The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	327707	338389	5371077	transposase	Streptococcus_phage(25.0%)	10	NA	NA
WP_001285288.1|327707_328811_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893251.1|328822_330076_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_162829202.1|331296_332510_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000692308.1|333402_333624_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186787.1|333692_334169_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214420.1|334184_334670_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001234405.1|334761_335580_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
WP_000480477.1|335669_336608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000642924.1|336673_337084_-	hypothetical protein	NA	G5DES5	Salmonella_phage	41.9	2.1e-26
WP_162829202.1|337175_338389_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 2
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	551083	630975	5371077	tRNA,protease,tail,head,capsid,transposase	Escherichia_phage(33.33%)	70	NA	NA
WP_000186631.1|551083_551563_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365177.1|551766_552561_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_001342071.1|552698_553040_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|553153_555658_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_000883048.1|555919_556852_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|556854_558147_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|558271_558679_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|558679_559138_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|559134_560052_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157532.1|560197_560875_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001345010.1|560861_561644_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|561706_562561_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|562621_563431_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|563420_564044_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|564014_564701_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561841.1|564697_567112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001320180.1|571733_571994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|572050_572224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|573225_574320_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|574388_575315_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|575544_576027_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|576104_576920_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001342079.1|577009_578791_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000943558.1|578803_579580_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|579679_580558_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|580726_582181_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|582240_583602_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|583658_584960_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001315307.1|584981_586127_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540946.1|586255_587041_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001301144.1|587051_588287_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703909.1|588308_589358_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|589674_591342_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|591351_592611_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152513.1|592621_593437_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855355.1|593433_594327_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815554.1|594463_595531_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|595527_596037_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|596154_596877_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|596879_597374_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|597547_598933_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|598968_599490_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|599597_599810_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|599811_600678_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|601158_601701_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|601920_602613_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001345007.1|602643_605253_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|606304_606820_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|606822_607455_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001277425.1|608083_608656_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.4	6.3e-90
WP_001345004.1|608665_608998_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063245.1|609053_610079_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158868.1|610120_610516_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752958.1|610527_610827_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_085947772.1|610847_612060_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000985133.1|612153_612732_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683103.1|612728_613124_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_012817849.1|613131_613872_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	2.3e-129
WP_000479169.1|613887_614310_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|614291_614726_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840226.1|614718_616899_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_162829202.1|616904_618117_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000239881.1|618187_618856_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226384.1|619401_620886_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201824.1|621072_622026_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177454.1|622538_623300_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224569.1|623482_624373_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001345000.1|624373_627346_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383942.1|627332_629570_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|629838_630975_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	850510	884580	5371077	holin,tail,integrase,head,capsid,transposase	Enterobacteria_phage(56.76%)	42	845103:845119	876894:876910
845103:845119	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000263438.1|850510_851587_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
WP_162829202.1|851994_853208_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000075117.1|853213_853411_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_085948261.1|853410_853626_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000023272.1|854064_855915_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|856213_856372_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|856457_857201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|857385_858075_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032178163.1|858089_858212_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|858551_859511_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|859722_859911_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008192.1|859907_860270_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000002251.1|860266_860557_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001286917.1|860549_860762_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950962.1|860754_860931_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_000386661.1|860930_861290_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_001254255.1|861292_861469_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814614.1|861465_861876_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_000344554.1|861847_862210_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000818841.1|862227_862434_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000145948.1|862506_862797_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001254039.1|864723_866229_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256792.1|866265_866613_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|866670_867699_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|867750_868125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|868117_868471_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|868485_869061_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|869057_869453_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143011.1|869460_870213_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000479083.1|870226_870658_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533403.1|870684_871098_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082363.1|871078_873658_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000847298.1|873654_873984_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000194798.1|874691_875435_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|875380_876010_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514984.1|876250_879727_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
876894:876910	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230465.1|879794_880394_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000268900.1|880458_881772_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001023459.1|881773_882043_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|882148_883030_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_044722167.1|883299_884085_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.1	6.5e-146
WP_021351651.1|884208_884580_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
>prophage 4
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1105695	1148254	5371077	transposase,holin,protease	Escherichia_phage(37.04%)	55	NA	NA
WP_000156529.1|1105695_1107456_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1107641_1108094_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1108169_1109210_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1109566_1110076_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001444487.1|1110348_1110924_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1110886_1113049_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1113058_1113505_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001297106.1|1113627_1115682_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1115713_1116172_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1116267_1116930_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1117102_1117516_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1117560_1117878_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116302.1|1117935_1119126_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|1119220_1119499_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1119495_1119825_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|1119915_1120575_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000273151.1|1121975_1122218_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000878794.1|1122285_1123326_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	2.1e-59
WP_162829202.1|1123380_1124594_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000048507.1|1124645_1126070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1126162_1126354_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1126350_1126539_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1127070_1127445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1127456_1127609_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1127881_1128598_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1128647_1128863_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1128859_1129285_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1129356_1130427_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151153.1|1130467_1130890_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266135.1|1130886_1131183_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001209481.1|1131179_1131641_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1131618_1131975_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1132025_1132238_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|1132489_1132753_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1132763_1133633_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1133748_1133853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1134041_1134254_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_032280206.1|1134421_1134682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265133.1|1134701_1135751_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1135763_1136135_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1136124_1136496_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1136647_1137466_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1137752_1137950_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|1138087_1138801_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874357.1|1139568_1141419_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024182511.1|1141857_1142073_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000138558.1|1142328_1142601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1142760_1143294_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675929.1|1143514_1143628_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_012816791.1|1143849_1144035_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1144561_1144876_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1144957_1145182_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_162829202.1|1145231_1146445_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_012817858.1|1146531_1147425_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|1147870_1148254_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1183583	1278699	5371077	terminase,holin,tail,integrase,portal,bacteriocin,capsid,transposase,lysis	Escherichia_phage(45.88%)	106	1184852:1184868	1283683:1283699
