The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	561746	626913	5449314	portal,terminase,tail,transposase,tRNA,head,lysis,capsid,integrase,protease	Enterobacteria_phage(56.6%)	69	571907:571953	618387:618433
WP_000912345.1|561746_563132_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|563167_563689_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|563796_564009_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|564010_564877_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001400141.1|565357_565900_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|566119_566812_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|569463_570471_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|570481_570997_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805429.1|570999_571632_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
571907:571953	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|571966_573130_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206810.1|573356_573662_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001242707.1|573661_574024_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|574014_574551_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|574678_575503_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|575568_575931_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|576401_576917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001400137.1|577236_577929_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	3.9e-126
WP_001191674.1|578026_578287_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|578279_578831_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|579006_579186_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|579175_580117_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001305611.1|580113_580608_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000066917.1|580607_581261_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|581257_581584_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|581580_581970_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_001061438.1|581989_582799_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_001360050.1|582806_583796_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_000332834.1|583813_584197_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	3.4e-55
WP_000737283.1|584386_585484_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|586072_586288_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|586287_586785_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|587001_587184_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|587274_587568_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001298896.1|587858_588269_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|588554_588761_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298906.1|588925_589120_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_000453580.1|589508_590054_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|590028_591954_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|591950_592157_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001297098.1|592153_593755_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123319.1|593735_595055_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	1.5e-235
WP_001297109.1|595064_595397_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|595452_596478_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158905.1|596519_596918_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752979.1|596929_597283_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|597294_597873_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|597869_598265_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001298904.1|598272_599013_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479153.1|599028_599451_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|599432_599867_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847379.1|602336_602666_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152638.1|602665_603364_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000140729.1|603369_604113_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001309913.1|604010_604658_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000515573.1|604718_608117_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_001230323.1|608183_608783_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	2.6e-110
WP_000279114.1|608847_611763_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	2.5e-57
WP_000885588.1|611762_612338_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_000087133.1|612435_613026_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|613344_613578_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|613646_613760_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|614125_614794_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|615339_616824_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|617010_617964_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|618476_619238_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
618387:618433	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224556.1|619420_620311_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|620311_623284_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383912.1|623270_625508_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|625776_626913_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	840148	883217	5449314	portal,transposase,terminase,tail,holin,head,lysis,capsid,integrase	Enterobacteria_phage(53.66%)	47	831741:831755	887567:887581
831741:831755	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_042353367.1|840148_841231_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.2e-193
WP_001254222.1|841395_841578_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566868.1|841574_841745_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001108038.1|841737_842349_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_001028841.1|842345_843011_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|843222_844182_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|844521_844644_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|844658_845348_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|845532_846276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499453.1|846361_846520_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023209.1|846818_848669_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_024164617.1|849107_849323_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075136.1|849322_849820_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	98.8	1.9e-90
WP_000092314.1|849816_850254_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	9.4e-70
WP_162829241.1|850920_852134_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_032347049.1|852521_852716_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_000235436.1|853118_853628_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012816750.1|853599_855528_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000259002.1|855511_855718_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001374583.1|855714_857307_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_001253907.1|857296_858802_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000256725.1|858838_859186_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	7.5e-22
WP_000522623.1|859243_860272_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201513.1|860323_860707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204560.1|860699_861053_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000975031.1|861067_861601_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_000683065.1|861597_861993_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143022.1|862000_862753_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000479115.1|862766_863198_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|863224_863638_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000082378.1|863618_866198_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|866194_866524_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152517.1|866523_867222_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	88.4	5.4e-120
WP_012816751.1|867227_867971_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	95.9	1.7e-143
WP_000090913.1|867907_868510_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_000515380.1|868570_871966_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.2	0.0e+00
WP_001230425.1|872033_872633_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_000279086.1|872697_874011_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|874012_874282_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000950792.1|874458_875439_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_096150060.1|875785_875917_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950986.1|876080_876962_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	2.3e-147
WP_042353374.1|877228_878011_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.4	1.2e-144
WP_001131649.1|878562_879138_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_001102750.1|879475_880714_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_000767413.1|881392_881869_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001399730.1|881927_883217_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
887567:887581	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 3
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	1268819	1342420	5449314	terminase,tail,holin,tRNA,head,capsid,integrase	Stx2-converting_phage(33.33%)	81	1307756:1307770	1331043:1331057
WP_001113310.1|1268819_1269287_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074973.1|1269363_1270482_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|1270450_1270720_-	excisionase	NA	NA	NA	NA	NA
