0e+00
WP_001233071.1|648378_648978_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_024210446.1|649042_652003_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|652002_652578_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086513.1|652675_653266_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	38.3	2.8e-24
WP_000836768.1|653582_653816_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|653884_653998_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|654363_655032_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226374.1|655576_657061_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|657247_658201_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177455.1|658713_659475_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
658624:658670	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224602.1|659657_660548_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|660548_663521_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|663507_665745_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420936.1|666013_667150_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_011415	Escherichia coli SE11, complete genome	4887515	1469990	1589699	4887515	transposase,lysis,tRNA,tail,terminase	Escherichia_phage(46.43%)	111	NA	NA
WP_000628065.1|1469990_1471223_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1471477_1472461_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123738.1|1472938_1474312_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1474440_1475376_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1475427_1476663_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1476664_1476880_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1476958_1477168_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1477160_1477355_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1477411_1478221_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105146.1|1478213_1480814_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	2.0e-247
WP_012565066.1|1480915_1481191_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1481265_1481436_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1481435_1481657_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1482099_1482588_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1482584_1482740_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1482750_1482930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1483172_1483592_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1483671_1483926_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693804.1|1483922_1484345_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1484357_1485215_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788971.1|1485221_1485968_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.0	1.9e-110
WP_000450658.1|1485990_1486752_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-117
WP_001141106.1|1486767_1487145_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	1.6e-54
WP_001118594.1|1487435_1489118_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000505828.1|1489645_1490695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|1491179_1492393_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000940319.1|1492988_1493588_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|1493587_1493878_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|1493874_1494417_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|1495461_1495890_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1496061_1496436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|1496687_1496903_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|1496902_1497400_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|1497616_1497802_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|1497998_1499456_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|1499593_1500385_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|1500377_1501310_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|1501245_1501497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|1501500_1502595_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|1502575_1503877_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|1503879_1505286_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|1505269_1506382_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|1506486_1507251_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|1507349_1508489_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|1508531_1508708_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1508711_1509107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1509106_1509490_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|1509490_1509871_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|1509867_1510260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|1510286_1511249_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|1511399_1511759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840618.1|1512232_1515466_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.1e-111
WP_000024051.1|1515458_1515797_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|1515796_1516495_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_012565076.1|1516500_1517244_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.6e-146
WP_000090943.1|1517180_1517783_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_000515709.1|1517843_1521341_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|1521411_1522011_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_012565077.1|1522075_1525474_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_000885615.1|1525473_1526058_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	1.5e-102
WP_000586336.1|1526131_1527463_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001157925.1|1527737_1527911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082294.1|1528175_1528610_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1528750_1529884_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_000628232.1|1530250_1533775_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1534048_1534315_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1534311_1534734_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|1534844_1535834_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900984.1|1536041_1538681_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|1538677_1538863_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001325798.1|1538867_1539197_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|1539368_1540274_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1540509_1542009_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535464.1|1542066_1544340_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186457.1|1544587_1546633_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191067.1|1546917_1547847_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1547858_1548146_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072831.1|1548154_1548901_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189206.1|1548915_1549413_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206374.1|1549420_1550491_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292341.1|1550487_1551255_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969792.1|1551254_1552043_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973371.1|1552044_1553472_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1553461_1553884_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|1553883_1555089_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632286.1|1555115_1556429_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039892.1|1556529_1557480_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123453.1|1557461_1558052_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097794.1|1558283_1559144_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000471499.1|1559207_1561514_+	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000177535.1|1561684_1562290_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_049768376.1|1565724_1567041_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048955.1|1567091_1567697_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139551.1|1567897_1571800_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001027943.1|1572071_1572872_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115948.1|1573068_1574508_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048672.1|1574549_1575551_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001307188.1|1575739_1576270_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731856.1|1576514_1576688_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	5.8e-07