WP_000013654.1|1183583_1184894_-	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
1184852:1184868	attL	CTCCGTGATTTTCAACG	NA	NA	NA	NA
WP_001208773.1|1184946_1185231_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|1185316_1185616_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000022062.1|1185703_1185985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951710.1|1187091_1187301_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_000797282.1|1187302_1187491_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_001261535.1|1187487_1187664_-	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	96.6	4.5e-23
WP_001033097.1|1187663_1188218_-	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	87.7	1.0e-57
WP_000109677.1|1188219_1188519_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.1e-56
WP_001214466.1|1188515_1188683_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	4.7e-22
WP_001111307.1|1188693_1188987_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	3.2e-50
WP_000951320.1|1189010_1189394_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_000031374.1|1189393_1189999_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	2.1e-107
WP_000050554.1|1190009_1190180_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001183771.1|1190255_1190426_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000167579.1|1190620_1191091_-	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	8.2e-88
WP_000198444.1|1191149_1191533_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745483.1|1192021_1192186_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1192188_1193235_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1193228_1193690_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1193757_1194099_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1194159_1194867_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1194945_1195173_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|1195311_1195608_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|1195640_1196579_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|1196575_1197277_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145931.1|1197273_1197564_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1197634_1197913_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1198045_1198261_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1198271_1198508_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1198464_1198911_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1198907_1199435_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000335902.1|1199616_1200666_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_001004020.1|1200817_1201540_+	phage antirepressor KilAC domain-containing protein	NA	A0A1I9LJQ1	Stx_converting_phage	100.0	7.8e-130
WP_001107963.1|1201539_1202145_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144764.1|1202141_1202336_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|1202328_1202763_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000874503.1|1203984_1205922_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000143458.1|1206056_1206236_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1206276_1206549_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1206625_1206841_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|1206845_1207379_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|1207653_1208223_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1208222_1208372_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1208379_1208844_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1208875_1209169_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1209318_1209522_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086073.1|1209577_1210384_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143984.1|1210364_1212071_+	hypothetical protein	NA	G9L6K0	Escherichia_phage	99.8	0.0e+00
WP_000787036.1|1212070_1214215_+|portal	portal protein	portal	V5URY3	Shigella_phage	100.0	0.0e+00
WP_000345010.1|1214372_1215380_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1215403_1216618_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1216673_1217063_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1217112_1217574_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1217557_1218121_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1218120_1218771_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000117994.1|1218767_1220705_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1220706_1220976_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001358663.1|1221060_1222257_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001303606.1|1222565_1222754_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|1223048_1224674_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|1224670_1225939_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1225953_1226232_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1226237_1226855_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|1226945_1227680_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|1227912_1228053_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1228109_1228511_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509484.1|1228604_1229261_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	99.5	4.1e-109
WP_000455649.1|1229263_1229710_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|1229719_1229971_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1229981_1231247_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331691.1|1231316_1239698_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	99.7	0.0e+00
WP_000756595.1|1240248_1240593_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|1240712_1240925_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|1241158_1241554_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001120841.1|1241553_1241961_-	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_001024844.1|1242438_1242723_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000763353.1|1242719_1242941_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000203825.1|1242988_1243618_-	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_001273658.1|1244576_1244750_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1244832_1246161_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1246181_1246676_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|1246686_1247277_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001345413.1|1247286_1248087_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|1248094_1248481_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|1248492_1249185_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|1249184_1250276_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|1250563_1251202_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001299828.1|1251241_1255204_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|1255258_1255468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|1255626_1257135_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|1257800_1258631_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|1258688_1259816_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199167.1|1259821_1261093_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000533522.1|1261711_1262500_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_000009226.1|1263080_1263767_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|1264390_1265593_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1265779_1267597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1268708_1269005_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1269231_1269429_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335710.1|1269647_1271081_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1271901_1272465_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1272619_1274980_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|1275141_1275318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998045.1|1275736_1277275_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_162829202.1|1277486_1278699_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
1283683:1283699	attR	CGTTGAAAATCACGGAG	NA	NA	NA	NA
>prophage 6
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1436037	1503822	5371077	tRNA,terminase,holin,tail,integrase,head,capsid,transposase	Stx2-converting_phage(37.74%)	72	1431131:1431145	1437612:1437626
1431131:1431145	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|1436037_1437156_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|1437124_1437394_-	excisionase	NA	NA	NA	NA	NA
WP_000048442.1|1437455_1439921_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1437612:1437626	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1440013_1440205_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1440201_1440390_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122993436.1|1440729_1440870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1440873_1441092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447517.1|1441132_1441522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1441817_1442096_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1442097_1442289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|1442309_1442681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444689.1|1442778_1443081_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_000693943.1|1443077_1443503_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|1443525_1444488_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151120.1|1444528_1444951_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000004322.1|1444947_1445202_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|1445194_1445506_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|1445811_1446390_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|1446349_1447447_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_162829202.1|1448081_1449295_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072058819.1|1449332_1449473_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_012817871.1|1449640_1449913_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|1449914_1450970_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|1450970_1451336_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|1451344_1451875_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1452116_1452314_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935544.1|1452464_1453523_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000874287.1|1454319_1456170_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_024164617.1|1456608_1456824_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731236.1|1456828_1457173_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|1457223_1457757_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1458027_1458597_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1458596_1458743_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1458970_1459156_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1459580_1459808_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1459849_1460215_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958415.1|1460505_1461069_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|1461065_1462727_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000172984.1|1462790_1464728_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1464772_1464994_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|1467682_1468009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1468018_1468369_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1468365_1468812_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1468808_1469153_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275472.1|1469219_1469936_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030042.1|1469941_1470316_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_001453698.1|1470411_1470621_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212932.1|1470672_1473915_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
WP_000807928.1|1473907_1474249_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_001447444.1|1474248_1474947_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
WP_001302649.1|1474963_1475284_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1475391_1475565_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_000967279.1|1476612_1477350_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_122996286.1|1477295_1477928_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514853.1|1478164_1481644_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_001230459.1|1481711_1482311_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268887.1|1482375_1483698_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001023356.1|1483699_1483969_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1484075_1484165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1484184_1486533_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_012817873.1|1487123_1490525_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.6e-220