WP_000048411.1|1270781_1273253_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|1273345_1273537_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1273533_1273722_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001358071.1|1274122_1274287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171966.1|1274290_1274509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001443692.1|1274668_1274824_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	5.7e-06
WP_000948452.1|1275142_1275619_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1275743_1276067_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|1276050_1276476_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1276498_1277461_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000788938.1|1277467_1278208_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000450874.1|1278233_1279004_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
WP_001118159.1|1279019_1279415_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000627694.1|1279471_1280056_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
WP_001278450.1|1280171_1280276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000884071.1|1280464_1280677_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	1.2e-17
WP_001341388.1|1280844_1281123_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265175.1|1281124_1282174_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_000904098.1|1282186_1282561_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
WP_000762928.1|1282557_1283379_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|1284549_1286400_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_085954673.1|1286683_1286899_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
WP_000138558.1|1287154_1287427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1287586_1288120_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1288766_1288973_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1289037_1289262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1289618_1289759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1289888_1290074_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279805.1|1290115_1290481_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	1.2e-65
WP_000958380.1|1290771_1291335_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1291331_1292993_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_001063099.1|1295038_1295260_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|1297786_1298113_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007890.1|1298123_1298474_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000573391.1|1298470_1298917_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133391.1|1298913_1299258_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|1299324_1300041_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710954.1|1300055_1300430_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	8.6e-64
WP_122993730.1|1300525_1300735_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212999.1|1300785_1304028_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.4	0.0e+00
WP_000807944.1|1304020_1304362_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001357740.1|1304361_1305060_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194767.1|1305070_1305814_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_122994371.1|1305759_1306392_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_000514665.1|1306630_1310104_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.2	0.0e+00
1307756:1307770	attL	GTGGTGGTGGATGAT	NA	NA	NA	NA
WP_024199595.1|1310171_1310771_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	3.1e-108
WP_000279061.1|1310835_1312149_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.7e-77
WP_001023420.1|1312150_1312420_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|1312526_1312616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1312635_1314984_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_024199596.1|1315575_1318977_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	2.3e-219
WP_000938111.1|1319353_1320715_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000799400.1|1321077_1321941_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1321924_1323061_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359439.1|1323310_1324540_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1324685_1325807_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085268.1|1326055_1327285_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	2.1e-130
WP_000953272.1|1327640_1327829_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|1327886_1328915_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336166.1|1328904_1329369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204981.1|1329361_1329595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|1329600_1329900_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|1329896_1331297_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
1331043:1331057	attR	GTGGTGGTGGATGAT	NA	NA	NA	NA
WP_000192401.1|1331497_1331749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1331745_1332156_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1332166_1332439_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1332565_1332790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796962.1|1333041_1333248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1333247_1334303_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1334315_1334651_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1334663_1335077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816762.1|1335282_1335825_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	43.6	1.5e-32
WP_000133424.1|1336080_1336362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735406.1|1336963_1338424_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1338423_1339095_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1339262_1340633_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1340636_1341278_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1341313_1342420_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	1445682	1505240	5449314	portal,terminase,tail,holin,lysis,integrase,protease	Escherichia_phage(35.29%)	70	1445519:1445546	1491435:1491462
1445519:1445546	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1445682_1446813_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1446790_1447039_-	excisionase	NA	NA	NA	NA	NA
WP_000102133.1|1447103_1449548_-	exonuclease	NA	V5UQJ3	Shigella_phage	59.1	4.0e-178
WP_000199474.1|1449640_1449832_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1449828_1450017_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000379610.1|1450504_1450657_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001003379.1|1450846_1451254_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1451331_1451559_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|1451542_1452094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020532.1|1452065_1453106_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|1453017_1453560_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000450846.1|1453593_1454364_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_001118156.1|1454379_1454760_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000403785.1|1454832_1455189_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224661.1|1455284_1455458_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000789359.1|1455717_1456434_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_000373318.1|1456417_1457212_-	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000967408.1|1457565_1457778_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_077625879.1|1457994_1458255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032156506.1|1458324_1458603_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_001265167.1|1458604_1459654_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_000904137.1|1459666_1460041_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762909.1|1460037_1460859_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.5e-81
WP_000917735.1|1461085_1461283_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000935552.1|1461433_1462492_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	1.5e-206
WP_000142956.1|1462995_1464942_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000143462.1|1465077_1465257_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|1465297_1465543_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|1465620_1465836_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087729.1|1465840_1466374_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_000539782.1|1467218_1467365_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	97.9	9.8e-16
WP_001082574.1|1467372_1467840_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000373407.1|1468253_1468730_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077608.1|1468726_1470850_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1470846_1471059_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974567.1|1471058_1472561_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_001365078.1|1472550_1474530_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|1474617_1474944_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1474936_1475218_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1475220_1475844_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1475856_1476255_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1476262_1477015_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479059.1|1477028_1477451_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000532075.1|1477477_1477786_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000918272.1|1477829_1480475_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.6	0.0e+00
WP_000847298.1|1480471_1480801_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303033.1|1480800_1481499_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	7.6e-130
WP_001303030.1|1481509_1482253_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.3e-148
WP_077775224.1|1482198_1482828_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_000514951.1|1483068_1486545_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.8	0.0e+00