WP_001320773.1|1576759_1576909_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098559.1|1577307_1578948_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414560.1|1578985_1579909_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013783.1|1580125_1581469_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|1581693_1583349_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|1583488_1583713_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140884.1|1583775_1584312_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001234037.1|1584306_1585287_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001190278.1|1585410_1586403_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586720.1|1586399_1586993_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|1587295_1587964_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000826403.1|1588490_1589699_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
>prophage 4
NC_011415	Escherichia coli SE11, complete genome	4887515	1740293	1793997	4887515	capsid,portal,holin,tail,head,terminase	Enterobacteria_phage(35.85%)	70	NA	NA
WP_000114662.1|1740293_1742066_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	43.0	9.1e-55
WP_072135258.1|1742115_1742190_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_000268768.1|1742529_1745358_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	97.4	1.4e-57
WP_001228226.1|1745422_1746022_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.5	5.2e-103
WP_000515166.1|1746089_1749569_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090857.1|1749629_1750262_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_012565085.1|1750198_1750942_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_001152638.1|1750947_1751646_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847379.1|1751645_1751975_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840306.1|1751971_1754533_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
WP_000459457.1|1754525_1754960_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479194.1|1754941_1755364_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	3.8e-60
WP_012565086.1|1755379_1756120_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	3.0e-129
WP_000683129.1|1756127_1756523_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975109.1|1756519_1757098_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000752970.1|1757109_1757463_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	95.7	1.9e-60
WP_000201533.1|1757474_1757876_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	78.6	4.6e-47
WP_000522569.1|1757926_1758955_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	4.1e-116
WP_024210450.1|1759027_1759366_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	48.6	5.3e-20
WP_001253883.1|1759386_1760886_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.8	1.5e-98
WP_012565087.1|1760875_1762468_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.8	4.9e-185
WP_000256235.1|1762464_1762671_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	55.4	1.0e-10
WP_000028207.1|1762657_1764583_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.3	4.1e-258
WP_000874942.1|1764554_1765061_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	6.2e-33
WP_041031382.1|1765705_1765996_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	97.7	3.4e-44
WP_126633427.1|1766154_1766337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117823.1|1766351_1766729_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_000950570.1|1766734_1767010_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
WP_001294586.1|1766999_1767392_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	5.7e-50
WP_000833649.1|1767479_1767632_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.2	6.2e-05
WP_000466932.1|1767628_1768054_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	1.5e-59
WP_012565093.1|1769141_1769543_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001064880.1|1769736_1770426_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	6.2e-60
WP_000139997.1|1770422_1770788_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.3e-37
WP_001265262.1|1770788_1771847_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	4.1e-87
WP_012565094.1|1771848_1772121_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
WP_000543832.1|1772287_1772500_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	94.3	8.1e-27
WP_000208124.1|1773319_1773733_-	hypothetical protein	NA	V5UT79	Shigella_phage	61.1	9.6e-24
WP_000156881.1|1773744_1774116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209155.1|1774117_1774336_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	93.1	1.0e-29
WP_000935432.1|1774368_1774581_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.9e-32
WP_000403783.1|1774631_1774988_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001289837.1|1774989_1775547_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	75.7	1.3e-87
WP_001018051.1|1775533_1775821_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.2	1.4e-34
WP_001266137.1|1775817_1776114_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.9	1.6e-49
WP_001151200.1|1776110_1776533_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	2.7e-66
WP_077626014.1|1776573_1777683_-	DNA-binding protein	NA	V5URT9	Shigella_phage	67.2	2.5e-127
WP_000273724.1|1777761_1778217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693848.1|1778423_1778849_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|1778845_1779073_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|1779172_1779817_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_041031385.1|1780094_1780250_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171569.1|1780409_1780628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024207709.1|1780650_1780851_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_000358771.1|1780810_1781089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077626015.1|1781181_1781376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449177.1|1781648_1781837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090192.1|1781833_1782037_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001271562.1|1782114_1784574_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.3	1.5e-103
WP_000005552.1|1784643_1784895_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_012565101.1|1784914_1786210_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	61.7	2.4e-153
WP_072131185.1|1786232_1786340_-	transporter	NA	NA	NA	NA	NA
WP_000836059.1|1786397_1787417_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1787428_1788643_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1788848_1789175_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1789309_1789651_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1789685_1790246_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1790248_1790959_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1791066_1791372_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1791570_1793997_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