WP_001303921.1|1491499_1491775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938117.1|1491835_1493197_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_000799400.1|1493560_1494424_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1494407_1495544_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1495793_1497023_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1497168_1498290_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1498365_1499826_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1499825_1500497_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1500664_1502035_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1502038_1502680_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1502715_1503822_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1605038	1660600	5371077	terminase,holin,protease,tail,portal,transposase,lysis	Enterobacteria_phage(46.94%)	62	NA	NA
WP_000268365.1|1605038_1605587_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
WP_162829202.1|1607433_1608646_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000075578.1|1608710_1609247_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_072127369.1|1609279_1609561_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_001444682.1|1609557_1609854_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_001209477.1|1609850_1610312_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_000403788.1|1610289_1610646_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000137950.1|1610741_1611113_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000610381.1|1611109_1611463_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000220602.1|1611668_1611968_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_001260976.1|1611973_1612231_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_001447497.1|1612366_1612645_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001344904.1|1612646_1613696_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_000904137.1|1613708_1614083_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762902.1|1614079_1614901_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1615127_1615325_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483498.1|1615475_1616534_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000142980.1|1617128_1619075_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000143458.1|1619212_1619392_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290214.1|1619432_1619678_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_001072901.1|1619755_1619971_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001344902.1|1619974_1620220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1620245_1621458_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000992150.1|1621881_1622415_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_001082532.1|1622713_1623181_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
WP_000373407.1|1623594_1624071_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|1624067_1626191_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|1626187_1626400_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|1626399_1627902_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1627846_1629871_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1629958_1630285_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1630277_1630559_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1630561_1631185_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1631197_1631596_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1631603_1632356_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1632369_1632792_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1632818_1633127_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|1633170_1635816_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1635812_1636142_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001344666.1|1636849_1637593_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122996286.1|1637538_1638171_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|1638417_1641894_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|1641961_1642561_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279055.1|1642625_1643939_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1643940_1644210_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000692020.1|1645345_1645936_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1646313_1646484_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|1646972_1647479_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1647524_1648025_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1648110_1648290_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1648670_1649477_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1649476_1650670_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1650681_1652043_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1652043_1653639_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|1653638_1655201_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1655292_1655337_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1655474_1656356_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1656352_1656973_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1657073_1657946_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1657985_1658576_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|1658572_1659331_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|1659550_1660600_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1737141	1775354	5371077	tRNA,terminase,tail,head,portal,capsid,transposase	Stx2-converting_phage(41.46%)	43	NA	NA
WP_000628065.1|1737141_1738374_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1738628_1739612_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1739886_1740060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123745.1|1740089_1741463_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1741591_1742527_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1742578_1743814_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1743815_1744031_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1744130_1744319_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1744356_1744506_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_162829202.1|1744816_1746030_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000285960.1|1746106_1746283_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_001280923.1|1746377_1746509_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|1746731_1746917_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|1747317_1747644_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1747775_1747976_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1748017_1748383_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|1748671_1749235_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001411753.1|1749231_1750893_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000173011.1|1750956_1752894_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|1752938_1753160_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012817878.1|1753105_1755685_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_000125990.1|1755687_1756014_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1756023_1756374_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1756370_1756817_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1756813_1757158_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275445.1|1757224_1757941_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	95.8	3.7e-124
WP_001030060.1|1757946_1758321_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001453698.1|1758416_1758626_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212770.1|1758677_1761920_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
WP_000807964.1|1761912_1762254_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_012817879.1|1762253_1762952_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000194763.1|1762962_1763706_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_064732755.1|1763651_1764284_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000649829.1|1764474_1765002_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|1765135_1768633_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|1768703_1769303_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268964.1|1769367_1770681_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|1770682_1770952_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|1771064_1771640_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1771712_1772342_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1772423_1773065_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1773645_1774080_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837930.1|1774220_1775354_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
>prophage 9
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	1973463	2068892	5371077	terminase,holin,tail,protease,integrase,head,capsid,transposase,lysis	Stx2-converting_phage(29.03%)	105	2030058:2030074	2064121:2064137
WP_000214712.1|1973463_1973667_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1973702_1975163_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1975251_1976535_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_012817881.1|1976666_1976909_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_001345374.1|1977027_1977177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121225.1|1977504_1978155_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491542.1|1978379_1979255_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|1979395_1979665_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_162829202.1|1979754_1980968_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_012817882.1|1980993_1982778_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_001059384.1|1984305_1984995_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1984991_1985357_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1985357_1986413_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_032178572.1|1986414_1986693_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001217394.1|1986762_1987020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1987240_1987453_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1987731_1988490_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1989188_1989353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1989349_1990084_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_157825328.1|1990117_1990660_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1990571_1991612_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|1991583_1992135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1992421_1992829_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1993093_1993393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171894.1|1993465_1993684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1993706_1994114_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1994091_1994325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1994318_1994486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1994885_1995074_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1995070_1995259_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048484.1|1995354_1997826_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000113189.1|1997890_1998139_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1998116_1999247_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000737224.1|1999292_1999931_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|2000287_2001031_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|2001060_2001600_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2001704_2002103_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000171274.1|2002142_2002862_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_001261191.1|2002952_2003306_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001345079.1|2003654_2004305_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144879.1|2005811_2006402_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2006585_2007233_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2007369_2007516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2007943_2008222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950979.1|2009695_2010607_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2010713_2010836_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023476.1|2011950_2012220_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000216548.1|2012221_2013526_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001228290.1|2013677_2014277_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000514717.1|2014344_2017818_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_096860308.1|2018160_2018793_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_001369422.1|2018738_2019482_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_001369426.1|2019487_2020186_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_000807940.1|2020185_2020527_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000091308.1|2021980_2022346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|2022345_2023533_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001453698.1|2025641_2025851_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030041.1|2025946_2026321_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001275467.1|2026326_2027043_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.9	4.7e-127