WP_001230517.1|1486611_1487211_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_000268983.1|1487275_1488589_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	8.5e-82
WP_001023406.1|1488590_1488860_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_032243391.1|1489990_1490575_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1490952_1491123_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079494.1|1491612_1492119_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1491435:1491462	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1492164_1492665_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1492750_1492930_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1493310_1494117_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209519.1|1494116_1495310_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983908.1|1495321_1496683_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1496683_1498279_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194591.1|1498278_1499841_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1499932_1499977_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1500114_1500996_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1500992_1501613_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1501713_1502586_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1502625_1503216_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1503212_1503971_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1504190_1505240_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	1785782	1817821	5449314	transposase,holin	Escherichia_phage(36.0%)	39	NA	NA
WP_001120551.1|1785782_1786025_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_012816773.1|1787496_1788387_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	96.8	6.2e-153
WP_000391471.1|1788986_1789157_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	96.4	1.5e-23
WP_162829241.1|1789219_1790433_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000284491.1|1791015_1791231_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	2.0e-33
WP_001289716.1|1791306_1791576_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	76.4	1.6e-08
WP_001213059.1|1791613_1791796_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023165.1|1791943_1793881_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.6	2.1e-291
WP_000762928.1|1794958_1795780_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217405.1|1795776_1796151_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	3.9e-32
WP_001265267.1|1796163_1797213_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.9e-108
WP_012816774.1|1797214_1797493_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001299354.1|1797559_1797820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1798040_1798253_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001815900.1|1798534_1799293_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001443694.1|1799991_1800156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368628.1|1800152_1800899_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.9	7.6e-112
WP_157904138.1|1800931_1801474_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.7e-84
WP_000020574.1|1801385_1802426_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705373.1|1802397_1802949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912290.1|1802932_1803160_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787426.1|1803236_1803644_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	8.3e-28
WP_000379598.1|1803845_1804001_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_001368621.1|1804160_1804400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399959.1|1804515_1804860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1805512_1805701_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001369006.1|1805697_1805886_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000990639.1|1805978_1808396_+	exonuclease	NA	V5UQJ3	Shigella_phage	59.8	4.4e-177
WP_000005551.1|1808467_1808719_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001369004.1|1808738_1810034_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|1810053_1810164_-	transporter	NA	NA	NA	NA	NA
WP_000836067.1|1810221_1811241_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1811252_1812467_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1812672_1812999_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1813133_1813475_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1813509_1814070_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001443598.1|1814072_1814783_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1814890_1815196_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041691.1|1815394_1817821_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	2.0e-214
>prophage 6
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	1951259	1998998	5449314	plate,portal,terminase,tail,holin,tRNA,head,capsid,integrase	Enterobacteria_phage(75.51%)	61	1953662:1953686	1991639:1991663
WP_000029479.1|1951259_1952009_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|1952008_1952560_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|1952622_1953603_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1953662:1953686	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|1953795_1954233_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403441.1|1954333_1954834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247214.1|1954836_1955775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	1.1e-80
WP_000094528.1|1955863_1956175_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	1.2e-21
WP_000163908.1|1956266_1956545_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917798.1|1956559_1956898_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	6.0e-48
WP_000159450.1|1956908_1957196_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	6.0e-33
WP_000514277.1|1957207_1957450_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|1957446_1957560_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000543042.1|1957653_1958064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985163.1|1958087_1958291_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_000153699.1|1958287_1958554_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	6.8e-31
WP_001143720.1|1958619_1959087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157911232.1|1959042_1959780_+	ash family protein	NA	S5MQL6	Escherichia_phage	36.8	4.9e-10
WP_000599384.1|1959776_1960142_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123483.1|1960148_1962971_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_000686521.1|1963047_1964007_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
WP_000211262.1|1964011_1964323_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	8.5e-49
WP_001289906.1|1964386_1964911_+	ead/Ea22-like family protein	NA	A0A2I6TCG8	Escherichia_phage	59.5	2.6e-05
WP_000087812.1|1965401_1966448_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613755.1|1966447_1968199_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_001262673.1|1968353_1969190_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|1969213_1970266_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|1970311_1971112_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|1971214_1971709_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864909.1|1971708_1971909_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	97.0	3.9e-31
WP_000104350.1|1971911_1972235_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1972231_1972624_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|1972620_1973028_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|1973165_1973633_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|1973625_1974261_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001345538.1|1974272_1974839_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	1.7e-100
WP_001067548.1|1974856_1975186_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111942.1|1975189_1976086_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071720.1|1976078_1976609_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108527.1|1976611_1978714_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	62.5	1.7e-212
WP_000972162.1|1978716_1979250_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	7.1e-96
WP_000972109.1|1979278_1979806_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	90.9	6.0e-87
WP_012816778.1|1979807_1980941_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	62.3	8.1e-65
WP_000905055.1|1981126_1981726_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.8	1.2e-96
WP_000979954.1|1981752_1982241_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853436.1|1982253_1985061_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.1	0.0e+00
WP_000333495.1|1985047_1985203_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|1985211_1985577_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1985631_1986144_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005435.1|1986143_1987328_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	4.0e-224
WP_000567532.1|1987484_1988594_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	92.4	2.7e-190
WP_000146939.1|1988945_1990529_+	DUF262 domain-containing protein	NA	E5E3X3	Burkholderia_phage	54.9	8.5e-161
WP_000488107.1|1990786_1991047_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1991237_1991378_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1991680_1991980_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1991639:1991663	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672369.1|1991984_1994372_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1994386_1995370_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1995653_1995698_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1995820_1996177_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1996229_1996427_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1996523_1997066_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1997069_1998998_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 7