>prophage 5
NC_011415	Escherichia coli SE11, complete genome	4887515	1926303	1971866	4887515	capsid,portal,plate,tRNA,holin,integrase,tail,head,terminase	Enterobacteria_phage(77.27%)	58	1928706:1928730	1964508:1964532
WP_000029466.1|1926303_1927053_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|1927052_1927604_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956530.1|1927666_1928647_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1928706:1928730	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000997174.1|1928855_1929185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000668483.1|1929292_1929655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247211.1|1929657_1930596_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904672.1|1930684_1930993_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|1931089_1931368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917811.1|1931382_1931721_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_000158971.1|1931731_1932019_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|1932030_1932273_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|1932269_1932383_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1932469_1932673_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000584687.1|1932669_1932915_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	90.1	1.7e-36
WP_000599388.1|1933056_1933422_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.1e-60
WP_000123454.1|1933428_1936194_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	94.9	0.0e+00
WP_012565106.1|1936404_1937196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781372.1|1937179_1937524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000717775.1|1937535_1938912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|1939460_1940507_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613769.1|1940506_1942258_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.3	0.0e+00
WP_001262673.1|1942412_1943249_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|1943271_1944324_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632339.1|1944369_1945170_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	4.9e-125
WP_000063082.1|1945272_1945767_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864897.1|1945766_1945967_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|1945969_1946293_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072328.1|1946289_1946682_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000780541.1|1946678_1947086_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_000920599.1|1947223_1947691_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.3e-85
WP_000356351.1|1947683_1948319_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	4.1e-114
WP_077626020.1|1948330_1948897_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	3.9e-100
WP_001067548.1|1948914_1949244_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111924.1|1949247_1950144_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	3.5e-156
WP_000071739.1|1950136_1950667_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108549.1|1950669_1952655_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	85.7	2.7e-172
WP_000972138.1|1952657_1953191_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001164130.1|1953219_1953747_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.1	2.8e-92
WP_001171284.1|1953750_1954587_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	94.2	4.2e-151
WP_000905061.1|1954691_1955291_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979954.1|1955319_1955808_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853414.1|1955820_1958628_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.1	0.0e+00
WP_000333494.1|1958614_1958770_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000651567.1|1958778_1959153_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	84.6	4.0e-45
WP_000290462.1|1959208_1959721_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005406.1|1959720_1960905_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.4e-224
WP_000132820.1|1961062_1962160_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	6.6e-205
WP_024210451.1|1962290_1963436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488102.1|1963652_1963913_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1964103_1964244_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1964549_1964849_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1964508:1964532	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672343.1|1964853_1967241_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1967255_1968239_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1968521_1968566_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1968688_1969045_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1969097_1969295_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1969391_1969934_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|1969937_1971866_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
>prophage 6
NC_011415	Escherichia coli SE11, complete genome	4887515	2082767	2177680	4887515	transposase,capsid,portal,tRNA,holin,tail,protease,head,terminase	Enterobacteria_phage(57.14%)	105	NA	NA
WP_000984517.1|2082767_2083649_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2083840_2085889_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2085908_2086607_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2086703_2087201_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2087330_2088614_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2088582_2091216_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001307251.1|2091295_2092735_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2092852_2093089_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2093193_2093385_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812735.1|2093385_2094042_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
WP_000976472.1|2094437_2094779_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879282.1|2094791_2095664_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2095667_2096042_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2096180_2096411_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2096512_2097169_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2097192_2097855_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|2097851_2099912_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2100120_2100780_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2101106_2101463_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2101529_2101820_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173493.1|2101953_2103132_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2103187_2103829_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069466.1|2103865_2105677_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|2105911_2107387_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|2107724_2108594_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|2108721_2110164_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2110295_2111267_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2111386_2112709_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2112724_2113657_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2113735_2114491_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2114487_2115273_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2115419_2116430_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2116438_2117050_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2117188_2117254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|2117324_2117927_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2117928_2118450_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2118484_2119225_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|2119253_2119706_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2119823_2121596_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|2121905_2122472_+	hydrolase	NA	NA	NA	NA	NA
