The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	0	10746	2815241	integrase	Pseudomonas_phage(20.0%)	10	304:315	8358:8369
304:315	attL	TTCCCCTGTTAT	NA	NA	NA	NA
WP_012812257.1|387_813_-	RusA family crossover junction endodeoxyribonuclease	NA	K4NWZ9	Pseudomonas_phage	42.5	2.4e-22
WP_012812258.1|1205_2420_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	43.3	1.1e-83
WP_012812259.1|2680_3160_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_012812260.1|3399_3927_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_012812261.1|4063_5311_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.7	2.2e-26
WP_003623254.1|5335_5722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003623252.1|5752_5938_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_003623250.1|5964_6669_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003623248.1|6683_7643_-	tetratricopeptide repeat protein	NA	A0A1J0GW78	Streptomyces_phage	37.6	3.5e-08
WP_012812262.1|7881_10746_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.6	0.0e+00
8358:8369	attR	TTCCCCTGTTAT	NA	NA	NA	NA
>prophage 2
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	18317	19772	2815241		Gordonia_phage(100.0%)	1	NA	NA
WP_003623233.1|18317_19772_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	34.5	3.1e-32
>prophage 3
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	23075	24104	2815241		Tupanvirus(100.0%)	1	NA	NA
WP_012812267.1|23075_24104_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.0	1.1e-31
>prophage 4
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	43040	44075	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_003624906.1|43040_44075_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.6	1.3e-122
>prophage 5
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	51978	53952	2815241		Streptococcus_virus(100.0%)	1	NA	NA
WP_012812281.1|51978_53952_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.1	1.5e-42
>prophage 6
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	67814	68945	2815241		Pseudomonas_phage(100.0%)	1	NA	NA
WP_124296306.1|67814_68945_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	36.2	7.2e-05
>prophage 7
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	79340	87535	2815241		Micromonas_sp._RCC1109_virus(33.33%)	6	NA	NA
WP_004449247.1|79340_80930_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	37.5	9.8e-08
WP_012812291.1|81225_82275_-	heme A synthase	NA	NA	NA	NA	NA
WP_003629844.1|82289_83069_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_012812292.1|83230_84493_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	1.8e-25
WP_014462171.1|84596_86840_+	response regulator	NA	NA	NA	NA	NA
WP_003629841.1|87001_87535_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.8	4.0e-22
>prophage 8
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	102733	119260	2815241		Salicola_phage(33.33%)	12	NA	NA
WP_012812303.1|102733_105274_-	DEAD/DEAH box helicase	NA	A0A248SJQ0	Salicola_phage	34.0	8.0e-28
WP_012812304.1|105283_106870_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.2	8.8e-33
WP_012812305.1|106968_107442_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003629818.1|107582_108029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812306.1|108038_109136_-	UDP-phosphate alpha-N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_004449205.1|109129_111160_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.5	3.3e-16
WP_004449204.1|111156_112293_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	23.6	1.9e-21
WP_004449202.1|112309_112774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812307.1|112867_114232_-	dihydroorotase	NA	NA	NA	NA	NA
WP_012812308.1|114238_115636_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.9e-47
WP_003629809.1|115696_116593_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_004449196.1|116911_119260_+	RNA helicase	NA	A0A248SJQ0	Salicola_phage	33.5	1.5e-49
>prophage 9
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	124900	125431	2815241		Rhizobium_phage(100.0%)	1	NA	NA
WP_003629802.1|124900_125431_-	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	29.2	2.2e-12
>prophage 10
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	131501	131972	2815241		Pneumococcus_phage(100.0%)	1	NA	NA
WP_035362188.1|131501_131972_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	54.3	1.8e-26
>prophage 11
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	137725	138763	2815241		Planktothrix_phage(100.0%)	1	NA	NA
WP_003623712.1|137725_138763_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	7.0e-31
>prophage 12
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	142376	199550	2815241	transposase,integrase	Streptococcus_phage(23.08%)	44	182678:182702	201073:201097
WP_012812320.1|142376_143762_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.1e-31
WP_003623703.1|144757_145792_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012812322.1|145820_146966_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003623701.1|147058_148447_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_003623700.1|148443_149229_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_003623699.1|149261_150614_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_012812323.1|151113_152304_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012812324.1|152309_155465_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003623693.1|155469_156954_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003623691.1|157033_157240_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	48.3	1.8e-10
WP_012812325.1|157533_157848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812327.1|158843_159509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|159551_160802_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012812329.1|160891_161317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812330.1|161360_163715_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012812331.1|164039_167195_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_012812332.1|167200_168472_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_012812333.1|168916_169426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812334.1|169425_170655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626057.1|171033_172041_+	formamidase	NA	NA	NA	NA	NA
WP_012812336.1|172086_172986_-	response regulator	NA	W8CYM9	Bacillus_phage	41.8	7.0e-19
WP_003626054.1|172982_176465_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	3.5e-34
WP_003626052.1|176588_177803_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003626050.1|177857_178784_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_012812338.1|178795_179911_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_003626046.1|179922_180669_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	2.0e-19
WP_012812339.1|180685_181402_+	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	31.4	1.0e-17
WP_020944507.1|182215_182470_-	hypothetical protein	NA	NA	NA	NA	NA
182678:182702	attL	TGCGAACTGCGGGACTCGAACCCGC	NA	NA	NA	NA
WP_012812342.1|182917_183943_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_012812343.1|184106_185108_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_082179745.1|185193_185400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812344.1|185429_185831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812345.1|186048_187422_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012812346.1|187674_188712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|188829_190215_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812348.1|190357_191128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812349.1|191150_191543_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_012812390.1|191714_193100_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812350.1|193500_194562_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012812351.1|194597_195656_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	47.2	1.7e-56
WP_012812352.1|195652_196735_+	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	28.8	9.6e-15
WP_082179746.1|196839_197400_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	28.5	4.7e-05
WP_012812354.1|197528_199139_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.5e-112
WP_012812355.1|199202_199550_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	2.7e-11
201073:201097	attR	TGCGAACTGCGGGACTCGAACCCGC	NA	NA	NA	NA
>prophage 13
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	225336	227853	2815241		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003625653.1|225336_225864_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	51.7	2.1e-44
WP_003625655.1|226173_227853_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.0	1.9e-41
>prophage 14
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	232530	233691	2815241	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003624841.1|232530_233691_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	50.6	1.1e-93
>prophage 15
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	238646	242945	2815241		Enterococcus_phage(33.33%)	4	NA	NA
WP_012812368.1|238646_239561_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.0	8.4e-28
WP_003624826.1|239679_240828_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003624824.1|240847_241312_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	47.4	1.3e-29
WP_003624821.1|241388_242945_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	42.0	8.4e-20
>prophage 16
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	250835	251333	2815241		Paenibacillus_phage(100.0%)	1	NA	NA
WP_012812374.1|250835_251333_-	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	32.7	4.4e-07
>prophage 17
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	268280	269039	2815241		Pandoravirus(100.0%)	1	NA	NA
WP_003624776.1|268280_269039_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	35.9	7.2e-25
>prophage 18
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	276978	281609	2815241	transposase	Bacteriophage(33.33%)	7	NA	NA
WP_012812385.1|276978_277722_-	phage repressor protein/antirepressor Ant	NA	A0A0C5AEJ9	Bacteriophage	39.7	9.5e-38
WP_012812386.1|277718_277976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812387.1|277972_278188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812388.1|278539_278776_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_012812389.1|278804_278999_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_012812390.1|279320_280706_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_158301028.1|280877_281609_+|transposase	transposase	transposase	A0A0A8WEF4	Clostridium_phage	27.6	2.8e-18
>prophage 19
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	291353	294243	2815241	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003623838.1|291353_291731_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.0	1.5e-15
WP_003623836.1|291897_294243_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	6.2e-176
>prophage 20
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	299982	309488	2815241	tRNA	Bacillus_phage(20.0%)	8	NA	NA
WP_003623821.1|299982_300696_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	3.9e-33
WP_012812400.1|300889_301486_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003623819.1|301691_303596_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	51.9	3.6e-150
WP_003623818.1|303751_304894_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	9.2e-24
WP_003623816.1|304900_305680_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_035362213.1|305868_307056_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	50.2	1.3e-97
WP_003623812.1|307074_307812_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003623808.1|307910_309488_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.7	1.1e-64
>prophage 21
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	315909	316404	2815241		Caulobacter_phage(100.0%)	1	NA	NA
WP_012812407.1|315909_316404_-	helix-turn-helix domain-containing protein	NA	K4K6E9	Caulobacter_phage	51.7	2.7e-17
>prophage 22
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	329789	334426	2815241		Megavirus(33.33%)	4	NA	NA
WP_003623768.1|329789_331079_+	adenylosuccinate synthase	NA	K7YXK1	Megavirus	34.5	2.4e-60
WP_003623766.1|331301_331991_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	33.8	1.9e-32
WP_012812412.1|332010_333318_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003623764.1|333391_334426_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A2R8FEI2	Cedratvirus	26.9	7.3e-12
>prophage 23
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	341761	343918	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_003623755.1|341761_343918_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	2.9e-31
>prophage 24
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	350954	352832	2815241		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012812418.1|350954_352832_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.3	3.4e-100
>prophage 25
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	356751	361338	2815241	transposase	Streptococcus_phage(50.0%)	6	NA	NA
WP_012812390.1|356751_358137_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_041632451.1|358278_358506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003623736.1|358505_358916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812424.1|359039_360296_+	CotH kinase family protein	NA	NA	NA	NA	NA
WP_012812425.1|360346_360853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812426.1|360849_361338_+	hypothetical protein	NA	S5M805	Pseudoalteromonas_phage	39.2	1.4e-10
>prophage 26
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	364925	366026	2815241		Gordonia_phage(100.0%)	1	NA	NA
WP_012812433.1|364925_366026_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.5	6.1e-09
>prophage 27
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	374514	379845	2815241		Staphylococcus_phage(50.0%)	4	NA	NA
WP_012812439.1|374514_376503_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	33.6	2.8e-68
WP_003625024.1|376728_377991_+	MFS transporter	NA	NA	NA	NA	NA