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	2100885	2196452	5449314	portal,tail,terminase,transposase,holin,tRNA,head,capsid,lysis,protease	Enterobacteria_phage(48.48%)	108	NA	NA
WP_000984517.1|2100885_2101767_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|2101958_2104007_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2104026_2104725_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2104821_2105319_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2105448_2106732_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2106700_2109334_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2109413_2110853_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2110970_2111207_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2111311_2111503_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812707.1|2111503_2112160_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|2112555_2112897_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2112909_2113782_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204700.1|2113785_2114160_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2114298_2114529_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2114630_2115287_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2115310_2115973_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936935.1|2115969_2118030_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2118238_2118898_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000745667.1|2119272_2119581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257738.1|2119647_2119938_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173511.1|2120071_2121250_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2121305_2121947_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2121983_2123795_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301729.1|2124029_2125505_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001056706.1|2125842_2126712_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2126839_2128282_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2128412_2129384_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2129503_2130826_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2130841_2131774_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2131852_2132608_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|2132604_2133390_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2133536_2134547_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2134555_2135167_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2135305_2135371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295503.1|2136045_2136567_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2136601_2137342_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|2137370_2137823_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2137940_2139713_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2140022_2140589_+	hydrolase	NA	NA	NA	NA	NA
WP_001217551.1|2140942_2141191_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_099561169.1|2141327_2141450_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001132098.1|2141436_2142027_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144084.1|2142210_2142861_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001434995.1|2142939_2143998_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2144125_2144761_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001101700.1|2145522_2145792_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_000268984.1|2145793_2147107_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	1.4e-81
WP_001230526.1|2147171_2147771_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	3.1e-108
WP_000515514.1|2147837_2151317_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_071790928.1|2151377_2152010_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_000140735.1|2151946_2152690_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_001152532.1|2152694_2153393_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|2153392_2153722_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_000082504.1|2153718_2156280_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.6	0.0e+00
WP_000533415.1|2156260_2156674_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000479108.1|2156700_2157132_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143023.1|2157145_2157898_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	96.4	3.7e-130
WP_000683079.1|2157905_2158301_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974986.1|2158297_2158831_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_001204554.1|2158846_2159200_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2159192_2159576_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522593.1|2159627_2160656_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.0e-111
WP_000256824.1|2160713_2161061_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_001253979.1|2161097_2162603_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000831776.1|2162592_2164185_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_000259002.1|2164181_2164388_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_024182572.1|2164371_2166300_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_001429103.1|2166271_2166778_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_032164595.1|2167205_2167391_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.3	6.4e-20
WP_000347012.1|2167530_2167668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000736383.1|2168024_2168249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816783.1|2168245_2168740_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.9e-74
WP_032140280.1|2168741_2168828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092850.1|2169382_2169916_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_000731216.1|2169958_2170948_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.7	1.2e-107
WP_000411813.1|2170952_2171159_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000466957.1|2173779_2174211_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000185911.1|2174669_2175728_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.6	1.2e-190
WP_001382053.1|2175878_2176076_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.4	2.3e-28
WP_000640037.1|2176298_2176853_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
WP_001215507.1|2176861_2177221_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
WP_001064806.1|2177220_2177478_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.2e-34
WP_000184331.1|2177474_2178875_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
WP_000181080.1|2178871_2179762_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
WP_001247847.1|2179779_2180673_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
WP_000621936.1|2180659_2180893_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
WP_000626792.1|2180889_2181084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587263.1|2181080_2181743_-	ash family protein	NA	Q8W643	Enterobacteria_phage	83.2	4.2e-98
WP_001435006.1|2181851_2182559_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	97.4	1.3e-124
WP_000867909.1|2182678_2182972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399865.1|2183042_2183315_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
WP_000800135.1|2183448_2184138_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
WP_012816784.1|2184282_2184975_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
WP_000147365.1|2184980_2185181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312938.1|2185380_2185740_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
WP_169301903.1|2185828_2187042_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	3.5e-167
WP_000566773.1|2187454_2187847_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_001091865.1|2188464_2188749_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	96.2	7.3e-39
WP_169301903.1|2188754_2189967_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	3.5e-167
WP_000492057.1|2190180_2190423_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001030139.1|2190426_2190573_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000073102.1|2190581_2190818_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_000362001.1|2190873_2192187_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_042353505.1|2192168_2192900_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.4e-72
WP_162860178.1|2192902_2194116_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_000252979.1|2194304_2194700_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2194740_2195484_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|2195480_2196452_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 8
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	2285092	2434590	5449314	portal,tail,terminase,transposase,holin,head,capsid,integrase,protease	Escherichia_phage(35.22%)	191	2373141:2373200	2422607:2422691
WP_095111390.1|2285092_2285224_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|2285570_2286551_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001023997.1|2286727_2286997_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	95.5	6.0e-43
WP_000279044.1|2286998_2288312_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	9.1e-76
WP_001435161.1|2288376_2289000_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.9e-68
WP_000515001.1|2289068_2292545_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|2292678_2293206_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_123006569.1|2293396_2294029_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	2.0e-105
WP_012816788.1|2293974_2294718_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.6e-148
WP_001357740.1|2294723_2295422_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2295421_2295751_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082502.1|2295747_2298327_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000533415.1|2298307_2298721_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000479070.1|2298747_2299179_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.4e-41