WP_000133393.1|2027111_2027456_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2027452_2027899_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2027895_2028246_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2028255_2028582_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
2030058:2030074	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001063025.1|2030946_2031168_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2031212_2033150_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001369319.1|2033213_2034875_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|2034871_2035435_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279803.1|2035724_2036090_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000095736.1|2036131_2036359_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2036727_2036952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082554.1|2036948_2037443_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
WP_000992122.1|2037740_2038274_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2038324_2038669_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_029785460.1|2038673_2038889_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000143036.1|2039325_2041176_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001344632.1|2041623_2041755_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000476993.1|2042133_2042361_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|2042438_2042846_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|2043038_2043191_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241298.1|2043190_2043568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|2043536_2043824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2044239_2044428_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2044424_2044616_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048302.1|2044709_2047181_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_000005552.1|2047253_2047505_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876990.1|2047539_2048820_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|2048839_2048950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|2049007_2050027_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|2050038_2051253_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2051458_2051785_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2051919_2052261_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2052295_2052856_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2052858_2053569_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2053676_2053982_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001342196.1|2056665_2059089_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|2059099_2059717_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|2059718_2060573_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2060615_2061230_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071526378.1|2061388_2062681_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919226.1|2062633_2063329_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2063453_2064674_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
2064121:2064137	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
WP_001019545.1|2064808_2065702_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2065808_2067062_+	MFS transporter	NA	NA	NA	NA	NA
WP_000233090.1|2067887_2067971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|2068070_2068892_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	2192372	2230788	5371077	tRNA,terminase,holin,tail,head,portal,plate,capsid,transposase	Enterobacteria_phage(86.11%)	45	NA	NA
WP_100206497.1|2192372_2192651_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000159459.1|2192661_2192940_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|2192951_2193194_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_162829202.1|2193258_2194472_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000686506.1|2196044_2197004_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000211267.1|2197008_2197320_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|2197684_2197954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236489.1|2198516_2199041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087824.1|2199055_2200102_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000613748.1|2200101_2201853_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_001262673.1|2202007_2202844_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|2202867_2203920_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632344.1|2203965_2204766_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063082.1|2204868_2205363_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|2205362_2205563_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2205565_2205889_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2205885_2206278_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780569.1|2206274_2206682_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920593.1|2206819_2207287_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356341.1|2207279_2207915_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001369311.1|2207926_2208493_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.1e-98
WP_001067548.1|2208510_2208840_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111942.1|2208843_2209740_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000071739.1|2209732_2210263_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108519.1|2210265_2212398_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000144026.1|2212397_2212976_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000954196.1|2213019_2213592_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979957.1|2213748_2214237_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000853433.1|2214249_2217057_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000333503.1|2217043_2217199_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651581.1|2217207_2217582_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000290445.1|2217637_2218150_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000005431.1|2218149_2219334_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132811.1|2219491_2220601_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_001035742.1|2220826_2222329_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000488103.1|2222572_2222833_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078923.1|2223023_2223164_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_001229265.1|2223470_2223770_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672378.1|2223774_2226162_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018594.1|2226176_2227160_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2227443_2227488_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2227610_2227967_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2228019_2228217_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2228313_2228856_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|2228859_2230788_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 11
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	2389425	2450812	5371077	tRNA,terminase,holin,tail,head,capsid	Stx2-converting_phage(37.93%)	69	NA	NA
WP_001258662.1|2389425_2391198_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2391507_2392074_+	hydrolase	NA	NA	NA	NA	NA
WP_001261931.1|2392391_2392640_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|2393011_2394025_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2394239_2394317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023381.1|2394427_2394697_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000279053.1|2394698_2396012_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.6	6.9e-76
WP_001230428.1|2396076_2396676_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000515051.1|2396746_2400244_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_000649829.1|2400377_2400905_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2401095_2401728_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2401673_2402417_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_012817889.1|2402427_2403126_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	1.6e-127
WP_000807964.1|2403125_2403467_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212809.1|2403459_2406702_-|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	94.4	0.0e+00
WP_001453698.1|2406753_2406963_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2407058_2407433_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2407438_2408155_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2408213_2408558_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2408554_2409001_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2408997_2409348_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2409358_2409685_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2412211_2412433_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2412477_2414415_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_012817891.1|2414478_2416140_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2416136_2416700_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279788.1|2416990_2417356_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000095736.1|2417397_2417625_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2418049_2418235_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2418462_2418609_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2418608_2419178_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|2419448_2419982_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|2420032_2420377_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284515.1|2420381_2420597_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290230.1|2420674_2420920_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2420960_2421140_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143120.1|2421277_2423215_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.2	0.0e+00
WP_001398907.1|2423458_2423782_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_000738072.1|2424079_2424349_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365678.1|2424360_2425320_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000483505.1|2425702_2426761_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|2426912_2427110_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|2427325_2427706_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|2427724_2428714_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|2428765_2429023_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|2429019_2430420_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|2430416_2431295_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|2431305_2432214_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621233.1|2432200_2432434_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_000587259.1|2432430_2433093_-	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|2433201_2433909_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|2433990_2434224_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|2434380_2435070_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|2435217_2435919_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|2435915_2436116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365075.1|2436501_2437074_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|2437443_2438271_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|2438311_2438683_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|2438874_2439129_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|2439162_2440449_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_171895658.1|2440453_2441230_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252979.1|2441282_2441678_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2441718_2442462_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564748.1|2442458_2443430_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176765.1|2443594_2446024_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|2446048_2447149_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|2447536_2448283_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|2448296_2448863_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|2449078_2450812_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 12
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	2493340	2589242	5371077	terminase,holin,tail,integrase,head,portal,capsid,transposase	Escherichia_phage(33.85%)	111	2582025:2582084	2587987:2589299