WP_003625022.1|378062_379181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625020.1|379278_379845_+	DUF1643 domain-containing protein	NA	K4JQR8	Caulobacter_virus	41.0	1.6e-24
>prophage 28
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	388620	393682	2815241		Streptococcus_phage(50.0%)	6	NA	NA
WP_003630016.1|388620_389946_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	3.2e-89
WP_003624996.1|389957_390677_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003624991.1|390772_391234_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003624989.1|391289_391745_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003624987.1|391856_392735_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012812442.1|392740_393682_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.5	1.5e-08
>prophage 29
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	403674	404229	2815241		Pseudomonas_phage(100.0%)	1	NA	NA
WP_012812446.1|403674_404229_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	67.1	2.8e-63
>prophage 30
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	416453	418415	2815241		Geobacillus_virus(100.0%)	1	NA	NA
WP_003625120.1|416453_418415_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	29.1	4.6e-07
>prophage 31
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	424824	429566	2815241		Escherichia_phage(33.33%)	5	NA	NA
WP_003625103.1|424824_425034_-	hypothetical protein	NA	A0A0A0YUA2	Escherichia_phage	50.0	4.0e-10
WP_012812453.1|425026_426523_-	multidrug transporter	NA	NA	NA	NA	NA
WP_003625101.1|426667_427474_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	1.4e-07
WP_012812454.1|427479_428511_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035362377.1|428633_429566_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	1.1e-43
>prophage 32
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	445105	445867	2815241		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_012812463.1|445105_445867_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.3	9.8e-14
>prophage 33
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	454886	456272	2815241	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_012812320.1|454886_456272_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.1e-31
>prophage 34
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	468581	472375	2815241	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_087651418.1|468581_469336_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_012812475.1|469512_471414_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_003626015.1|471826_472375_-	DNA starvation/stationary phase protection protein	NA	A0A2K9VDB4	Lactobacillus_phage	34.1	3.3e-11
>prophage 35
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	483858	484755	2815241		Klosneuvirus(100.0%)	1	NA	NA
WP_012812486.1|483858_484755_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	24.8	3.5e-18
>prophage 36
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	509662	510397	2815241		Sulfitobacter_phage(100.0%)	1	NA	NA
WP_012812506.1|509662_510397_+	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	50.0	2.0e-11
>prophage 37
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	525286	526138	2815241		Pseudomonas_virus(100.0%)	1	NA	NA
WP_012812516.1|525286_526138_-	helix-turn-helix domain-containing protein	NA	H1ZZB6	Pseudomonas_virus	31.4	5.2e-08
>prophage 38
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	535267	595689	2815241	plate,transposase,terminase	Myoviridae_environmental_samples(19.05%)	58	NA	NA
WP_012812522.1|535267_537457_+	acyltransferase	NA	C6ZR20	Salmonella_phage	34.4	2.1e-61
WP_012812523.1|537453_538092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812524.1|538254_538797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625349.1|538783_538966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812525.1|538998_540453_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.2	6.7e-104
WP_012812526.1|540449_541601_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_012812527.1|541749_543129_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	7.8e-86
WP_012812528.1|543125_544127_+	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	36.5	1.1e-28
WP_012812529.1|544164_544665_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.9	9.2e-29
WP_012812530.1|544664_545702_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	47.0	2.4e-79
WP_012812531.1|545745_546063_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.4	2.5e-11
WP_012812532.1|546099_546606_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_012812533.1|546596_546977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812534.1|546973_547510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812535.1|547528_548683_+	DUF3383 family protein	NA	E2GLU1	Acinetobacter_phage	33.0	2.8e-28
WP_012812536.1|548685_549123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812537.1|549162_549618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625379.1|549641_549803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812320.1|550209_551595_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.1e-31
WP_012812538.1|551660_552464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812539.1|552499_553213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628974.1|553209_553530_+	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	36.2	8.3e-07
WP_012812540.1|553526_554453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812541.1|554449_555139_+|plate	baseplate assembly protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	43.1	3.1e-35
WP_012812542.1|555150_555504_+	hypothetical protein	NA	A0A068CCM1	Acinetobacter_phage	42.1	1.1e-12
WP_012812543.1|555532_556726_+|plate	baseplate J/gp47 family protein	plate	A0A2R3UAL9	Myoviridae_environmental_samples	39.2	2.0e-61
WP_012812544.1|556725_557304_+	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	38.6	1.3e-29
WP_012812545.1|557311_558409_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	34.5	5.9e-12
WP_012812546.1|558415_558985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625399.1|559107_559554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003625401.1|559626_560889_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.3	2.5e-30
WP_012812547.1|560895_563397_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012812548.1|563399_564650_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012812549.1|564649_565213_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_012812550.1|565337_565883_-	RcnB family protein	NA	NA	NA	NA	NA
WP_012812551.1|566132_566438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812552.1|566555_567461_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.6	5.4e-11
WP_012812553.1|567765_568188_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_041632590.1|568305_568779_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812555.1|568850_569696_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627014.1|569706_570141_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	38.6	2.8e-05
WP_003627013.1|570269_570653_-	VOC family protein	NA	NA	NA	NA	NA
WP_003627012.1|570722_571547_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_003627010.1|571779_572220_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012812557.1|572539_574234_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_012812558.1|574343_575549_-	TonB family protein	NA	NA	NA	NA	NA
WP_012812559.1|575673_577878_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.9	5.4e-81
WP_012812560.1|578014_580471_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012812561.1|580634_581306_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812562.1|581566_582586_+	acetyl-CoA--acetoacetyl-CoA transferase subunit alpha	NA	NA	NA	NA	NA
WP_012812564.1|583162_584548_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_012812567.1|586518_587778_+	glycerate kinase	NA	NA	NA	NA	NA
WP_003626098.1|587913_589056_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012812568.1|589052_589820_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_012812569.1|589822_590980_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_012812570.1|590979_591837_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_012812571.1|591852_592614_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_041632468.1|594303_595689_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
>prophage 39
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	598979	600572	2815241		Klosneuvirus(100.0%)	1	NA	NA
WP_012812577.1|598979_600572_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	34.8	3.1e-62
>prophage 40
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	606957	608343	2815241	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_012812583.1|606957_608343_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
>prophage 41
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	614309	615476	2815241		Mycobacterium_phage(100.0%)	1	NA	NA
WP_012812588.1|614309_615476_+	acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit	NA	G1BRG0	Mycobacterium_phage	37.7	2.9e-09
>prophage 42
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	620276	621743	2815241		Streptococcus_phage(100.0%)	1	NA	NA
WP_012812591.1|620276_621743_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.2	1.2e-07
>prophage 43
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	625898	626696	2815241		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003622454.1|625898_626696_-	alpha/beta fold hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	32.2	5.1e-05
>prophage 44
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	636385	637198	2815241		Pandoravirus(100.0%)	1	NA	NA
WP_012812601.1|636385_637198_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	35.8	1.2e-09
>prophage 45
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	643216	648442	2815241		Erysipelothrix_phage(50.0%)	5	NA	NA
WP_012812606.1|643216_645034_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	43.3	1.1e-23
WP_020944598.1|645078_645300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629062.1|645389_645689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812608.1|645945_647202_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003622489.1|647425_648442_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	27.5	6.5e-13
>prophage 46
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	660944	666451	2815241		Streptococcus_phage(50.0%)	4	NA	NA
WP_012812615.1|660944_662750_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	1.8e-21
WP_003622514.1|662876_664052_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003622517.1|664051_664657_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_003622519.1|665113_666451_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	1.4e-52
>prophage 47
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	670027	677663	2815241		Tupanvirus(33.33%)	8	NA	NA
WP_012812618.1|670027_672400_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	35.9	1.4e-10
WP_003622537.1|672396_672804_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003622540.1|672892_673699_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003622542.1|673713_674430_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	33.0	3.4e-16
WP_012812619.1|674436_675339_+	GTPase Era	NA	NA	NA	NA	NA
WP_003622547.1|675452_676190_+	UMP kinase	NA	NA	NA	NA	NA
WP_003622549.1|676296_676860_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003629090.1|676922_677663_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	41.7	4.2e-22
>prophage 48
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	696441	705611	2815241	tRNA	Synechococcus_phage(33.33%)	12	NA	NA
WP_012812630.1|696441_697380_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.4	7.1e-06
WP_012812631.1|697399_697960_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.4	8.4e-23
WP_035362006.1|698197_698707_+	Hsp20 family protein	NA	A0A222YXB4	Synechococcus_phage	34.3	4.7e-12
WP_003622604.1|698725_698992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003622606.1|699084_699705_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004448851.1|700050_700353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004448852.1|700385_701219_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003629116.1|701230_702052_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.1e-23
WP_004448853.1|702054_703161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004448854.1|703162_703900_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004448855.1|703896_704910_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5E465	Acinetobacter_phage	31.8	2.5e-17
WP_012812633.1|704957_705611_-	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	35.5	1.9e-13
>prophage 49
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	708910	713759	2815241		Liberibacter_phage(33.33%)	4	NA	NA
WP_004448861.1|708910_709564_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	29.7	6.0e-12
WP_004448863.1|709569_711003_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	30.8	2.2e-35
WP_004448865.1|710999_712184_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_012812637.1|712202_713759_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.3	4.2e-72
>prophage 50
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	733136	735059	2815241		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012812643.1|733136_735059_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	34.2	1.9e-69
>prophage 51
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	742016	755641	2815241		Pandoravirus(20.0%)	12	NA	NA
WP_012812649.1|742016_743018_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.1	3.7e-37
WP_012812650.1|743107_743878_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_003628446.1|744021_745506_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	2.6e-47
WP_004448917.1|745567_746014_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_012812651.1|746120_746975_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003628440.1|746991_748110_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012812652.1|748248_750816_-	ATP-dependent helicase HrpB	NA	A0A2K9L0J3	Tupanvirus	25.4	2.2e-25