WP_000106786.1|2299192_2299945_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000683066.1|2299952_2300348_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975041.1|2300344_2300878_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_001204554.1|2300892_2301246_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201523.1|2301238_2301613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2301664_2302693_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2302750_2303098_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253957.1|2303134_2304640_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.5	1.2e-100
WP_000831765.1|2304629_2306222_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259008.1|2306218_2306425_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_012816790.1|2306408_2308337_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000235436.1|2308308_2308818_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2309212_2309437_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2309518_2309833_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2310359_2310545_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280929.1|2310772_2310904_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2310916_2311099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003127.1|2311254_2311788_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	94.4	1.5e-98
WP_000138558.1|2311947_2312220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|2312475_2312691_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000874348.1|2313130_2314981_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_101898425.1|2315748_2316462_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2316596_2316794_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000265267.1|2317080_2317899_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2318050_2318422_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2318411_2318783_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|2318795_2319845_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|2319846_2320125_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813254.1|2320291_2320447_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000955173.1|2320548_2320686_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|2321051_2321825_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2322176_2322590_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|2322605_2323376_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788749.1|2323457_2324144_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	9.8e-106
WP_001205820.1|2324150_2325266_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000693855.1|2326006_2326432_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2326415_2326688_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2326796_2327198_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2327225_2327417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2327416_2327704_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|2327980_2328136_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|2328277_2328667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|2328853_2329039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2329612_2329801_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2329797_2329989_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034468.1|2330082_2332554_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_000273151.1|2332621_2332864_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2332841_2333861_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000938124.1|2334672_2336034_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2336488_2336758_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381372.1|2336795_2338367_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|2338386_2338734_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2338733_2339411_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000279062.1|2339466_2340780_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_024199595.1|2340844_2341444_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	3.1e-108
WP_000514665.1|2341511_2344985_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.2	0.0e+00
WP_122994371.1|2345223_2345856_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_000194767.1|2345801_2346545_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_001357740.1|2346555_2347254_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|2347253_2347595_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_000212999.1|2347587_2350830_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.4	0.0e+00
WP_122993099.1|2350877_2351087_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|2351182_2351557_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2351562_2352279_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133391.1|2352337_2352682_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2352678_2353125_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007890.1|2353121_2353472_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000125984.1|2353482_2353809_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|2356335_2356557_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001399867.1|2358602_2360264_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|2360260_2360824_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_012816793.1|2361113_2361479_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	1.5e-65
WP_001448509.1|2361520_2361745_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2361826_2362141_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2362666_2362852_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2363079_2363229_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056891.1|2363228_2363798_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	9.9e-104
WP_000087705.1|2364072_2364606_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	98.9	1.5e-101
WP_001072901.1|2364610_2364826_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2364903_2365149_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2365189_2365369_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|2365504_2367442_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2367919_2368351_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2368800_2369514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2369648_2369846_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|2370087_2370618_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2370626_2370986_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265043.1|2370998_2372045_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.9e-109
WP_001342259.1|2372046_2372319_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2372454_2372712_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2372717_2373017_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
2373141:2373200	attL	TTTATCCCCAGCGGCAAATCGAATACACCACCAGCGCCACCGCCATCGCAATTCCTACCG	NA	NA	NA	NA
WP_000350274.1|2373221_2373455_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_001229296.1|2373562_2373928_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2373929_2374148_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2374235_2374871_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000753069.1|2374867_2375044_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
WP_001224662.1|2375036_2375219_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2375252_2375465_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2375515_2375872_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2375849_2376311_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2376307_2376604_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|2376600_2376993_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_072096947.1|2377767_2378310_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|2378221_2379232_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|2379318_2379756_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2379752_2380013_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2380139_2380532_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2380578_2380938_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2380940_2381243_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_012817750.1|2381578_2381878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2381949_2382168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2382171_2382336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2382736_2382925_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2382921_2383110_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048493.1|2383204_2385655_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2385722_2385965_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2385942_2386962_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001443410.1|2387266_2387650_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_012816795.1|2388095_2388848_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001023420.1|2388974_2389244_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000279061.1|2389245_2390559_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.7e-77
WP_001230425.1|2390623_2391223_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_000515000.1|2391289_2394766_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|2394899_2395427_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_123006569.1|2395617_2396250_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	2.0e-105
WP_012816788.1|2396195_2396939_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	8.6e-148
WP_001357740.1|2396944_2397643_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2397642_2397972_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082502.1|2397968_2400548_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000533415.1|2400528_2400942_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	6.0e-42