WP_000885624.1|2122892_2123477_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	7.3e-102
WP_000279143.1|2123476_2126551_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	7.3e-68
WP_001233090.1|2126615_2127215_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515700.1|2127285_2130783_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	96.9	0.0e+00
WP_000090891.1|2130843_2131476_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140723.1|2131412_2132156_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_001152571.1|2132161_2132860_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847331.1|2132859_2133189_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840353.1|2133185_2135747_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.4	0.0e+00
WP_000459457.1|2135739_2136174_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479155.1|2136155_2136578_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_012565115.1|2136593_2137334_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	1.5e-131
WP_000683105.1|2137341_2137737_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975050.1|2137733_2138312_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000785280.1|2138323_2138677_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|2138688_2139084_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063250.1|2139125_2140151_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|2140206_2140539_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123337.1|2140548_2141868_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.1e-233
WP_001362418.1|2141848_2143450_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000198149.1|2143446_2143653_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027308.1|2143649_2145575_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|2145549_2146095_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_041031370.1|2146701_2146953_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	95.2	1.7e-39
WP_126633427.1|2147152_2147335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001117823.1|2147349_2147727_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_000950570.1|2147732_2148008_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
WP_012565117.1|2147997_2148390_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	9.0e-48
WP_000833645.1|2148478_2148631_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.2	8.1e-05
WP_000466937.1|2148627_2149053_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	3.3e-59
WP_000024309.1|2150066_2151113_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.5	8.0e-192
WP_000917767.1|2151263_2151461_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000019440.1|2151864_2152845_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000457920.1|2152898_2153132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737251.1|2153242_2154325_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	2.1e-158
WP_001204816.1|2154512_2154896_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.8	1.9e-58
WP_001064805.1|2154895_2155153_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.8	1.3e-34
WP_000211328.1|2155149_2156541_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	98.3	3.3e-262
WP_000988191.1|2156537_2157416_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.4	3.5e-140
WP_000061543.1|2157426_2158251_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	80.0	9.7e-92
WP_000621185.1|2158247_2158472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336163.1|2158468_2158702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103201.1|2158694_2159360_-	ash family protein	NA	Q8W643	Enterobacteria_phage	91.1	6.1e-105
WP_001406052.1|2159473_2160181_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	98.3	6.1e-127
WP_000867914.1|2160300_2160594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838346.1|2160985_2161642_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	99.5	2.8e-126
WP_000608399.1|2161745_2162249_+	helix-turn-helix transcriptional regulator	NA	Q8W649	Enterobacteria_phage	95.5	1.5e-63
WP_000141090.1|2162536_2162743_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_000676870.1|2162939_2163128_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	96.8	5.0e-28
WP_012565120.1|2163124_2163706_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	91.2	4.1e-105
WP_000720008.1|2164068_2164896_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	8.1e-131
WP_001695578.1|2164936_2165308_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	2.9e-64
WP_000457711.1|2165339_2165582_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	97.5	5.8e-37
WP_001030144.1|2165585_2165732_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	4.5e-21
WP_000528717.1|2165740_2165977_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_000361996.1|2166032_2167346_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	97.9	3.0e-252
WP_049768377.1|2167327_2168098_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2168150_2168546_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2168586_2169330_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564742.1|2169326_2170298_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176841.1|2170462_2172892_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2172916_2174017_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2174404_2175151_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2175164_2175731_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2175946_2177680_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 7
NC_011415	Escherichia coli SE11, complete genome	4887515	2225881	2308960	4887515	transposase,capsid,plate,portal,holin,integrase,tail,head,terminase	Escherichia_phage(20.0%)	99	2261390:2261449	2309030:2309106
WP_000826403.1|2225881_2227090_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
WP_000879833.1|2228474_2229272_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2229281_2229833_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2230001_2230334_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274295.1|2230667_2230982_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994447.1|2231196_2232855_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2232847_2233843_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|2233835_2234522_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213318.1|2234521_2235895_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2235913_2236357_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620113.1|2236353_2237481_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133112.1|2237585_2238050_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2238054_2239059_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2239055_2239469_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001349974.1|2239471_2239837_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2239836_2240574_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2240583_2240853_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|2240861_2241647_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2241936_2242560_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2242603_2242792_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2242954_2243182_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491500.1|2243479_2244295_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_012565123.1|2244291_2245986_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009306.1|2246156_2246339_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2246417_2247335_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|2247507_2248428_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2248416_2248887_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157239.1|2248867_2250286_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365564.1|2250352_2251048_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	7.3e-08