WP_012812653.1|750915_751878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004448926.1|751999_752950_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003628432.1|753073_753391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812654.1|753395_754382_-	ornithine carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	26.1	6.9e-20
WP_012812655.1|754393_755641_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	1.7e-23
>prophage 52
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	760383	789805	2815241	transposase,tRNA	Streptococcus_phage(20.0%)	22	NA	NA
WP_004448936.1|760383_763299_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.6	1.5e-67
WP_003628414.1|763295_763811_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003628412.1|763857_764388_+	DUF3035 domain-containing protein	NA	NA	NA	NA	NA
WP_012812659.1|764405_766337_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.5	6.0e-92
WP_004448938.1|766455_767973_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_004448939.1|767997_768924_-	EamA family transporter	NA	NA	NA	NA	NA
WP_004448940.1|768993_771033_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	37.6	9.1e-107
WP_003628405.1|771139_771667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812660.1|772055_772583_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012812661.1|772707_773157_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_173328351.1|773296_774298_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.4	4.2e-73
WP_012812663.1|774401_775637_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003628397.1|775766_776108_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_012812664.1|776118_777774_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	24.3	2.2e-10
WP_012812665.1|777820_779851_-	VacB/RNase II family 3'-5' exoribonuclease	NA	Q0GXV6	Lactococcus_phage	28.1	6.2e-23
WP_004448953.1|779857_782551_-	type I DNA topoisomerase	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	31.8	1.5e-88
WP_012812666.1|782580_783225_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012812390.1|784026_785412_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812669.1|786276_786903_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	45.6	8.6e-16
WP_003628389.1|786933_787575_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012812670.1|787574_788867_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003628385.1|788863_789805_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	31.5	3.3e-27
>prophage 53
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	799672	804592	2815241		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_012812675.1|799672_801397_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.1e-39
WP_012812676.1|801462_802497_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003628367.1|802640_803126_-	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
WP_003628366.1|803302_804592_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	34.3	3.6e-53
>prophage 54
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	815001	871115	2815241	transposase,tail,holin,integrase,tRNA	Klosneuvirus(10.0%)	52	851600:851615	878764:878779
WP_003628349.1|815001_815907_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_004448985.1|815919_816609_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_012812683.1|816691_819337_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.0	4.7e-71
WP_003628343.1|819509_820013_-	GtrA family protein	NA	NA	NA	NA	NA
WP_012812684.1|820112_821240_-	OmpA family protein	NA	NA	NA	NA	NA
WP_050920457.1|821584_823375_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_004448996.1|823380_823719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004448999.1|823722_824643_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	2.6e-29
WP_003628331.1|824717_825674_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004449001.1|825730_826486_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004449003.1|826643_828269_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003628326.1|828289_830377_+	lysylphosphatidylglycerol synthetase family protein	NA	NA	NA	NA	NA
WP_003628324.1|830434_831172_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_012812686.1|831186_832008_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_012812687.1|832004_833111_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	2.0e-63
WP_003628319.1|833256_834330_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004449010.1|834339_835068_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003628317.1|835130_835628_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_012812688.1|835754_836387_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004449012.1|836433_837114_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_012812690.1|837110_837968_+	site-specific DNA-methyltransferase	NA	A0A0E3HGT7	Synechococcus_phage	44.2	6.8e-64
WP_012812691.1|838102_839530_+	heme-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012812692.1|839665_840298_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_012812693.1|840277_841492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812694.1|841502_842417_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_012812695.1|842556_843780_+	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012812696.1|843776_844568_+	ubiquinol-cytochrome c reductase	NA	NA	NA	NA	NA
WP_003628301.1|844554_845439_+	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_012812697.1|845481_846063_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_012812698.1|846205_846841_+	LysE family translocator	NA	NA	NA	NA	NA
WP_012812699.1|846851_847205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812700.1|847447_848098_-	oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB	NA	NA	NA	NA	NA
WP_012812701.1|848214_849114_-	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_012812702.1|849274_850693_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012812703.1|850781_851408_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
851600:851615	attL	TGGGTAATCCCCCCAT	NA	NA	NA	NA
WP_148194241.1|851671_852758_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	22.9	8.2e-06
WP_020944636.1|852996_853428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|853707_855093_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812706.1|855704_856139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627774.1|856534_856876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812707.1|856889_857603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812708.1|858567_859134_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.1e-25
WP_012812709.1|859332_859785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812710.1|859955_861512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812711.1|861971_863576_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012812712.1|863724_865029_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	43.1	3.4e-83
WP_012812713.1|865268_865523_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012812714.1|865519_865852_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012812715.1|865893_866199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812716.1|866945_867401_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2D1GQ71	Lysinibacillus_phage	46.3	3.5e-19
WP_012812717.1|868305_868620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812718.1|868982_871115_+|tail	tail protein	tail	A0A2R3UAN6	Myoviridae_environmental_samples	25.3	5.7e-19
878764:878779	attR	TGGGTAATCCCCCCAT	NA	NA	NA	NA
>prophage 55
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	874741	879892	2815241	transposase	Salmonella_phage(25.0%)	5	NA	NA
WP_012812721.1|874741_875860_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	27.2	1.0e-27
WP_012812356.1|876169_876529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012812355.1|876525_876873_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	2.7e-11
WP_012812354.1|876936_878547_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.5e-112
WP_110914157.1|878804_879892_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.7	2.0e-07
>prophage 56
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	885462	894451	2815241	protease	Wolbachia_phage(25.0%)	8	NA	NA
WP_012812734.1|885462_888024_+	DUF927 domain-containing protein	NA	Q9JMN6	Wolbachia_phage	41.8	1.6e-15
WP_012812735.1|888178_888670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812736.1|889203_890022_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	33.5	2.4e-34
WP_012812737.1|890081_891173_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_012812738.1|891269_891602_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003627279.1|891617_892601_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.3	5.8e-19
WP_003627278.1|892713_893448_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012812739.1|893464_894451_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.1	4.9e-50
>prophage 57
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	903293	905781	2815241		Bradyrhizobium_phage(50.0%)	3	NA	NA
WP_012812745.1|903293_903968_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	47.1	5.0e-46
WP_012812746.1|904127_904646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812747.1|904671_905781_-	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	25.1	1.2e-07
>prophage 58
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	910417	911500	2815241		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_003625164.1|910417_911500_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.4	3.1e-53
>prophage 59
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	939445	940420	2815241		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_012812759.1|939445_940420_-	D-glycerate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	27.9	4.7e-21
>prophage 60
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	950994	952278	2815241		Burkholderia_virus(100.0%)	1	NA	NA
WP_003622664.1|950994_952278_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.6	2.7e-48
>prophage 61
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	955995	959169	2815241		Leptospira_phage(100.0%)	1	NA	NA
WP_003622675.1|955995_959169_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.4	2.4e-50
>prophage 62
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	964856	975781	2815241		Phaeocystis_globosa_virus(33.33%)	5	NA	NA
WP_035362067.1|964856_969029_+	DNA-directed RNA polymerase subunit beta	NA	R4TQG3	Phaeocystis_globosa_virus	30.7	5.5e-26
WP_003622695.1|969122_973298_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.6e-63
WP_003622698.1|973637_974009_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_006116053.1|974023_974500_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003622701.1|974590_975781_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.1	7.6e-13
>prophage 63
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	986771	987440	2815241		Tenacibaculum_phage(100.0%)	1	NA	NA
WP_003622746.1|986771_987440_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	28.2	3.0e-11
>prophage 64
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	991964	992783	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_003622762.1|991964_992783_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	1.0e-29
>prophage 65
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1004818	1006566	2815241		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_012812774.1|1004818_1005466_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	36.5	4.7e-17
WP_173328355.1|1005486_1006566_+	site-specific DNA-methyltransferase	NA	S5Y7I7	Mycobacterium_phage	26.5	6.6e-16
>prophage 66
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1014966	1018011	2815241	tRNA	Agrobacterium_phage(50.0%)	2	NA	NA
WP_012812780.1|1014966_1016160_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	35.1	8.6e-41
WP_012812781.1|1016217_1018011_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	5.1e-53
>prophage 67
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1022659	1024105	2815241		Moraxella_phage(100.0%)	1	NA	NA
WP_003622806.1|1022659_1024105_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.6	2.8e-30
>prophage 68
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1034729	1042118	2815241		Caulobacter_phage(33.33%)	7	NA	NA
WP_003622829.1|1034729_1036571_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.0	7.4e-84
WP_003622831.1|1036716_1038708_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	6.3e-36
WP_012812788.1|1038697_1039279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003622834.1|1039445_1039907_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003622836.1|1039913_1040189_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003622838.1|1040200_1040806_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_012812789.1|1040906_1042118_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	35.2	5.3e-46
>prophage 69
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1051425	1053276	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_012812791.1|1051425_1053276_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.3e-24
>prophage 70
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1060573	1062178	2815241		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_012812798.1|1060573_1062178_-	tetratricopeptide repeat protein	NA	F2Y1J7	Organic_Lake_phycodnavirus	23.1	2.4e-09
>prophage 71
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1066439	1067222	2815241		Planktothrix_phage(100.0%)	1	NA	NA
WP_003628152.1|1066439_1067222_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.9	1.5e-25
>prophage 72
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1070982	1074942	2815241	protease	Feldmannia_irregularis_virus(50.0%)	3	NA	NA
WP_012812803.1|1070982_1072983_+	response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	29.8	1.6e-10