WP_000479070.1|2400968_2401400_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.4e-41
WP_000106786.1|2401413_2402166_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	4.6e-133
WP_000683066.1|2402173_2402569_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975041.1|2402565_2403099_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.3e-57
WP_001204554.1|2403113_2403467_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201523.1|2403459_2403834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2403885_2404914_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2404971_2405319_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253957.1|2405355_2406861_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.5	1.2e-100
WP_000831765.1|2406850_2408443_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259008.1|2408439_2408646_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	1.8e-10
WP_012816790.1|2408629_2410558_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	5.5e-263
WP_000235436.1|2410529_2411039_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2411433_2411658_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2411739_2412054_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2412580_2412766_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280929.1|2412993_2413125_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2413137_2413320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992157.1|2413475_2414009_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_000731192.1|2414059_2414404_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_024165672.1|2414408_2414624_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001368722.1|2417243_2417675_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2418125_2418839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2418974_2419172_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2419397_2419952_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|2419960_2420320_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265228.1|2420332_2421382_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000191872.1|2421383_2421656_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2421777_2422122_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2422241_2422454_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2422687_2423245_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
2422607:2422691	attR	TTTATCCCCAGCGGCAAATCGAATACACCACCAGCGCCACCGCCATCGCAATTCCTACCGTTGTGAATGCTTCAGGCCAGGTCAT	NA	NA	NA	NA
WP_000683608.1|2423246_2423465_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	56.9	1.2e-14
WP_000034815.1|2423592_2423904_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2423896_2424124_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|2424120_2424402_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|2424434_2425151_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2425172_2425919_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262348.1|2425925_2427008_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2427079_2427505_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2427488_2427731_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_024173647.1|2428122_2428461_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	1.5e-06
WP_001345283.1|2428753_2428906_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_162829241.1|2429071_2430285_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001133037.1|2430869_2431079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2431649_2431838_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2431834_2432026_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048406.1|2432118_2434590_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.7e-59
>prophage 9
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	2619825	2629267	5449314		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2619825_2620962_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001298843.1|2620958_2622959_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2623083_2623545_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2623585_2624056_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2624102_2624822_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2624818_2626504_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240402.1|2626725_2627457_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2627516_2627624_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2627604_2628336_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569314.1|2628340_2629267_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	2828860	2924123	5449314	bacteriocin,portal,tail,transposase,terminase,holin,tRNA,capsid,integrase	Escherichia_phage(60.81%)	104	2861707:2861730	2924319:2924342
WP_001283581.1|2828860_2829673_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2829672_2830686_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2830751_2831888_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2831986_2832982_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2832978_2834157_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2834440_2835661_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|2835819_2837826_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399621.1|2837996_2838977_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000559764.1|2839224_2839503_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2839536_2840085_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2840084_2840894_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043812.1|2840893_2841718_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2841721_2842807_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001298774.1|2842841_2843774_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2843939_2844491_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2844612_2845485_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2845471_2845996_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2845992_2846463_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2846459_2847008_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2846982_2847735_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|2847754_2850397_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2850478_2851042_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2851725_2852211_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425058.1|2852413_2854558_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531908.1|2854557_2855868_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2856047_2856332_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2856703_2858044_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937837.1|2858409_2859468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2859649_2860405_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2860698_2861631_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2861707:2861730	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000331701.1|2861852_2870207_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.9	0.0e+00
WP_000012437.1|2870276_2871542_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|2871552_2871804_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|2871814_2872261_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|2872263_2872917_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|2873010_2873412_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000078907.1|2873468_2873609_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000836187.1|2873841_2874579_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_001459282.1|2874658_2875276_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000455633.1|2875281_2875560_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000197188.1|2875574_2876843_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_001146321.1|2876839_2878465_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_001303606.1|2878759_2878948_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001023407.1|2879086_2879356_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_012816803.1|2879357_2881295_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_000207922.1|2881291_2881942_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|2881941_2882505_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001371266.1|2882488_2882950_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_001140444.1|2882999_2883389_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|2883443_2884658_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345011.1|2884681_2885689_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000787035.1|2885846_2887991_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_000143988.1|2887990_2889697_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086067.1|2889677_2890472_-	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
WP_001108577.1|2890764_2891316_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_012816804.1|2891554_2891740_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000539792.1|2891967_2892114_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2892113_2892683_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087702.1|2892953_2893487_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.2	1.6e-100
WP_000284506.1|2893491_2893707_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|2893783_2894056_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000142777.1|2894096_2894276_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_000874485.1|2894412_2896350_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000738068.1|2896847_2897117_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2897128_2898088_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204859.1|2898871_2899306_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2899298_2899493_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2899489_2900053_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2900060_2900510_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001193567.1|2900509_2901481_-	toprim domain-containing protein	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|2901470_2902991_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|2902984_2903362_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|2903528_2903723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171145.1|2903885_2904125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000162431.1|2904230_2904950_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