WP_162829202.1|2493340_2494553_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000287769.1|2494669_2495080_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|2495079_2495445_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245704.1|2495522_2497010_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001344676.1|2497043_2497457_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118907.1|2497643_2498849_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790498.1|2498845_2499079_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334609.1|2499185_2499857_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000826461.1|2499896_2501105_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000879833.1|2502496_2503294_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734033.1|2503303_2503855_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2504023_2504356_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2504689_2505004_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994449.1|2505217_2506876_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2506868_2507864_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282694.1|2507856_2508543_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213292.1|2508542_2509916_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2509934_2510378_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620091.1|2510374_2511502_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133124.1|2511606_2512071_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2512075_2513080_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2513076_2513490_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2513492_2513858_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2513857_2514595_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2514604_2514874_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942326.1|2514881_2515667_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103994.1|2515956_2516580_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2516623_2516812_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2516974_2517202_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949111.1|2517499_2518315_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001377491.1|2518311_2520006_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009309.1|2520176_2520359_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2520437_2521355_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|2521527_2522448_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2522436_2522907_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|2522887_2524306_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365565.1|2524372_2525068_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2525107_2525473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824375.1|2526039_2527203_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218214.1|2527793_2528645_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826738.1|2528752_2530111_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2530110_2530782_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920136.1|2530914_2531328_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2531436_2532441_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240109.1|2532441_2533077_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2533333_2533984_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2534326_2534857_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_122993429.1|2536091_2537105_-	peptidase M85	NA	NA	NA	NA	NA
WP_001023476.1|2537510_2537780_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|2537781_2539095_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|2539159_2539759_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514844.1|2539825_2543302_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.7	0.0e+00
WP_122996286.1|2543548_2544181_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|2544126_2544870_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|2544875_2545574_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|2545573_2545903_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|2545899_2548512_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|2548492_2548906_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2548932_2549355_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2549368_2550121_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683079.1|2550128_2550524_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|2550520_2551054_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2551069_2551423_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2551415_2551799_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2551850_2552879_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2552936_2553284_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2553320_2554826_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_001369121.1|2554815_2556408_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2556404_2556611_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001426431.1|2556594_2558523_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_001426432.1|2558494_2559001_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.3	7.4e-34
WP_001444498.1|2559427_2559652_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001302717.1|2559733_2560048_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012817896.1|2560574_2560760_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001092858.1|2561277_2561811_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|2562373_2562589_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2562665_2562938_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2562978_2563158_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000023159.1|2563295_2565233_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2565711_2566143_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000422741.1|2566230_2566656_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2566652_2567003_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080194.1|2567033_2568647_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000301789.1|2569132_2569846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917764.1|2569980_2570178_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000640033.1|2570401_2570956_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_001217447.1|2570964_2571324_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2571336_2572386_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2572387_2572660_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2572781_2573126_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2573245_2573458_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2573691_2574249_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2574250_2574469_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|2574596_2574908_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|2574900_2575128_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2575124_2575406_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2575438_2576155_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000788760.1|2576176_2576923_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_001262366.1|2576929_2578000_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693883.1|2578071_2578497_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|2578480_2578762_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|2578861_2579281_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_001345283.1|2579546_2579699_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|2579710_2580349_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133034.1|2580349_2580559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2581129_2581318_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2581314_2581506_+	DUF1482 family protein	NA	NA	NA	NA	NA
2582025:2582084	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|2582066_2583280_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001300307.1|2585519_2586317_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001345280.1|2586672_2587947_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_162829202.1|2588028_2589242_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
2587987:2589299	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGAC	NA	NA	NA	NA
>prophage 13
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	2604200	2660872	5371077	terminase,holin,coat,integrase,head,portal,transposase,lysis	Enterobacteria_phage(42.47%)	84	2589966:2589980	2662551:2662565
2589966:2589980	attL	AGCATCGCCAATCTG	NA	NA	NA	NA
WP_162829202.1|2604200_2605413_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000068481.1|2606038_2606698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2606833_2607517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2607532_2607943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234505.1|2608163_2608985_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
WP_000860076.1|2609066_2609546_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2609561_2610038_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2610106_2610328_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285585.1|2610401_2610770_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988599.1|2611228_2611423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2611435_2611549_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016348.1|2612037_2612220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2612320_2612650_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001105393.1|2614078_2614552_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_162829202.1|2614691_2615905_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001369224.1|2615983_2617150_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
WP_001345271.1|2618003_2618912_+	acyltransferase	NA	NA	NA	NA	NA
WP_000129903.1|2618952_2620890_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A140G5Z9	Enterobacteria_phage	88.9	1.9e-271
WP_001084290.1|2621068_2622004_-	phage antirepressor Ant	NA	A0A2H4FRZ6	Salmonella_phage	99.0	2.2e-177
WP_000677939.1|2622072_2622234_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_000090241.1|2622324_2622576_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000821222.1|2622592_2623012_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_001334102.1|2623149_2623518_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_001345269.1|2623542_2625381_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.6	4.7e-248
WP_000382045.1|2625380_2626787_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.2	1.2e-126
WP_000964882.1|2626796_2627489_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000627632.1|2627491_2627947_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
WP_000785561.1|2627946_2628648_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	97.0	5.1e-118
WP_000947776.1|2628640_2629174_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	48.3	1.1e-35
WP_001122404.1|2629195_2630614_-	Packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	91.5	5.3e-255
WP_001140510.1|2630623_2631085_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_000966051.1|2631065_2631242_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.3	4.8e-25
WP_162829202.1|2631284_2632498_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000013275.1|2632608_2633862_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.6	1.7e-233
WP_162829202.1|2634475_2635688_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000818367.1|2636177_2638376_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_000200766.1|2638377_2639793_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_001436504.1|2639789_2640212_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000205033.1|2640235_2640415_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
WP_000139136.1|2640424_2640712_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
WP_000807789.1|2640715_2640958_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_000999693.1|2641061_2641442_-	hypothetical protein	NA	Q716B1	Shigella_phage	96.8	6.7e-64
WP_001668490.1|2641673_2642156_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.3	3.2e-79
WP_000092296.1|2642397_2642835_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_000229402.1|2642831_2643308_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	98.7	4.9e-88
WP_000783734.1|2643291_2643615_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000512813.1|2644076_2644595_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.7	5.0e-94
WP_001271131.1|2644585_2645257_-	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	98.2	2.1e-129
WP_000144614.1|2645234_2645441_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001223932.1|2645437_2646040_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	96.6	9.8e-94
WP_001108084.1|2646014_2646581_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000566872.1|2646573_2646744_-	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	1.2e-25
WP_001254257.1|2646740_2646923_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000153271.1|2646919_2647447_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
WP_001303571.1|2647443_2647890_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2647846_2648083_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2648093_2648309_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2648441_2648720_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001036037.1|2648789_2649059_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_000131499.1|2649058_2650495_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.8	1.4e-274
WP_000065673.1|2650484_2651384_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	98.3	7.4e-162
WP_000166207.1|2651376_2651523_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438527.1|2651555_2651852_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000067727.1|2651993_2652209_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_016242500.1|2652284_2652980_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000088201.1|2653325_2653598_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000214161.1|2653726_2653927_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	6.0e-32
WP_000167579.1|2653992_2654463_+	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	8.2e-88