WP_012812804.1|1073029_1073629_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003622882.1|1073628_1074942_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	31.2	1.3e-42
>prophage 73
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1080056	1119997	2815241	tRNA	Caulobacter_phage(14.29%)	37	NA	NA
WP_003622896.1|1080056_1081529_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.8	1.9e-53
WP_003622898.1|1081750_1081951_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003622900.1|1081965_1082325_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003622905.1|1082489_1083560_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.1	1.2e-28
WP_003622907.1|1083563_1086023_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012812806.1|1086043_1087090_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SY86	Cyanophage	34.8	4.0e-42
WP_012812807.1|1087188_1088892_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012812808.1|1089014_1089407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812809.1|1089521_1092122_+	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	26.2	8.8e-06
WP_012812810.1|1092202_1092754_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_003622919.1|1093026_1093644_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_012812811.1|1093743_1095291_+	peptide chain release factor 3	NA	E4ZFJ7	Streptococcus_phage	29.0	6.6e-33
WP_012812812.1|1095309_1096047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003622925.1|1096144_1097176_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_012812813.1|1097273_1099055_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.2	9.1e-95
WP_012812814.1|1099095_1100016_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012812815.1|1100015_1102247_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.0	1.7e-106
WP_012812816.1|1102292_1103117_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012812817.1|1103128_1103878_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012812818.1|1103911_1105081_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003622939.1|1105077_1105626_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	1.2e-16
WP_003622940.1|1105670_1105877_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_003622942.1|1106116_1106281_+	YdcH family protein	NA	NA	NA	NA	NA
WP_012812819.1|1106350_1106941_-	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_012812820.1|1107184_1107691_-	Hsp20 family protein	NA	A0A218MMV3	uncultured_virus	37.6	9.3e-21
WP_003622947.1|1107873_1108104_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012812821.1|1108393_1108873_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_012812822.1|1108940_1109363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003622951.1|1109437_1110388_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.5	3.9e-28
WP_012812823.1|1110400_1111966_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003622954.1|1112201_1113182_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003622955.1|1113380_1115312_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	62.4	6.6e-216
WP_012812824.1|1115385_1116405_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	54.9	8.3e-101
WP_012812825.1|1116410_1117166_-	methyltransferase	NA	NA	NA	NA	NA
WP_003622958.1|1117283_1118354_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.1	6.8e-05
WP_012812826.1|1118367_1119237_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_012812827.1|1119241_1119997_-	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	30.1	1.1e-12
>prophage 74
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1123038	1123770	2815241		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003622974.1|1123038_1123770_-	metallophosphoesterase	NA	A0A2L0UZN4	Agrobacterium_phage	31.1	3.8e-23
>prophage 75
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1133171	1134269	2815241		Erwinia_phage(100.0%)	1	NA	NA
WP_012812833.1|1133171_1134269_-	PhoH family protein	NA	A0A223LII3	Erwinia_phage	47.0	5.3e-45
>prophage 76
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1149750	1151049	2815241		Klosneuvirus(100.0%)	1	NA	NA
WP_003623008.1|1149750_1151049_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	2.2e-13
>prophage 77
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1154407	1158550	2815241		Lactococcus_phage(50.0%)	5	NA	NA
WP_003623014.1|1154407_1155058_-	transcriptional repressor LexA	NA	Q38327	Lactococcus_phage	27.3	7.5e-07
WP_012812839.1|1155144_1156419_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003623017.1|1156488_1156656_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003623018.1|1156769_1157099_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_012812840.1|1157269_1158550_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	60.9	3.0e-140
>prophage 78
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1170049	1179612	2815241		Pandoravirus(20.0%)	9	NA	NA
WP_012812848.1|1170049_1171495_+	cytochrome d ubiquinol oxidase subunit I	NA	S4W1T5	Pandoravirus	26.0	2.9e-14
WP_003623448.1|1171525_1173442_-	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	29.2	1.1e-16
WP_003623450.1|1173455_1174463_-	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	31.2	4.1e-36
WP_012812849.1|1174551_1175172_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_003623453.1|1175223_1175562_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003623454.1|1175561_1176134_+	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_012812850.1|1176114_1176816_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003623457.1|1177312_1178203_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	9.5e-69
WP_003623458.1|1178202_1179612_+	phosphomannomutase/phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.4	1.3e-08
>prophage 79
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1201793	1207019	2815241	tRNA	Synechococcus_phage(25.0%)	5	NA	NA
WP_003623507.1|1201793_1202660_+	SPOR domain-containing protein	NA	H2BCY4	Synechococcus_phage	43.1	9.4e-05
WP_012812868.1|1202666_1203887_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	35.0	5.5e-51
WP_012812869.1|1203890_1204535_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	37.7	5.5e-26
WP_012812870.1|1204539_1205484_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_012812871.1|1205480_1207019_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	40.5	1.2e-98
>prophage 80
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1211313	1216606	2815241		Pandoravirus(33.33%)	6	NA	NA
WP_003623525.1|1211313_1212384_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	2.0e-81
WP_003623526.1|1212401_1212836_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012812875.1|1212913_1214623_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004449082.1|1214671_1215220_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_004449084.1|1215212_1215953_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	48.0	1.2e-56
WP_012812876.1|1215955_1216606_-	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	30.6	2.6e-07
>prophage 81
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1220039	1221920	2815241		Brazilian_marseillevirus(100.0%)	1	NA	NA
WP_012812880.1|1220039_1221920_+	adenylyl-sulfate kinase	NA	A0A142CJQ8	Brazilian_marseillevirus	29.5	4.8e-38
>prophage 82
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1238229	1244602	2815241	transposase,integrase	Escherichia_phage(25.0%)	6	1234821:1234835	1251385:1251399
1234821:1234835	attL	GCTGCTTCTGCCACA	NA	NA	NA	NA
WP_003630649.1|1238229_1238823_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	40.3	1.7e-26
WP_012812886.1|1238941_1240441_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N7ACC7	Bacillus_phage	22.0	2.1e-12
WP_012813374.1|1240440_1241265_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004449120.1|1241872_1242934_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_003628822.1|1243379_1243991_+	CspA family cold shock protein	NA	A0A1W6JNX5	Morganella_phage	49.3	9.6e-12
WP_003628823.1|1244095_1244602_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.7	9.0e-24
1251385:1251399	attR	TGTGGCAGAAGCAGC	NA	NA	NA	NA
>prophage 83
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1248656	1249916	2815241		Catovirus(100.0%)	1	NA	NA
WP_004449129.1|1248656_1249916_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	44.9	4.6e-101
>prophage 84
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1258393	1268027	2815241		Pseudomonas_phage(33.33%)	10	NA	NA
WP_004449144.1|1258393_1260598_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.2	7.4e-163
WP_004449146.1|1260594_1261296_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003630617.1|1261292_1261664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630619.1|1261660_1261903_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_004449150.1|1261931_1262699_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	41.7	1.7e-45
WP_012812894.1|1262852_1264202_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.5	1.8e-18
WP_003630625.1|1264373_1264985_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	34.4	4.1e-15
WP_012812895.1|1265043_1267020_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	9.3e-08
WP_004449156.1|1267021_1267498_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_012812896.1|1267514_1268027_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	50.7	3.6e-28
>prophage 85
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1275934	1280127	2815241		Acinetobacter_phage(75.0%)	4	NA	NA
WP_003625537.1|1275934_1276801_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	8.4e-54
WP_003625535.1|1276818_1277931_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.0	2.9e-43
WP_003625532.1|1277930_1278527_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.6	1.2e-59
WP_003625530.1|1278585_1280127_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	30.7	4.5e-34
>prophage 86
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1283543	1303108	2815241	tRNA	Bacillus_virus(33.33%)	15	NA	NA
WP_003625521.1|1283543_1285178_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.8	2.5e-152
WP_003629962.1|1285174_1286008_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.6	1.3e-51
WP_003625516.1|1286119_1288558_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	36.0	7.0e-114
WP_012812905.1|1288648_1289797_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003629958.1|1289842_1290967_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	43.3	8.6e-67
WP_012812906.1|1291082_1292516_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_012812907.1|1292856_1293126_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_012812908.1|1293263_1294103_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	31.4	1.6e-25
WP_003625501.1|1294132_1294915_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003625499.1|1294926_1296156_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	9.8e-40
WP_003625497.1|1296191_1296671_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	60.0	4.7e-38
WP_012812909.1|1296667_1298416_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003625493.1|1298431_1299787_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	1.0e-29
WP_012812910.1|1299799_1300336_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012812911.1|1300414_1303108_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.6	8.2e-140
>prophage 87
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1318808	1324568	2815241		Bacillus_phage(66.67%)	4	NA	NA
WP_003624302.1|1318808_1320689_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.4	4.0e-77
WP_003624304.1|1320693_1321071_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012812918.1|1321149_1322844_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.7	4.2e-17
WP_012812919.1|1322846_1324568_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.6	1.2e-24
>prophage 88
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1328872	1333929	2815241		Tupanvirus(50.0%)	3	NA	NA
WP_012812921.1|1328872_1330681_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	24.1	9.7e-28
WP_012812922.1|1330746_1332798_+	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
WP_003624320.1|1332813_1333929_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	31.9	2.1e-36
>prophage 89
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1341009	1341801	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_003624329.1|1341009_1341801_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	6.1e-27
>prophage 90
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1353318	1358635	2815241		Acinetobacter_phage(66.67%)	3	NA	NA
WP_012812937.1|1353318_1355664_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	51.6	1.1e-212
WP_012812938.1|1355656_1357138_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	43.8	3.3e-98
WP_012812939.1|1357174_1358635_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.3	4.8e-25
>prophage 91
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1370873	1373609	2815241		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003624464.1|1370873_1373609_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	3.9e-20
>prophage 92
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1384014	1385247	2815241		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003624476.1|1384014_1385247_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	45.2	5.9e-69
>prophage 93
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1388351	1390487	2815241		Tupanvirus(100.0%)	1	NA	NA
WP_003624480.1|1388351_1390487_-	catalase	NA	A0A2K9L572	Tupanvirus	49.3	3.7e-135
>prophage 94
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1406792	1408553	2815241		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_012812964.1|1406792_1408553_+	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.6	2.0e-09
>prophage 95
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1434113	1434867	2815241	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_087651418.1|1434113_1434867_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
>prophage 96
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1448327	1449074	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_012812992.1|1448327_1449074_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	8.6e-23