WP_000939555.1|2905045_2906515_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
WP_001064736.1|2906511_2907465_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	97.5	1.1e-182
WP_000331648.1|2907645_2908116_+	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
WP_001292087.1|2908115_2908496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706115.1|2909113_2909899_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.0e-139
WP_000917252.1|2909969_2910182_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934196.1|2910193_2910475_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	3.0e-45
WP_000995345.1|2910495_2910777_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|2910793_2911744_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|2911740_2912430_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344636.1|2912429_2913017_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_001071603.1|2913091_2913439_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2913502_2914324_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159714.1|2914400_2914844_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	99.3	1.9e-78
WP_001453790.1|2914951_2915830_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|2915826_2916030_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|2916022_2916262_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000036158.1|2916258_2916960_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_000628769.1|2917473_2918427_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	55.0	2.0e-80
WP_000969523.1|2918423_2918684_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
WP_000609351.1|2918768_2919512_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	99.1	2.8e-122
WP_000203819.1|2919835_2920123_+	phage antirepressor Ant	NA	V5URG2	Shigella_phage	97.9	3.9e-48
WP_000211520.1|2920372_2921002_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|2921057_2921489_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|2921485_2922112_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|2922071_2922284_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994795.1|2922319_2922709_+	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_000453637.1|2922787_2922970_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218304.1|2922953_2924123_-|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	99.7	3.7e-230
2924319:2924342	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 11
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	3105425	3186672	5449314	plate,tail,transposase,terminase,holin,tRNA,integrase	Salmonella_phage(41.18%)	82	NA	NA
WP_000940019.1|3105425_3106166_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|3106284_3107088_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001299515.1|3107232_3108087_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983009.1|3108277_3109558_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244193.1|3109549_3110689_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423256.1|3110848_3111739_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000211172.1|3111874_3113236_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_162829241.1|3113594_3114808_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001080103.1|3115063_3115384_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001281377.1|3115380_3116193_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_000660797.1|3116202_3117405_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_000158546.1|3117971_3118844_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700809.1|3118855_3119950_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276691.1|3119982_3120981_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493478.1|3121005_3122517_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
WP_001124894.1|3122539_3123523_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001342899.1|3123619_3126901_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001298982.1|3127018_3128212_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|3128275_3129529_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883124.1|3129856_3131047_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3131091_3131430_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|3131490_3132825_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3132814_3133528_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298980.1|3133692_3135120_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970125.1|3135694_3139582_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
WP_000734212.1|3139839_3141396_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298981.1|3141392_3141929_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|3141953_3142589_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013780.1|3142797_3143646_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288820.1|3144285_3144933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001342905.1|3145594_3145996_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.7	5.9e-10
WP_000376434.1|3145999_3146419_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.7	4.2e-35
WP_001030532.1|3146390_3146993_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	4.6e-99
WP_001096973.1|3146992_3147838_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	1.1e-47
WP_000049950.1|3147837_3148518_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197085.1|3148514_3149714_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_001270633.1|3149713_3150067_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001007933.1|3150066_3150819_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	5.9e-88
WP_000213605.1|3150881_3151052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044737.1|3151055_3151610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832849.1|3151617_3151965_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_000081745.1|3151967_3153032_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.0e-154
WP_001007341.1|3153034_3153337_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	8.2e-49
WP_001300247.1|3153336_3153924_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	2.6e-83
WP_000990884.1|3153923_3155912_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_000393954.1|3156089_3156542_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|3156545_3156986_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046933.1|3156996_3158142_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	6.1e-161
WP_012816811.1|3158145_3158709_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.0e-80
WP_001142484.1|3158683_3159073_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_000008726.1|3159059_3159614_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	2.5e-67
WP_000042170.1|3159610_3160018_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	4.3e-69
WP_001040697.1|3159983_3160352_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	1.4e-53
WP_000627490.1|3160392_3161334_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001066733.1|3161345_3161852_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000873185.1|3161855_3163076_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.3	1.1e-200
WP_000113491.1|3163716_3165183_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	3.9e-261
WP_001130793.1|3165182_3166805_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|3166807_3167380_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|3167441_3167966_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|3167949_3168426_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|3168429_3168771_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174014.1|3169216_3169558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|3169589_3170012_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001520086.1|3170300_3172487_-	replication protein	NA	B6SD37	Bacteriophage	72.4	2.4e-174
WP_000016209.1|3172490_3172691_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_000567466.1|3172832_3173507_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_001288046.1|3173925_3174450_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	47.5	1.4e-35
WP_000801965.1|3174674_3174824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051355.1|3174820_3175723_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113516.1|3175725_3177027_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	4.0e-132
WP_000769005.1|3177042_3177591_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_000551021.1|3177643_3178273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065469.1|3178319_3180383_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000008820.1|3180388_3180604_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637723.1|3180600_3180900_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	4.2e-29
WP_000312945.1|3180889_3181183_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	6.6e-27
WP_001213770.1|3181155_3182169_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	52.5	2.2e-101
WP_001288450.1|3182171_3183101_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	38.1	2.5e-48
WP_001135919.1|3183211_3184606_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.4	3.2e-212
WP_001138330.1|3184799_3186197_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|3186411_3186672_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
>prophage 12