WP_001183771.1|2654657_2654828_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000050554.1|2654903_2655074_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031374.1|2655084_2655690_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	2.1e-107
WP_000951320.1|2655689_2656073_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_001111307.1|2656096_2656390_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	3.2e-50
WP_001214466.1|2656400_2656568_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	4.7e-22
WP_000109677.1|2656564_2656864_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.1e-56
WP_001033097.1|2656865_2657420_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	87.7	1.0e-57
WP_001261535.1|2657419_2657596_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	96.6	4.5e-23
WP_000797282.1|2657592_2657781_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000951710.1|2657782_2657992_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_000208130.1|2657988_2658792_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	50.6	2.2e-48
WP_000002108.1|2658784_2659069_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	9.1e-50
WP_000227131.1|2659140_2659440_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	3.0e-51
WP_000132739.1|2659521_2659713_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007947.1|2659693_2660872_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
2662551:2662565	attR	AGCATCGCCAATCTG	NA	NA	NA	NA
>prophage 14
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	2855321	2922888	5371077	terminase,protease,holin,integrase,capsid,lysis	Enterobacteria_phage(21.43%)	63	2893264:2893299	2923828:2923863
WP_000101907.1|2855321_2856563_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2857059_2857266_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001345228.1|2857220_2859029_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_023981888.1|2859244_2859484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2859456_2859690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|2859682_2859916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2859921_2860221_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2860217_2861618_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2861819_2862065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2862195_2862390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2862393_2862555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|2862682_2863171_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_000006073.1|2863182_2863344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001369202.1|2863333_2864257_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|2867634_2868282_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211568.1|2868316_2869369_-	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2869365_2869923_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2869919_2871863_-	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_001026418.1|2871859_2872339_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2872335_2872545_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2872541_2873279_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971722.1|2873320_2873983_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2873979_2874597_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2874615_2875218_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835176.1|2875227_2875677_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013506.1|2875673_2876537_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2876523_2877219_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2877225_2879712_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2879708_2879972_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2879961_2880456_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849214.1|2880864_2881353_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758043.1|2881501_2883148_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2883365_2885009_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2885084_2885735_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2885734_2886799_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2886872_2887928_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2888039_2889131_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249151.1|2889869_2892542_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2892558_2893209_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2893264:2893299	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000876032.1|2893408_2896258_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2896532_2897309_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2897313_2898963_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_122993426.1|2898963_2903358_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025665.1|2904159_2905482_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_001443833.1|2906175_2906709_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
WP_000092247.1|2907462_2907900_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000075144.1|2907896_2908394_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|2908393_2908609_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2908751_2909150_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2909230_2909389_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235460.1|2910481_2911105_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2911101_2911767_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2911763_2912366_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2912340_2912907_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_042352449.1|2913448_2914381_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001345214.1|2914419_2915247_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_001254228.1|2915750_2915933_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001281192.1|2916089_2916434_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2916539_2916758_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2916735_2917806_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2917800_2918427_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012296.1|2918423_2920112_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2920260_2922888_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2923828:2923863	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 15
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	3272608	3385498	5371077	tRNA,terminase,protease,tail,portal,transposase	Enterobacteria_phage(52.0%)	105	NA	NA
WP_001298974.1|3272608_3273346_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3273477_3274812_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3275021_3275903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000627807.1|3276650_3277034_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3277337_3278027_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3278074_3279112_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3279318_3279738_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|3279806_3280505_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|3280536_3283197_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3283310_3284666_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3284711_3285035_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3285031_3286330_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3292182_3294756_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|3294885_3295617_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3295613_3296594_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3296728_3297466_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3297736_3298078_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3298181_3298229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3298327_3299488_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225214.1|3299530_3300652_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|3300662_3301733_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|3301942_3302308_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3302457_3302976_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|3302965_3304192_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589821.1|3304207_3304690_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3304766_3305114_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264774.1|3305155_3305923_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3305953_3306502_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3306520_3306769_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|3307017_3308379_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3308545_3309337_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3309357_3310644_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3310698_3311292_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3311414_3312293_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3312378_3314040_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3314188_3314530_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3314591_3314882_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3314871_3315348_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3315479_3315962_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217540.1|3316810_3317059_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_001023452.1|3317426_3317696_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000279055.1|3317697_3319011_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230459.1|3319075_3319675_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000514843.1|3319742_3323219_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.7	0.0e+00
WP_122996286.1|3323465_3324098_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|3324043_3324787_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|3324792_3325491_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|3325490_3325820_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918236.1|3325816_3328462_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|3328505_3328814_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|3328840_3329263_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3329276_3330029_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_162829202.1|3330381_3331594_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001108006.1|3332342_3332948_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|3332944_3333139_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|3333131_3333566_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|3334072_3335020_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|3335029_3335299_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_012816791.1|3336302_3336488_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|3336962_3337439_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|3337435_3339559_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|3339555_3339768_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974557.1|3339767_3341270_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.8	3.1e-290
WP_001114424.1|3341214_3343239_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|3343326_3343653_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|3343645_3343927_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|3343929_3344553_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682711.1|3344565_3344712_+	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_162829202.1|3344714_3345928_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000448925.1|3347006_3347423_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|3347496_3349245_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_001426837.1|3349246_3350965_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
WP_000993087.1|3352525_3353503_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000271938.1|3353522_3354791_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772858.1|3354813_3356262_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001087606.1|3356275_3357556_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001344737.1|3357866_3359267_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3359287_3359950_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|3359950_3360400_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000508177.1|3360483_3360642_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137280.1|3360824_3361124_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229468.1|3361133_3361658_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115383.1|3361704_3362109_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492649.1|3362776_3363226_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|3363262_3363607_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001295174.1|3363758_3364088_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223219.1|3364335_3364581_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	4.1e-06
WP_000080947.1|3364577_3364988_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246506.1|3364960_3367105_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	9.3e-195