>prophage 97
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1455502	1456257	2815241	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_087651418.1|1455502_1456257_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
>prophage 98
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1523955	1525434	2815241		Klosneuvirus(100.0%)	1	NA	NA
WP_012813073.1|1523955_1525434_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	2.1e-97
>prophage 99
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1529313	1531322	2815241		Planktothrix_phage(100.0%)	2	NA	NA
WP_003623891.1|1529313_1530345_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	3.8e-13
WP_003623893.1|1530341_1531322_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	8.7e-15
>prophage 100
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1566790	1570167	2815241		Bacillus_phage(100.0%)	2	NA	NA
WP_014456884.1|1566790_1568482_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.7	5.0e-18
WP_014456885.1|1568478_1570167_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	32.6	3.8e-26
>prophage 101
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1586144	1659900	2815241	transposase	Streptococcus_phage(33.33%)	58	NA	NA
WP_012812320.1|1586144_1587530_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.1e-31
WP_082179758.1|1587587_1587860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004449339.1|1588224_1589847_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	5.1e-60
WP_004449342.1|1590013_1590958_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014456897.1|1591204_1591402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812583.1|1591544_1592930_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_014456898.1|1593254_1595495_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_014456899.1|1595972_1598486_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	40.6	2.8e-17
WP_014456900.1|1598585_1599656_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	4.8e-75
WP_012813230.1|1599861_1601247_+|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_014456901.1|1601696_1602161_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003626699.1|1602269_1602773_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014456902.1|1602972_1603542_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014456903.1|1603506_1604220_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_041632502.1|1604429_1604711_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014456904.1|1604717_1605434_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_014456905.1|1605430_1606603_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_012812390.1|1606915_1608301_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_014456908.1|1610123_1611401_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_014456909.1|1611960_1612482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014456910.1|1612600_1613314_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014456911.1|1613376_1614009_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014456912.1|1614168_1614930_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014456913.1|1614959_1615400_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_014456914.1|1615497_1615944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630930.1|1616147_1617524_+	MFS transporter	NA	NA	NA	NA	NA
WP_014456915.1|1617706_1619374_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_014456916.1|1619598_1620141_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_014456917.1|1620137_1620842_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_014456918.1|1621210_1622554_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_148194242.1|1622725_1623813_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.7	2.0e-07
WP_014456920.1|1624158_1625124_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_082179769.1|1625278_1625767_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014456922.1|1626284_1626410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456923.1|1626608_1627313_-	VIT family protein	NA	NA	NA	NA	NA
WP_014456924.1|1627446_1628799_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003626138.1|1628795_1629467_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012813264.1|1629466_1632541_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012813265.1|1632540_1633695_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006115452.1|1633691_1634927_-	TolC family protein	NA	NA	NA	NA	NA
WP_012813266.1|1634945_1635416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041632680.1|1636021_1636363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627217.1|1640441_1640585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625325.1|1643105_1644236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014456925.1|1644235_1646002_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_003625320.1|1646133_1646385_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_014456926.1|1646391_1647606_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	D2TEZ5	Emiliania_huxleyi_virus	29.6	8.8e-33
WP_014456927.1|1647611_1648565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456928.1|1648589_1649570_-	acylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_014456929.1|1649665_1650616_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014456930.1|1650612_1651812_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_014456931.1|1651808_1652903_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_003625306.1|1652899_1653688_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_014456932.1|1653684_1654491_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_014456933.1|1654504_1655203_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_014456934.1|1655285_1656662_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_014456935.1|1656661_1658485_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	38.4	1.6e-102
WP_012812328.1|1658649_1659900_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
>prophage 102
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1666329	1667052	2815241		Planktothrix_phage(100.0%)	1	NA	NA
WP_003630513.1|1666329_1667052_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	4.3e-35
>prophage 103
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1686689	1691892	2815241	protease	Burkholderia_phage(25.0%)	4	NA	NA
WP_003624117.1|1686689_1686977_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	55.6	3.2e-18
WP_014456949.1|1687122_1689645_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.5	8.9e-205
WP_014456950.1|1689843_1691109_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.8	1.2e-130
WP_014456951.1|1691229_1691892_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	3.6e-57
>prophage 104
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1695884	1703672	2815241		Diachasmimorpha_longicaudata_entomopoxvirus(25.0%)	8	NA	NA
WP_014456953.1|1695884_1697795_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	5.6e-50
WP_014456954.1|1697803_1699102_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_014456955.1|1699055_1699424_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	35.8	6.8e-13
WP_014456956.1|1699450_1699939_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_014456957.1|1699925_1700378_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_014456958.1|1700374_1701622_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	3.8e-100
WP_014456959.1|1701621_1702884_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003624093.1|1702901_1703672_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.4	8.6e-10
>prophage 105
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1711245	1716127	2815241		Streptococcus_phage(50.0%)	4	NA	NA
WP_014456963.1|1711245_1713333_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	2.6e-61
WP_003624085.1|1713562_1713868_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003624084.1|1713985_1714279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456964.1|1714375_1716127_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.3	8.5e-45
>prophage 106
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1720181	1722836	2815241		Indivirus(100.0%)	1	NA	NA
WP_014456967.1|1720181_1722836_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	34.7	3.8e-28
>prophage 107
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1729173	1730439	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_014456972.1|1729173_1730439_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.9	2.2e-47
>prophage 108
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1741066	1745695	2815241		Orpheovirus(33.33%)	5	NA	NA
WP_014456981.1|1741066_1742014_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.1	5.5e-67
WP_014456982.1|1742130_1743012_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014456983.1|1743471_1743978_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.0	2.5e-21
WP_003624040.1|1744126_1744441_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_014456984.1|1744441_1745695_-	UdgX family uracil-DNA binding protein	NA	A0A2I6PIA1	Pseudomonas_phage	29.6	5.9e-08
>prophage 109
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1749636	1749957	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_003623929.1|1749636_1749957_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	33.7	6.1e-10
>prophage 110
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1755401	1758258	2815241		Bacillus_phage(33.33%)	5	NA	NA
WP_014456990.1|1755401_1756124_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	1.2e-26
WP_014456991.1|1756113_1756635_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014456992.1|1756653_1757313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456993.1|1757316_1757841_-	peptide deformylase	NA	A0A2I7QMX1	Vibrio_phage	33.6	1.5e-13
WP_003623949.1|1758054_1758258_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	47.6	1.3e-05
>prophage 111
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1769946	1771308	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_014457001.1|1769946_1771308_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.4	3.7e-72
>prophage 112
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1783290	1795528	2815241		Organic_Lake_phycodnavirus(25.0%)	10	NA	NA
WP_014457011.1|1783290_1785051_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	23.2	2.6e-17
WP_014457012.1|1785134_1786010_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003623988.1|1786006_1786426_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_014457013.1|1786432_1787620_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_014457014.1|1787804_1789262_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	51.1	4.6e-121
WP_014457015.1|1789327_1789993_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_014457016.1|1790173_1791049_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014457017.1|1790997_1791852_-	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_003629595.1|1792047_1792656_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	4.2e-36
WP_003624005.1|1792912_1795528_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.6	2.9e-118
>prophage 113
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1799352	1887994	2815241	transposase,tRNA	Streptococcus_phage(25.0%)	62	NA	NA
WP_014457019.1|1799352_1801617_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	21.2	3.4e-06
WP_003624017.1|1801626_1803069_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_014457020.1|1803125_1804235_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	8.6e-11
WP_014457021.1|1804231_1805302_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003629590.1|1805386_1806541_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_014457022.1|1806602_1807577_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	49.5	4.4e-75
WP_014457023.1|1807855_1809682_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014457024.1|1809756_1811931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457025.1|1812085_1813237_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.8	2.9e-78
WP_014457026.1|1813375_1815151_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014457027.1|1815351_1815657_-	ETC complex I subunit	NA	NA	NA	NA	NA
WP_014457028.1|1815819_1816302_-	xanthine phosphoribosyltransferase	NA	M4T1R9	Cellulophaga_phage	26.4	6.6e-08
WP_014457029.1|1816361_1817747_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014457030.1|1817831_1818500_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014457031.1|1818539_1818791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457032.1|1818882_1819128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457033.1|1819266_1820607_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.0	4.0e-71
WP_014457034.1|1820892_1822110_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	39.5	1.5e-69
WP_003625731.1|1822240_1822579_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003625733.1|1822663_1823533_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014457035.1|1823535_1824786_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_003625736.1|1825143_1825719_+	DedA family protein	NA	NA	NA	NA	NA
WP_003625737.1|1825834_1826347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457036.1|1826539_1827097_+	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_050920473.1|1828587_1828803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081380874.1|1828849_1829185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625750.1|1831535_1832102_+	elongation factor P	NA	NA	NA	NA	NA
WP_014457039.1|1832147_1832975_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_014457040.1|1833086_1836065_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	32.6	3.3e-09
WP_003625755.1|1836083_1836287_-	cold-shock protein	NA	A0A218MMZ6	uncultured_virus	51.5	1.3e-13
WP_014457041.1|1836430_1837099_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_026019247.1|1837309_1837603_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	58.1	1.4e-21