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	3321237	3328377	5449314		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3321237_3323799_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141330.1|3323904_3324561_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3324611_3325379_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847994.1|3325574_3326483_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590407.1|3326479_3327742_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_001278994.1|3327738_3328377_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 13
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	3841878	3891067	5449314	integrase,transposase,protease	Stx2-converting_phage(20.0%)	41	3841094:3841108	3893430:3893444
3841094:3841108	attL	CCTGCTGCGAACCGG	NA	NA	NA	NA
WP_015740423.1|3841878_3843075_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000301248.1|3843184_3843760_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3843828_3844407_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3844455_3845496_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3845518_3845974_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3845996_3847154_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3847153_3847735_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3848057_3849116_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3849125_3850268_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3850260_3851034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182419.1|3851035_3852115_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.2	3.6e-38
WP_000797372.1|3852114_3853071_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3853081_3854290_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3854307_3854775_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3855035_3855365_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|3855351_3855732_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000355324.1|3855774_3857316_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.6	1.5e-77
WP_001435098.1|3857329_3857473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|3860387_3860528_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|3860829_3861093_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|3863088_3863448_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|3863540_3865160_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|3865384_3865660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424145.1|3866830_3867133_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|3867141_3867462_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065689.1|3867454_3869158_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|3869167_3869632_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|3869632_3870307_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|3870318_3870936_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034023.1|3873590_3877682_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_001171554.1|3878156_3878537_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3878533_3878881_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|3878930_3880469_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|3880535_3880724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233443.1|3880741_3883102_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000282106.1|3883256_3883820_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335713.1|3884832_3886266_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000270115.1|3886361_3886589_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000248065.1|3887318_3888932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268401.1|3889024_3889621_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_000290297.1|3889750_3891067_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
3893430:3893444	attR	CCTGCTGCGAACCGG	NA	NA	NA	NA
>prophage 14
NC_013353	Escherichia coli O103:H2 str. 12009, complete genome	5449314	5357295	5421027	5449314	transposase,terminase,tail,capsid,head,integrase,protease	Stx2-converting_phage(34.78%)	77	5352318:5352333	5426816:5426831
5352318:5352333	attL	GTAAGAGCGCCAGCAG	NA	NA	NA	NA
WP_162860177.1|5357295_5358508_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.3	9.3e-168
WP_001299345.1|5358697_5359375_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331555.1|5359412_5360201_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001382695.1|5360341_5360578_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272345.1|5361206_5362238_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204018.1|5362340_5362754_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092465.1|5362722_5363169_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870700.1|5363183_5363861_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218295.1|5364245_5365469_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	6.4e-233
WP_001400035.1|5367992_5368811_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_001289923.1|5369324_5370095_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_000763383.1|5370091_5370313_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447688.1|5370411_5370693_-	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000548528.1|5370703_5370895_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|5370867_5371050_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186781.1|5371046_5371727_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000100847.1|5371723_5372509_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|5372514_5372811_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|5372886_5373030_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|5373022_5373163_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000167584.1|5373354_5373825_-	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	1.1e-87
WP_000198444.1|5373883_5374267_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745483.1|5374755_5374920_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|5374922_5375969_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|5375962_5376424_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885202.1|5376491_5376833_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_000250473.1|5376893_5377601_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|5377679_5377907_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|5378045_5378342_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|5378374_5379313_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788929.1|5379309_5380011_+	hypothetical protein	NA	K7P6G2	Enterobacteria_phage	98.7	1.9e-128
WP_000145894.1|5380007_5380298_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_169301903.1|5380474_5381688_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	3.5e-167
WP_000638119.1|5381771_5381960_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	98.4	2.6e-29
WP_000103680.1|5382091_5382307_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001229012.1|5382480_5382897_+	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000153293.1|5383488_5384016_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_001254258.1|5384012_5384207_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000235318.1|5384472_5385177_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	90.6	3.2e-120
WP_001004018.1|5385251_5385974_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|5385973_5386579_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|5386575_5386770_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|5386762_5387197_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|5387703_5388651_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|5388660_5388930_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_162860178.1|5389870_5391083_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_000992166.1|5391236_5391770_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_001056806.1|5392040_5392610_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|5392609_5392756_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|5392983_5393169_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|5393593_5393821_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279817.1|5393862_5394228_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	99.2	4.4e-65
WP_000958390.1|5394517_5395081_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_015740446.1|5395077_5396739_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000173093.1|5396802_5398740_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.8	0.0e+00
WP_001063096.1|5398784_5399006_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|5401532_5401859_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|5401868_5402219_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5402215_5402662_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133391.1|5402658_5403003_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275510.1|5403061_5403778_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|5403783_5404158_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_122993099.1|5404253_5404463_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_000212955.1|5404510_5407753_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.9	0.0e+00
WP_000807944.1|5407745_5408087_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_001357740.1|5408086_5408785_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194767.1|5408795_5409539_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_122994371.1|5409484_5410117_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_000514664.1|5410355_5413832_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_001230514.1|5413898_5414498_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_015740448.1|5414562_5415876_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.7e-80
WP_001101699.1|5415877_5416147_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001121225.1|5416431_5417082_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217548.1|5417674_5417935_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_000202566.1|5418154_5419741_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|5420133_5420739_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5420865_5421027_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
5426816:5426831	attR	GTAAGAGCGCCAGCAG	NA	NA	NA	NA