WP_000777939.1|3367114_3368074_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985494.1|3368428_3369631_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774994.1|3369623_3370688_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216521.1|3370745_3371738_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165722.1|3371929_3373114_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|3373237_3373975_+	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000119771.1|3373964_3374300_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|3374390_3374921_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_001295175.1|3375047_3376220_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001295176.1|3376236_3377775_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130207.1|3377838_3378354_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000611802.1|3378503_3380060_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287457.1|3380132_3380561_-	DedA family protein	NA	NA	NA	NA	NA
WP_000273309.1|3380557_3381124_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|3382447_3382633_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|3382867_3385498_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 16
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	3422493	3429633	5371077		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3422493_3425055_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|3425160_3425817_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|3425867_3426635_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3426830_3427739_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590389.1|3427735_3428998_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3428994_3429633_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	4957578	5002491	5371077	tRNA,terminase,holin,tail,head,capsid	Enterobacteria_phage(34.09%)	48	NA	NA
WP_000956557.1|4957578_4958112_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|4958308_4958482_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|4958529_4958811_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|4958847_4959420_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|4959419_4960154_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|4960156_4960348_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_171844465.1|4960400_4960679_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.4	1.2e-30
WP_000145671.1|4960963_4961437_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|4961433_4961784_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4961774_4962311_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081302.1|4962438_4963263_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000135680.1|4963328_4963691_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001345148.1|4964394_4965087_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_001191679.1|4965184_4965445_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_000515862.1|4965437_4965989_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001047110.1|4967501_4968254_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|4968563_4968716_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143075.1|4969533_4971384_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_024164617.1|4971823_4972039_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|4972038_4972536_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|4972752_4972938_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|4973465_4973780_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000958398.1|4974680_4975244_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_009453642.1|4975240_4976902_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000173088.1|4976965_4978903_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_001063096.1|4978947_4979169_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4981532_4981859_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4981868_4982219_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4982215_4982662_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4982658_4983003_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275461.1|4983069_4983786_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_001030043.1|4983791_4984166_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|4984261_4984471_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212952.1|4984522_4987765_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807964.1|4987757_4988099_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001152209.1|4988098_4988797_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000194763.1|4988807_4989551_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_126303346.1|4989496_4990129_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000514845.1|4990364_4993841_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|4993909_4994533_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279033.1|4994597_4995911_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023417.1|4995912_4996182_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000442132.1|4996342_4996765_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001345294.1|4996894_4997953_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001117798.1|4998031_4998682_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132154.1|4998864_4999455_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|4999956_5000205_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000543817.1|5001453_5002491_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 18
NC_013364	Escherichia coli O111:H- str. 11128, complete genome	5371077	5117127	5180988	5371077	tRNA,transposase,protease,integrase	Vibrio_phage(12.5%)	60	5158855:5158884	5184355:5184384
WP_000811566.1|5117127_5117403_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|5117519_5119145_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|5119228_5120392_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|5120394_5121033_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5121042_5121441_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012546.1|5121447_5122107_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5122157_5122856_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5122874_5123276_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293281.1|5123402_5124134_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076318.1|5124313_5126674_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001177639.1|5126712_5127138_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5127342_5128641_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5128744_5128942_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5129023_5130028_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5130030_5131290_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|5131375_5132656_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|5132732_5133041_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|5133126_5134077_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|5134069_5135917_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|5135926_5137264_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|5137282_5137744_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|5137715_5139263_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294195.1|5139261_5140401_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|5140383_5140437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|5141300_5141846_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|5141940_5142993_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|5143089_5144058_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|5144079_5147403_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|5147431_5147746_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|5147742_5148057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|5148108_5149611_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|5149829_5150807_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|5151131_5152940_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|5152932_5153667_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|5153677_5154073_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|5154083_5154443_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|5154505_5155639_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|5155727_5156261_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|5156257_5156575_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|5156756_5156903_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|5157013_5157139_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|5157190_5157757_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|5157798_5158827_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
5158855:5158884	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
WP_001008073.1|5159216_5160086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|5160289_5160643_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729116.1|5160780_5162436_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|5162479_5162773_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|5163048_5164305_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|5164320_5164797_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|5165133_5166570_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|5166687_5167989_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|5168104_5168443_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|5168418_5170116_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|5170152_5170728_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|5171107_5172373_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000631719.1|5174034_5174382_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_000603950.1|5176703_5177252_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001453071.1|5177824_5177998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|5179390_5180604_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001254202.1|5180697_5180988_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5184355:5184384	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NC_013365	Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence	204604	65528	115749	204604	transposase,integrase	Escherichia_phage(28.57%)	51	63827:63843	87494:87510
63827:63843	attL	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_001086279.1|65528_66710_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|66924_67137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|68722_69478_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|70962_72036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|72292_72769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|73448_73841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493077.1|74253_74457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255860.1|74611_75817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778959.1|75986_76478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|76916_77723_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_001178596.1|77840_78248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023145242.1|78294_79005_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.3	7.7e-05
WP_001287388.1|79770_80175_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001082182.1|80436_80709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010892343.1|80705_81374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|81880_82336_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000272280.1|82504_82693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131802.1|82698_83916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323423.1|83970_84174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529857.1|84211_85507_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_011011077.1|85531_85702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173051575.1|85830_87222_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	3.9e-101
WP_000173534.1|87481_87997_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
87494:87510	attR	AAAAAGTTACTTTTGCC	NA	NA	NA	NA
WP_005046389.1|88002_88926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|88981_89761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|90108_90408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|91398_92607_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|92972_94178_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|94621_94942_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|94934_95321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|95328_96015_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|95992_96616_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|96697_97903_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000429836.1|99186_99621_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|99692_100043_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732293.1|100056_100332_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|100367_100790_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|100841_102536_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|102553_102916_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|102912_103149_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|103184_103853_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|105242_105947_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|106136_106952_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|107102_107807_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|107867_108704_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|108703_109507_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|109567_110383_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|110690_111542_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|112297_113002_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|113599_114460_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|115044_115749_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NC_013370	Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence	97897	206	97499	97897	integrase,terminase,head,transposase,tail	Escherichia_phage(67.31%)	110	785:797	19883:19895