WP_003625762.1|1837656_1839297_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.0	2.8e-175
WP_014457043.1|1839591_1841796_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_012812356.1|1842037_1842397_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012812355.1|1842393_1842741_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	2.7e-11
WP_012812354.1|1842804_1844415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.5e-112
WP_012813179.1|1844603_1845683_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014457655.1|1845837_1847652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148194243.1|1847790_1848878_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	22.9	8.2e-06
WP_012813229.1|1849094_1850480_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_014457047.1|1851580_1852312_-	dTDP-glucose pyrophosphorylase	NA	A0A222YY90	Synechococcus_phage	28.1	9.1e-09
WP_014457048.1|1852326_1853910_-	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	29.1	1.5e-40
WP_014457049.1|1853925_1854339_-	phosphatase IIIC	NA	M4QRS4	Synechococcus_phage	41.5	1.8e-17
WP_148087460.1|1855012_1855183_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012812390.1|1855897_1857283_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_014457051.1|1857488_1857875_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_124307056.1|1858198_1858888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812583.1|1860122_1861508_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_014457053.1|1862486_1864175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041632520.1|1864201_1865095_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	53.8	3.0e-86
WP_014457055.1|1865091_1866150_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.6	1.8e-95
WP_012812328.1|1869682_1870933_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_082179761.1|1872614_1874000_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.9e-31
WP_014457499.1|1874283_1875669_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	3.8e-32
WP_014457062.1|1877479_1878970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|1879997_1881383_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812354.1|1881645_1883256_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.5e-112
WP_012812355.1|1883319_1883667_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	2.7e-11
WP_012812356.1|1883663_1884023_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014457065.1|1885072_1886464_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_014457066.1|1886530_1887994_-	discoidin domain-containing protein	NA	A0A0P0YM34	Yellowstone_lake_phycodnavirus	26.9	2.9e-14
>prophage 114
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1892781	1893729	2815241		Brevibacillus_phage(100.0%)	1	NA	NA
WP_014457071.1|1892781_1893729_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	25.9	1.3e-20
>prophage 115
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1899758	1903997	2815241		Hokovirus(50.0%)	4	NA	NA
WP_014457077.1|1899758_1901258_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.0	3.0e-51
WP_003624541.1|1901542_1902751_+	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_003624542.1|1902871_1903342_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003630067.1|1903385_1903997_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	48.9	1.7e-45
>prophage 116
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1920681	1924168	2815241		Staphylococcus_phage(75.0%)	4	NA	NA
WP_003630055.1|1920681_1921167_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.3	9.6e-23
WP_014457085.1|1921203_1922517_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.0	1.8e-79
WP_041632521.1|1922531_1923134_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.2	8.5e-21
WP_014457087.1|1923115_1924168_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.7	5.3e-18
>prophage 117
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1930353	1931712	2815241		Moraxella_phage(100.0%)	1	NA	NA
WP_014457094.1|1930353_1931712_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	1.4e-34
>prophage 118
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1939041	1947517	2815241	transposase,integrase	Ralstonia_phage(33.33%)	5	1927580:1927593	1947609:1947622
1927580:1927593	attL	GAATTGTCAAAATT	NA	NA	NA	NA
WP_014457098.1|1939041_1939719_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	40.6	2.8e-36
WP_014457099.1|1940601_1940835_+	DNA damage-inducible protein	NA	NA	NA	NA	NA
WP_050818279.1|1940892_1942278_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.2e-32
WP_014457101.1|1942420_1942600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457660.1|1942609_1947517_+	DEAD/DEAH box helicase	NA	A0A2H4UVA3	Bodo_saltans_virus	25.1	6.1e-32
1947609:1947622	attR	AATTTTGACAATTC	NA	NA	NA	NA
>prophage 119
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1950860	1951948	2815241	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_148194241.1|1950860_1951948_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	22.9	8.2e-06
>prophage 120
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1955897	1961226	2815241		Streptococcus_phage(25.0%)	6	NA	NA
WP_003623044.1|1955897_1957025_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	1.1e-56
WP_014457109.1|1957028_1957682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003623048.1|1957705_1957978_-	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	61.0	2.1e-19
WP_003623052.1|1958073_1959708_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.7	1.7e-68
WP_014457110.1|1959704_1960151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457111.1|1960167_1961226_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	34.9	1.2e-25
>prophage 121
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1985683	1992797	2815241		Sphingobium_phage(33.33%)	5	NA	NA
WP_014457125.1|1985683_1987741_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	39.7	1.3e-113
WP_014457126.1|1987964_1990640_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	43.1	1.1e-91
WP_003623092.1|1990690_1991515_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014457127.1|1991566_1992025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003623097.1|1992197_1992797_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.1	1.5e-22
>prophage 122
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	1998010	2002357	2815241		Tupanvirus(50.0%)	3	NA	NA
WP_014457131.1|1998010_1998640_+	nicotinamidase	NA	A0A2K9L6K4	Tupanvirus	42.0	6.6e-24
WP_014457132.1|1998674_1999979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457133.1|1999984_2002357_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	9.5e-124
>prophage 123
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2007432	2009283	2815241		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_014457138.1|2007432_2009283_-	biosynthetic-type acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	28.5	7.6e-52
>prophage 124
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2012648	2013851	2815241		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003623128.1|2012648_2013851_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.0	1.6e-47
>prophage 125
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2017397	2018690	2815241		Aeromonas_phage(100.0%)	1	NA	NA
WP_014457146.1|2017397_2018690_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.9	9.5e-102
>prophage 126
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2022331	2024560	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_014457150.1|2022331_2024560_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.1	2.2e-90
>prophage 127
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2030142	2034944	2815241		Pandoravirus(50.0%)	2	NA	NA
WP_014457155.1|2030142_2031522_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	39.3	4.9e-40
WP_014457156.1|2031524_2034944_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	37.1	1.9e-189
>prophage 128
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2041451	2042015	2815241		Virus_Rctr197k(100.0%)	1	NA	NA
WP_014457162.1|2041451_2042015_+	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	38.4	5.0e-23
>prophage 129
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2045353	2047801	2815241		Moumouvirus(50.0%)	2	NA	NA
WP_035362113.1|2045353_2045776_-	nucleoside-diphosphate kinase	NA	A0A2P1ELL9	Moumouvirus	36.6	4.6e-13
WP_014457165.1|2045911_2047801_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	33.3	6.1e-73
>prophage 130
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2051811	2117287	2815241	portal,terminase,tail,integrase,capsid,protease,head,tRNA	Pseudomonas_phage(17.65%)	66	2043069:2043084	2114133:2114148
2043069:2043084	attL	GCTCTGCGCCCTGCCC	NA	NA	NA	NA
WP_035351884.1|2051811_2052348_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.6	1.1e-14
WP_041632531.1|2052504_2054436_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.1	3.8e-115
WP_014457170.1|2054481_2055438_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014457171.1|2055434_2056298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457172.1|2056386_2057616_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014457173.1|2057665_2058481_+	NAD kinase	NA	NA	NA	NA	NA
WP_014457174.1|2058477_2059497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457175.1|2059508_2061026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628598.1|2061057_2061552_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	55.2	2.0e-36
WP_003623208.1|2061535_2062510_-	homoserine kinase	NA	NA	NA	NA	NA
WP_026019375.1|2062519_2063521_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_014457176.1|2063742_2064348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457177.1|2064402_2065770_-	AarF/ABC1/UbiB kinase family protein	NA	NA	NA	NA	NA
WP_014457178.1|2065772_2067710_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_014457179.1|2067771_2072328_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014457180.1|2072327_2073776_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014457181.1|2073970_2074924_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_014457182.1|2075332_2076271_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014457183.1|2076234_2077134_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	49.0	6.8e-14
WP_014457184.1|2077468_2080462_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_003623222.1|2080502_2080646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628608.1|2080607_2081369_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014457185.1|2081383_2082697_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_003623225.1|2082771_2082990_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_014457186.1|2082994_2083627_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014457187.1|2083623_2084709_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_003628614.1|2084705_2084891_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_014457188.1|2085135_2085345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457189.1|2085421_2086114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162010037.1|2086178_2086337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457191.1|2086379_2086838_-	lysozyme	NA	E5E3Z4	Acinetobacter_phage	41.9	1.3e-18
WP_014457192.1|2087424_2087637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457193.1|2087702_2088458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457194.1|2088454_2089207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457195.1|2089206_2089989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457196.1|2089990_2091622_-	hypothetical protein	NA	B0VK48	Azospirillum_phage	29.8	4.5e-24
WP_014457197.1|2091618_2097501_-|tail	phage tail length tape measure family protein	tail	NA	NA	NA	NA
WP_014457198.1|2097493_2098225_-	hypothetical protein	NA	F8TVA4	EBPR_siphovirus	29.1	4.8e-10
WP_014457199.1|2098228_2098603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457200.1|2098626_2099061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457201.1|2099153_2100395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457202.1|2100436_2100883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457203.1|2100879_2101320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457204.1|2101319_2101643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457205.1|2101639_2102284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457206.1|2102295_2103534_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	46.2	9.4e-91
WP_014457207.1|2103603_2104455_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	39.3	2.1e-17
WP_014457208.1|2104447_2105782_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	46.5	5.9e-91
WP_014457209.1|2105778_2107572_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	54.2	1.6e-171
WP_014457210.1|2107561_2108158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457211.1|2108357_2108687_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_014457212.1|2108683_2109316_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	48.1	4.0e-45
WP_014457213.1|2109353_2110229_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.9	1.1e-08
WP_014457214.1|2110378_2110783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041632739.1|2110890_2111085_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_014457215.1|2111110_2111311_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_041632532.1|2111307_2111568_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_014457216.1|2111999_2112329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457217.1|2112325_2113030_+	hypothetical protein	NA	A0A0B5A507	Paenibacillus_phage	54.1	2.0e-29
WP_014457218.1|2112989_2113493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457219.1|2113513_2113765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457220.1|2113761_2114919_-	hypothetical protein	NA	NA	NA	NA	NA
2114133:2114148	attR	GCTCTGCGCCCTGCCC	NA	NA	NA	NA
WP_014457221.1|2114911_2115406_-	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	35.2	7.5e-07
WP_014457222.1|2115490_2116027_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.8	1.3e-17