WP_001313057.1|2251087_2251453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2252019_2253183_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218209.1|2253773_2254625_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826769.1|2254732_2256091_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|2256090_2256762_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|2256894_2257308_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2257416_2258421_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|2258421_2259057_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2259313_2259964_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079073.1|2260305_2260836_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	7.2e-56
2261390:2261449	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_000974856.1|2261814_2262819_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	NA	NA	NA	NA
WP_001287093.1|2262824_2263868_-	phage late control protein	NA	R9TNM7	Vibrio_phage	28.7	9.9e-33
WP_000634204.1|2263871_2264084_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|2264100_2264343_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_024184912.1|2264321_2264711_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	39.5	1.5e-15
WP_001018354.1|2264746_2266387_-	hypothetical protein	NA	A0A2I7R731	Vibrio_phage	34.9	2.4e-17
WP_000445104.1|2266495_2266777_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001285189.1|2266789_2267302_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000106127.1|2267319_2268825_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	35.8	3.7e-73
WP_000829622.1|2268836_2269985_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.0	4.9e-17
WP_000203867.1|2269977_2270604_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	31.2	7.0e-26
WP_000633315.1|2270606_2271527_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.1	3.5e-66
WP_000467660.1|2271523_2271865_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	3.1e-20
WP_000079172.1|2271867_2272773_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	34.7	2.9e-12
WP_000015611.1|2272753_2273290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774515.1|2273286_2273967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122902.1|2273998_2274379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105180.1|2274375_2274789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283998.1|2274823_2275858_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.8	3.0e-106
WP_000206291.1|2275919_2276249_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|2276248_2277559_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_000126794.1|2277558_2279130_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.3	1.5e-189
WP_012565126.1|2279126_2279360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|2279356_2281222_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|2281208_2281775_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|2282147_2282393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004432.1|2282678_2283149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125258.1|2283222_2283471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000734932.1|2283572_2283764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131875.1|2283771_2284251_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.2	3.5e-62
WP_000172496.1|2284250_2284523_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2284522_2284906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064383.1|2285018_2285690_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	31.9	2.0e-15
WP_000717782.1|2285689_2285983_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_000057009.1|2285979_2286576_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	3.0e-71
WP_001025459.1|2286653_2286833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000855416.1|2286984_2287626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066090.1|2288135_2288915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582583.1|2289393_2290056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282641.1|2290378_2291758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353907.1|2292083_2292890_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.8	4.9e-40
WP_000166883.1|2292970_2294206_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001013409.1|2294337_2294898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237643.1|2295350_2296274_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000211984.1|2296451_2297246_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	73.8	1.4e-47
WP_000466604.1|2297518_2297740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002789.1|2297927_2298152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192614.1|2298381_2298783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067617.1|2298821_2300213_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	46.5	1.9e-103
WP_000088681.1|2300209_2301274_-	hypothetical protein	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_000943913.1|2301276_2301501_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_000431150.1|2301540_2302017_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	8.5e-24
WP_000846364.1|2302076_2302274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000423305.1|2302936_2303161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388259.1|2304191_2304512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151807.1|2304542_2306759_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.3	1.6e-101
WP_000100754.1|2306755_2307325_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.3	2.1e-37
WP_000916333.1|2307324_2307507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998966.1|2307716_2307932_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	69.0	6.1e-22
WP_000091777.1|2307931_2308960_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	1.6e-96
2309030:2309106	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 8
NC_011415	Escherichia coli SE11, complete genome	4887515	2462939	2472381	4887515		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2462939_2464076_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|2464072_2466073_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2466197_2466659_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2466699_2467170_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2467216_2467936_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2467932_2469618_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2469839_2470571_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2470630_2470738_+	protein YohO	NA	NA	NA	NA	NA
WP_000783121.1|2470718_2471450_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2471454_2472381_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
NC_011415	Escherichia coli SE11, complete genome	4887515	2660385	2717558	4887515	transposase,head,plate,tRNA,tail,protease	Shigella_phage(44.0%)	71	NA	NA
WP_000514025.1|2660385_2661081_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.6	4.3e-133