WP_000542341.1|206_428_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_000481733.1|447_843_+	hypothetical protein	NA	NA	NA	NA	NA
785:797	attL	TTATTGATGAGAT	NA	NA	NA	NA
WP_000185182.1|839_1871_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	3.2e-193
WP_001224238.1|1921_2233_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	1.8e-46
WP_001260622.1|2471_3587_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	93.3	1.3e-192
WP_012817933.1|3583_3805_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.8	6.2e-30
WP_024200488.1|4398_5040_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	100.0	9.7e-116
WP_000747846.1|5079_5328_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|5324_5765_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_001038178.1|5798_12566_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_000774708.1|12641_14351_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_000132943.1|14343_15363_+|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	100.0	3.9e-183
WP_001038142.1|15407_15662_-	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	3.6e-37
WP_000676956.1|15654_16212_-	lysozyme	NA	Q1MVN3	Enterobacteria_phage	100.0	4.2e-107
WP_000068866.1|16381_16870_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	8.5e-88
WP_000126784.1|17067_17856_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	97.7	1.3e-141
WP_000413423.1|18102_18390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165934.1|18593_18914_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.0e-41
WP_000058793.1|18903_21891_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	98.8	0.0e+00
19883:19895	attR	ATCTCATCAATAA	NA	NA	NA	NA
WP_000175486.1|21903_22269_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
WP_000434672.1|22265_24185_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.5	0.0e+00
WP_001345482.1|24186_24789_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580770.1|24775_25219_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_001312286.1|25215_25332_-	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	8.0e-13
WP_077625665.1|25312_25810_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	63.1	1.4e-24
WP_001369353.1|26300_26873_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144025.1|26916_27495_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_001000790.1|27494_30344_-|tail	tail fiber protein	tail	Q71TP5	Escherichia_phage	93.7	0.0e+00
WP_001286326.1|30355_30790_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_001189831.1|30868_31705_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_000047923.1|31704_33138_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|33134_33491_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440162.1|33490_36883_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	98.7	0.0e+00
WP_000926353.1|36964_37846_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	100.0	2.2e-174
WP_000523978.1|37860_38472_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_000188917.1|38482_39049_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	98.9	4.3e-99
WP_012817937.1|39107_39584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540695.1|39648_40323_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.0	2.0e-18
WP_000245710.1|40723_40945_+	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	100.0	5.6e-39
WP_000743160.1|40941_41979_+	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	93.9	1.8e-175
WP_001187870.1|42143_42944_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.2	2.1e-147
WP_001369093.1|42973_43819_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	2.1e-150
WP_001369095.1|43869_44115_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|44296_44452_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509943.1|44568_45078_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
WP_000035299.1|45089_45671_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
WP_000041774.1|45706_46522_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
WP_000085155.1|46531_48121_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000067713.1|48181_49888_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038868.1|50112_51114_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_001285362.1|51130_52327_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000888906.1|53597_54482_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001281116.1|54815_55208_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|55219_55360_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|55385_55808_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890203.1|55847_56636_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_001177859.1|57098_57383_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472523.1|57375_58281_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
WP_000660980.1|58277_61319_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	87.2	0.0e+00
WP_162467002.1|61377_61635_-	hypothetical protein	NA	A0A1B0V7P4	Salmonella_phage	84.8	7.8e-16
WP_000751806.1|63328_64156_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_001276599.1|64539_65904_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_001198654.1|65903_66902_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	3.7e-194
WP_000535209.1|66948_67581_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212018.1|67573_68590_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602707.1|68591_69377_-	hypothetical protein	NA	Q71T90	Escherichia_phage	96.5	1.2e-139
WP_000896792.1|69363_70092_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	98.8	1.5e-136
WP_001141913.1|70095_71313_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	3.2e-224
WP_000235786.1|71322_71700_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840933.1|71846_72092_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	98.8	3.3e-40
WP_000943615.1|72094_72673_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	92.7	3.4e-99
WP_000096174.1|72739_72895_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_012817939.1|72836_73499_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000484113.1|73396_74023_+	hypothetical protein	NA	A0A077SK52	Escherichia_phage	99.0	3.1e-122
WP_024200490.1|74019_74697_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	96.9	5.1e-131
WP_162829202.1|74952_76165_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000107685.1|77009_78272_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	97.6	4.0e-230
WP_000021752.1|78345_78852_+	hypothetical protein	NA	Q71T77	Escherichia_phage	97.0	5.0e-91
WP_000675632.1|79046_79775_+	hypothetical protein	NA	Q71T76	Escherichia_phage	95.4	9.3e-139
WP_000158003.1|79858_80062_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_000476202.1|80054_80294_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_001290013.1|80290_80992_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	53.9	9.2e-51
WP_001018057.1|80988_81279_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_000403776.1|81945_82305_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_000935430.1|82350_82563_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	2.2e-32
WP_000951706.1|82818_83028_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000208030.1|83024_83867_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	67.2	5.8e-100
WP_000969528.1|83863_84124_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	96.5	7.8e-40
WP_000002123.1|84123_84405_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.4e-47
WP_000267997.1|84428_84722_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	97.9	1.6e-49
WP_000988652.1|84728_85103_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
WP_000057456.1|85084_85774_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	97.8	8.8e-123
WP_001142389.1|85757_86042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988220.1|86041_86347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159954.1|86343_86868_+	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	4.9e-33
WP_001048304.1|86928_87144_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	97.2	4.2e-31
WP_001133672.1|87174_87510_-	hypothetical protein	NA	Q71TH9	Escherichia_phage	98.2	6.5e-63
WP_000506726.1|87684_88074_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|88146_88368_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|88367_88748_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_000113018.1|88752_88932_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_000648823.1|88959_90003_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_001448129.1|90091_90544_+	hypothetical protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000219603.1|90629_91823_+|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	95.7	5.0e-174
WP_000124153.1|91822_93307_+	hypothetical protein	NA	Q71T61	Escherichia_phage	99.8	2.1e-291
WP_000908421.1|93390_93867_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_162829202.1|93912_95126_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000568543.1|95206_96295_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	87.9	8.6e-173
WP_000611655.1|96327_97179_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_000874157.1|97289_97499_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	3.1e-31
>prophage 1
NC_013366	Escherichia coli O111:H- str. 11128 plasmid pO111_3, complete sequence	77690	7945	52640	77690	transposase	Escherichia_phage(30.77%)	52	NA	NA
WP_000998093.1|7945_9484_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
WP_001282151.1|9878_10268_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_001369432.1|11001_11214_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|11458_11920_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001369435.1|11965_12175_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766811.1|12212_12803_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083826.1|13042_13300_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365571.1|13534_13609_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130993.1|13601_14459_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001344604.1|15161_15422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859016.1|15434_15674_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000937595.1|15877_17065_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|17064_17430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997720.1|17568_17823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789660.1|17833_18025_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_001034091.1|18329_22295_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_162829242.1|22614_23828_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_162829202.1|25108_26321_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000445936.1|26773_27169_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000921961.1|27168_28128_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_000937595.1|28806_29994_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|29993_30359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072106536.1|30731_31034_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271680.1|31080_31503_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|31499_31691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013279293.1|31966_32191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|32728_32959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170683.1|33010_34372_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_077625669.1|35132_35435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032175643.1|35485_35680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290792.1|35907_36435_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
WP_000006004.1|36490_36724_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145472.1|36782_38741_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
WP_000845949.1|38795_39230_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|39226_39946_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|39957_40146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|40225_40384_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001427866.1|40737_40962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032351767.1|40884_41073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|41305_41593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|41713_42535_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_001151524.1|43754_44138_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283394.1|44324_45014_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_001309237.1|45112_45508_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000994781.1|45540_45900_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012104.1|45914_46226_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399789.1|46247_46814_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|46824_47529_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146670.1|47528_48956_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002783.1|48945_49536_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001369729.1|49522_49645_+	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|51426_52640_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