WP_082179763.1|2116237_2116453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014457223.1|2116537_2117287_+	transcriptional regulator	NA	A0A1B0V350	Roseobacter_phage	32.2	8.4e-10
>prophage 131
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2122455	2125799	2815241	integrase	Burkholderia_phage(33.33%)	5	2119334:2119347	2125486:2125499
2119334:2119347	attL	AGCACATCTCTGGA	NA	NA	NA	NA
WP_014457231.1|2122455_2122680_+	hypothetical protein	NA	I6NLI2	Burkholderia_phage	51.7	1.2e-09
WP_014457232.1|2122680_2123688_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	40.1	4.2e-49
WP_014457233.1|2124237_2124708_+	cytochrome c	NA	NA	NA	NA	NA
WP_003625801.1|2124777_2124996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457234.1|2125037_2125799_-	glucose 1-dehydrogenase	NA	M1NMS3	Moumouvirus	34.1	7.2e-09
2125486:2125499	attR	TCCAGAGATGTGCT	NA	NA	NA	NA
>prophage 132
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2143085	2143658	2815241		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014457248.1|2143085_2143658_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.5	2.7e-16
>prophage 133
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2148926	2151398	2815241		Acinetobacter_phage(100.0%)	1	NA	NA
WP_014457256.1|2148926_2151398_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	37.8	1.2e-12
>prophage 134
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2176250	2180630	2815241	transposase	Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_003625223.1|2176250_2177105_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.2	1.1e-61
WP_041632544.1|2177153_2178941_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_014457275.1|2179062_2179467_-	monooxygenase	NA	NA	NA	NA	NA
WP_088365001.1|2179543_2180630_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	7.4e-07
>prophage 135
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2188181	2189269	2815241	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_148194244.1|2188181_2189269_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.7	5.7e-07
>prophage 136
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2203218	2207833	2815241	tRNA	uncultured_Mediterranean_phage(100.0%)	5	NA	NA
WP_014457288.1|2203218_2204487_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.0	2.3e-84
WP_003624388.1|2204505_2205321_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	47.5	1.3e-53
WP_158301030.1|2205317_2205986_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_014457290.1|2206058_2206925_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.8	5.0e-30
WP_014457291.1|2206921_2207833_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.0	3.9e-25
>prophage 137
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2221578	2222259	2815241	protease	Agrobacterium_phage(100.0%)	1	NA	NA
WP_014457301.1|2221578_2222259_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	36.7	2.1e-31
>prophage 138
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2227228	2242203	2815241		Bacillus_phage(16.67%)	11	NA	NA
WP_014457305.1|2227228_2229061_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.7	5.2e-53
WP_014457306.1|2229151_2230111_-	RNA polymerase sigma factor RpoH	NA	G8CLC7	Synechococcus_phage	28.8	1.7e-15
WP_014457307.1|2230360_2231374_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_158301031.1|2231421_2232540_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_014457309.1|2232536_2233349_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	7.5e-12
WP_014457310.1|2233369_2234833_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.7	4.3e-50
WP_014457311.1|2235113_2236214_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_014457312.1|2236402_2239204_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.2	2.2e-58
WP_014457313.1|2239208_2239829_+	SCO family protein	NA	NA	NA	NA	NA
WP_014457314.1|2239925_2240672_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003629355.1|2240742_2242203_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.8	3.4e-55
>prophage 139
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2258136	2259486	2815241		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014457322.1|2258136_2259486_-	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	29.4	1.2e-11
>prophage 140
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2265152	2267174	2815241	transposase	Stx2-converting_phage(50.0%)	2	NA	NA
WP_012812354.1|2265152_2266763_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.8	1.5e-112
WP_012812355.1|2266826_2267174_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	2.7e-11
>prophage 141
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2286756	2291664	2815241		Mycobacterium_phage(50.0%)	5	NA	NA
WP_014457344.1|2286756_2287917_+	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	25.5	7.9e-07
WP_003626381.1|2288020_2288389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041632549.1|2288757_2289972_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003626378.1|2290025_2290700_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003626376.1|2290680_2291664_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-27
>prophage 142
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2317087	2320606	2815241	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_087651418.1|2317087_2317842_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_014457370.1|2318413_2319544_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014457371.1|2319586_2320606_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	4.9e-29
>prophage 143
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2326075	2326759	2815241		Synechococcus_phage(100.0%)	1	NA	NA
WP_003623680.1|2326075_2326759_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	28.9	2.5e-16
>prophage 144
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2348783	2349902	2815241		Faustovirus(100.0%)	1	NA	NA
WP_014457394.1|2348783_2349902_-	threonine-phosphate decarboxylase	NA	A0A142C026	Faustovirus	22.0	4.9e-06
>prophage 145
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2365977	2368283	2815241		Enterobacteria_phage(50.0%)	3	NA	NA
WP_014457407.1|2365977_2366481_+	flavin reductase	NA	Q9KX93	Enterobacteria_phage	52.7	7.1e-21
WP_014457408.1|2366682_2367477_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014457409.1|2367476_2368283_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	8.5e-16
>prophage 146
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2374590	2388934	2815241	transposase	Streptococcus_phage(28.57%)	16	NA	NA
WP_003623602.1|2374590_2375631_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	40.9	1.0e-45
WP_014457417.1|2375703_2377305_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.1	3.5e-13
WP_003623600.1|2377524_2377977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041632556.1|2378387_2378576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457418.1|2378995_2379565_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.0	9.8e-27
WP_014457419.1|2379813_2381709_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.0	2.2e-54
WP_014457420.1|2381713_2382775_-	toprim domain-containing protein	NA	A0A0U4B0G9	Pseudomonas_phage	42.0	1.7e-19
WP_014457421.1|2382761_2383364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457422.1|2383360_2383666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014457423.1|2383784_2385023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457424.1|2385019_2385391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|2385549_2386303_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_014457425.1|2386234_2386696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457426.1|2386692_2386956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457427.1|2387121_2387334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014457429.1|2388322_2388934_+	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	49.4	2.2e-32
>prophage 147
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2394447	2402436	2815241	integrase	Salmonella_phage(33.33%)	6	2391224:2391239	2406092:2406107
2391224:2391239	attL	GGTGCCGGTTGATTGG	NA	NA	NA	NA
WP_014457435.1|2394447_2395779_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	24.4	1.2e-14
WP_173328353.1|2396333_2397719_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014457437.1|2397813_2399145_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	38.0	1.4e-10
WP_014457438.1|2399324_2400917_+	L-lactate permease	NA	NA	NA	NA	NA
WP_003623595.1|2401003_2401306_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014457439.1|2401455_2402436_+	ADP-glyceromanno-heptose 6-epimerase	NA	Q58M42	Prochlorococcus_phage	30.2	1.0e-23
2406092:2406107	attR	CCAATCAACCGGCACC	NA	NA	NA	NA
>prophage 148
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2406179	2409802	2815241		Bacillus_phage(33.33%)	4	NA	NA
WP_014457443.1|2406179_2407544_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	40.8	6.9e-10
WP_003629287.1|2407733_2408597_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014457444.1|2408593_2409436_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	2.1e-09
WP_014457445.1|2409451_2409802_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	48.0	1.2e-22
>prophage 149
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2418621	2419620	2815241		Synechococcus_phage(100.0%)	1	NA	NA
WP_014457450.1|2418621_2419620_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	R9TLE2	Synechococcus_phage	46.0	1.0e-79
>prophage 150
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2428171	2434103	2815241		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_003623543.1|2428171_2430154_+	potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	31.4	1.8e-75
WP_014457457.1|2430158_2431313_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_014457458.1|2431357_2431792_+	DUF1489 domain-containing protein	NA	NA	NA	NA	NA
WP_014457460.1|2432628_2433324_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	25.4	2.0e-13
WP_014457461.1|2433362_2434103_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.5	2.3e-15
>prophage 151
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2438312	2441630	2815241		Hokovirus(100.0%)	1	NA	NA
WP_014457463.1|2438312_2441630_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	1.2e-36
>prophage 152
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2444999	2507679	2815241	transposase	Streptococcus_phage(37.5%)	59	NA	NA
WP_012812390.1|2444999_2446385_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_014457468.1|2446929_2447256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624691.1|2447507_2448122_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_014457469.1|2448118_2448784_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_003624694.1|2448794_2449280_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_003624697.1|2449279_2450986_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_003624699.1|2450982_2451327_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003624701.1|2451310_2451613_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_014457471.1|2451641_2452454_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_014457472.1|2452642_2453677_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_014457473.1|2453743_2455420_-	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_014457474.1|2455730_2456324_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014457475.1|2456440_2458405_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014457476.1|2458401_2459427_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_003624713.1|2459613_2460099_+	bacterioferritin	NA	NA	NA	NA	NA
WP_014457477.1|2460151_2460511_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_014457478.1|2460536_2460983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457479.1|2461052_2461616_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003624720.1|2461630_2462062_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003624722.1|2462066_2462747_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_014457480.1|2462835_2463762_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003624725.1|2463791_2464577_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014457481.1|2464571_2466263_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_014457482.1|2466343_2466625_+	arsenate reductase	NA	NA	NA	NA	NA
WP_012813230.1|2466682_2468068_+|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_014457483.1|2468459_2469194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457484.1|2469203_2470727_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003624731.1|2470731_2471808_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003624732.1|2471823_2473461_-	MFS transporter	NA	NA	NA	NA	NA
WP_003624733.1|2473581_2474505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812320.1|2474690_2476076_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	1.1e-31
WP_014457485.1|2476276_2477866_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_014457486.1|2477984_2479292_-	MFS transporter	NA	NA	NA	NA	NA
WP_173328357.1|2480538_2481240_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_003624737.1|2481384_2482179_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003624738.1|2482200_2482833_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_014457487.1|2482832_2483870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624740.1|2483937_2487510_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003624741.1|2487506_2487989_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003624742.1|2488012_2489137_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_003624743.1|2489443_2489896_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041632559.1|2490213_2490492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813230.1|2490623_2492009_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_014457488.1|2492066_2494223_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_014457489.1|2494237_2495221_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041632560.1|2495410_2495641_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_014457490.1|2495637_2496807_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_148194240.1|2497354_2498565_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	8.6e-97