WP_021548357.1|2661031_2661220_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	96.8	5.3e-30
WP_000904924.1|2661302_2661896_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	98.5	1.3e-106
WP_001112237.1|2661925_2662921_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	95.9	1.1e-185
WP_000972170.1|2662923_2663457_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	5.5e-96
WP_001164107.1|2663485_2664013_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.9	8.9e-91
WP_000499368.1|2664016_2665519_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.8	1.7e-102
WP_000301698.1|2665518_2666061_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	100.0	1.3e-100
WP_000331809.1|2666051_2667134_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	99.2	1.3e-205
WP_000130552.1|2667134_2667572_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	99.3	2.9e-79
WP_000442753.1|2667568_2668162_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072822.1|2668149_2669289_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461074.1|2669281_2670769_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	88.1	1.5e-223
WP_000147077.1|2670773_2672885_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	85.4	2.3e-275
WP_000344078.1|2673029_2673464_-|tail	phage tail assembly protein	tail	C9DGP9	Escherichia_phage	96.5	1.8e-68
WP_000918404.1|2673473_2673830_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	100.0	2.4e-63
WP_001280309.1|2673839_2675327_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	99.0	4.2e-279
WP_000979226.1|2675323_2675530_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	97.1	6.4e-29
WP_000562200.1|2675513_2676062_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	95.1	4.9e-100
WP_000119395.1|2676061_2676484_-	DUF1320 family protein	NA	A0A0C4UR02	Shigella_phage	77.9	9.4e-59
WP_000017160.1|2676480_2676891_-	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	92.6	3.1e-59
WP_000637415.1|2676957_2677875_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	99.7	5.2e-179
WP_000716019.1|2677871_2678957_-|protease	phage protease	protease	A0A0C4UQU6	Shigella_phage	96.4	2.3e-189
WP_000050892.1|2679158_2679629_-	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	84.6	1.3e-72
WP_001136426.1|2679625_2680945_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	94.1	1.2e-237
WP_000532647.1|2680925_2682464_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	98.6	1.3e-294
WP_000104672.1|2682463_2684119_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	98.9	0.0e+00
WP_000660214.1|2684173_2684359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257713.1|2684348_2684543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375393.1|2684556_2685132_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	97.9	1.1e-94
WP_000564504.1|2685143_2685434_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	96.8	1.8e-45
WP_000356258.1|2685430_2685730_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	42.9	5.3e-16
WP_000997675.1|2685742_2686171_-	hypothetical protein	NA	A0A1W6JNW4	Morganella_phage	37.7	5.0e-07
WP_000184653.1|2686273_2686684_-	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	75.2	1.4e-54
WP_000476267.1|2686816_2687197_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	40.7	5.6e-10
WP_000515800.1|2687189_2687408_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	84.7	1.5e-31
WP_001113882.1|2687400_2687961_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	43.9	4.6e-37
WP_000189799.1|2688043_2688433_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	87.5	1.7e-59
WP_001082363.1|2688429_2688981_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	89.1	5.5e-91
WP_000687313.1|2689011_2689428_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_001059089.1|2689389_2689701_-	hypothetical protein	NA	A0A0C4UQR5	Shigella_phage	78.0	1.7e-36
WP_001067068.1|2689693_2689852_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	93.0	7.6e-14
WP_000197751.1|2690019_2690247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012565150.1|2690233_2690542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107933.1|2690582_2691107_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	98.3	6.3e-89
WP_000649775.1|2691126_2691414_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	96.8	2.4e-45
WP_001101154.1|2691426_2691846_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	3.5e-74
WP_001405996.1|2691866_2692136_-	hypothetical protein	NA	C9DGL5	Escherichia_phage	97.8	1.8e-31
WP_001026714.1|2692610_2693549_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	88.4	3.5e-154
WP_000955480.1|2693587_2695585_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	92.6	0.0e+00
WP_001274794.1|2695578_2695806_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	47.7	1.8e-08
WP_012565155.1|2696017_2696584_+	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	46.9	2.4e-09
WP_001293612.1|2697477_2698251_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|2698258_2698975_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|2698971_2699658_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_000737621.1|2699747_2700530_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|2700750_2701533_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|2701798_2702368_-	flavin prenyltransferase UbiX	NA	NA	NA	NA	NA
WP_000334218.1|2702462_2703980_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
WP_000262113.1|2704016_2704505_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146981.1|2704763_2705426_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584571.1|2705415_2706684_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|2706753_2707668_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364331.1|2707823_2708483_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283581.1|2708565_2709378_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2709377_2710391_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2710456_2711593_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2711691_2712687_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127762.1|2712683_2713862_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2714172_2715393_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683808.1|2715551_2717558_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 10
NC_011415	Escherichia coli SE11, complete genome	4887515	3091524	3098664	4887515		Escherichia_phage(83.33%)	6	NA	NA
WP_001272894.1|3091524_3094086_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
WP_001141330.1|3094191_3094848_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3094898_3095666_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847987.1|3095861_3096770_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590388.1|3096766_3098029_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_001278994.1|3098025_3098664_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NC_011419	Escherichia coli SE11 plasmid pSE11-1, complete sequence	100021	28884	34842	100021		Enterobacteria_phage(16.67%)	9	NA	NA
WP_000688514.1|28884_29865_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|29857_30274_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457498.1|30275_31550_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	5.8e-144
WP_000109071.1|31549_31987_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|31983_32232_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_173072220.1|32649_33552_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012565240.1|33548_33860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086157.1|33936_34620_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	3.9e-30
WP_001104867.1|34620_34842_+	hypothetical protein	NA	A0A2I6TCC3	Escherichia_phage	35.6	6.9e-05