WP_014457493.1|2498579_2499113_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_041632561.1|2499109_2499793_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_014457495.1|2499798_2500611_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_012813230.1|2500868_2502254_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_014457496.1|2502311_2503178_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	45.8	7.1e-61
WP_007283917.1|2503206_2503587_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	54.3	2.7e-28
WP_041632562.1|2503576_2503900_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.1	5.6e-11
WP_014457497.1|2504001_2504229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457498.1|2504336_2504741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457499.1|2504883_2506269_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	3.8e-32
WP_088364821.1|2506468_2507679_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	5.0e-97
>prophage 153
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2521009	2521984	2815241		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003624230.1|2521009_2521984_-	GDP-mannose 4,6-dehydratase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	32.4	2.8e-29
>prophage 154
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2527325	2533601	2815241		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_014457512.1|2527325_2530286_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	53.2	1.6e-277
WP_003624219.1|2530306_2530672_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_014457513.1|2530715_2531852_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_014457514.1|2532149_2533022_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_014457515.1|2533133_2533601_-	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	41.7	2.1e-14
>prophage 155
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2537482	2541317	2815241		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_014457518.1|2537482_2537974_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	51.6	1.2e-33
WP_003624202.1|2538015_2538555_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	3.1e-30
WP_014457519.1|2538551_2541317_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.3	3.0e-97
>prophage 156
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2548367	2549153	2815241		Bacillus_virus(100.0%)	1	NA	NA
WP_003624184.1|2548367_2549153_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.3	1.7e-21
>prophage 157
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2561343	2563599	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_003624170.1|2561343_2563599_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	1.5e-30
>prophage 158
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2568764	2570252	2815241		Mollivirus(100.0%)	1	NA	NA
WP_003624159.1|2568764_2570252_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	3.3e-58
>prophage 159
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2576227	2577001	2815241		Oenococcus_phage(100.0%)	1	NA	NA
WP_003624148.1|2576227_2577001_-	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	30.8	4.9e-05
>prophage 160
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2585395	2587156	2815241		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003624658.1|2585395_2587156_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	4.7e-35
>prophage 161
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2593763	2594594	2815241		Planktothrix_phage(100.0%)	1	NA	NA
WP_003624643.1|2593763_2594594_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	30.9	2.4e-18
>prophage 162
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2602003	2603536	2815241	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014457534.1|2602003_2603536_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	4.7e-23
>prophage 163
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2607517	2608426	2815241		Loktanella_phage(100.0%)	1	NA	NA
WP_041632570.1|2607517_2608426_-	FAD-dependent thymidylate synthase	NA	M4QT16	Loktanella_phage	55.9	5.3e-83
>prophage 164
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2614858	2619720	2815241		Yellowstone_lake_mimivirus(50.0%)	4	NA	NA
WP_014457540.1|2614858_2616004_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.8	1.3e-17
WP_003624606.1|2616132_2616585_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014457541.1|2616589_2617054_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003624603.1|2617050_2619720_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	39.3	5.5e-19
>prophage 165
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2623387	2624671	2815241	protease	Vibrio_phage(100.0%)	1	NA	NA
WP_014457543.1|2623387_2624671_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	27.1	6.9e-28
>prophage 166
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2628404	2632862	2815241		Cedratvirus(50.0%)	3	NA	NA
WP_003624594.1|2628404_2629166_-	amino acid ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	33.5	1.7e-18
WP_003624593.1|2629230_2631924_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_014457546.1|2632115_2632862_+	heme ABC exporter ATP-binding protein CcmA	NA	W5SAS9	Pithovirus	31.5	3.1e-12
>prophage 167
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2637086	2637803	2815241		Synechococcus_phage(100.0%)	1	NA	NA
WP_014457550.1|2637086_2637803_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	53.6	2.8e-18
>prophage 168
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2652732	2654019	2815241		Klosneuvirus(100.0%)	1	NA	NA
WP_014457558.1|2652732_2654019_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.4e-25
>prophage 169
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2659086	2660880	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_014457561.1|2659086_2660880_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	1.3e-29
>prophage 170
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2666905	2669524	2815241	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_003626239.1|2666905_2669524_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.3	2.7e-148
>prophage 171
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2687559	2689128	2815241		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014457571.1|2687559_2689128_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	6.2e-23
>prophage 172
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2692424	2692985	2815241		Paracoccus_phage(100.0%)	1	NA	NA
WP_003626515.1|2692424_2692985_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	62.6	7.1e-38
>prophage 173
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2697153	2697732	2815241		Aeromonas_phage(100.0%)	1	NA	NA
WP_014457577.1|2697153_2697732_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.5	5.7e-22
>prophage 174
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2702716	2706728	2815241	tRNA,transposase	Paenibacillus_phage(50.0%)	4	NA	NA
WP_087651418.1|2702716_2703471_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_014457581.1|2703834_2704926_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003623410.1|2705051_2705438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457582.1|2705459_2706728_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	34.3	3.2e-62
>prophage 175
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2711529	2718970	2815241		Enterobacteria_phage(75.0%)	6	NA	NA
WP_014457584.1|2711529_2712588_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.6	1.4e-95
WP_003623399.1|2712584_2713496_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	53.8	3.0e-86
WP_014457585.1|2713544_2714117_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.0	2.1e-37
WP_003623395.1|2714119_2715025_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_014457586.1|2715105_2716080_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014457587.1|2716315_2718970_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	46.0	1.1e-80
>prophage 176
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2723006	2731698	2815241	tRNA	unidentified_phage(25.0%)	8	NA	NA
WP_014457591.1|2723006_2724170_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.0	4.5e-26
WP_014457592.1|2724178_2725363_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	24.1	1.6e-26
WP_003623374.1|2725810_2726476_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003623373.1|2726543_2727314_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003623371.1|2727310_2728744_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.2	2.3e-40
WP_014457593.1|2728936_2730274_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003623367.1|2730281_2731187_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003623364.1|2731371_2731698_-	thioredoxin TrxA	NA	A0A1B0V6E5	Roseobacter_phage	34.7	2.5e-11
>prophage 177
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2739329	2744748	2815241		Roseobacter_phage(33.33%)	4	NA	NA
WP_014457597.1|2739329_2740115_+	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	47.9	1.3e-16
WP_014457598.1|2740208_2741567_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014457599.1|2741700_2742789_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.9	2.3e-16
WP_014457600.1|2742810_2744748_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	47.0	6.1e-113
>prophage 178
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2751999	2753076	2815241		Bacillus_phage(100.0%)	1	NA	NA
WP_014457605.1|2751999_2753076_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.7	4.3e-07
>prophage 179
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2765126	2768170	2815241		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_014457612.1|2765126_2766041_-	J domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.2	1.3e-15
WP_003623324.1|2766037_2766208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026019353.1|2766488_2766791_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003623320.1|2766848_2767349_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_014457613.1|2767348_2768170_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.5	8.0e-22
>prophage 180
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2771960	2774780	2815241		Escherichia_phage(100.0%)	1	NA	NA
WP_014457617.1|2771960_2774780_-	glycosyltransferase	NA	A0A1D7XFH5	Escherichia_phage	45.8	5.1e-07
>prophage 181
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2790880	2792598	2815241		Bifidobacterium_phage(50.0%)	2	NA	NA
WP_014457628.1|2790880_2791804_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	36.8	4.1e-14
WP_003629491.1|2791800_2792598_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.0	2.5e-20
>prophage 182
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2796566	2797031	2815241		Tupanvirus(100.0%)	1	NA	NA
WP_014457631.1|2796566_2797031_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L698	Tupanvirus	48.8	1.8e-15
>prophage 183
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2802621	2803323	2815241		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_014457636.1|2802621_2803323_-	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.9	1.6e-07
>prophage 184
NC_017150	Acetobacter pasteurianus IFO 3283-01-42C, complete genome	2815241	2807151	2813092	2815241		Myoviridae_environmental_samples(25.0%)	6	NA	NA
WP_014457641.1|2807151_2807970_-	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	39.5	3.0e-29
WP_014457642.1|2807969_2809379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457643.1|2809375_2809729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041632942.1|2809891_2810458_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	44.6	5.7e-27
WP_014457645.1|2810828_2812229_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	49.5	3.4e-113
WP_014457646.1|2812225_2813092_-	bifunctional DNA primase/polymerase	NA	G8I4I7	Mycobacterium_phage	40.6	9.1e-08
>prophage 1
NC_017104	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_011, complete sequence	191799	0	80918	191799	integrase,transposase	Streptococcus_phage(38.1%)	57	14274:14333	39978:40500
WP_012813092.1|638_953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012813093.1|1019_1358_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_041247965.1|1475_2498_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_012813095.1|3041_4082_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012813096.1|4114_4558_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	50.8	2.6e-27
WP_012813098.1|5356_6835_+	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	28.1	9.1e-32
WP_012813099.1|6907_7621_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_012813100.1|8326_8710_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_157666435.1|9000_9441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813102.1|9425_13385_+	DNA damage-inducible protein	NA	NA	NA	NA	NA
14274:14333	attL	TCGACGCGGAAATCTCACAGAAGGGTTGTACATCGGGTTAGATTATGAAAAAGTCTGTTT	NA	NA	NA	NA
WP_082179774.1|14371_15757_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	4.2e-31
WP_012813104.1|16031_16460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813105.1|16676_18047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813107.1|18957_20343_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	5.0e-32
WP_012813108.1|20551_21010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148194248.1|21075_22162_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	5.8e-44
WP_012813110.1|22223_22886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813111.1|22899_25275_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_012813112.1|25292_25694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813113.1|26100_26721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813114.1|26717_27725_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_012812390.1|28612_29998_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813116.1|30212_30710_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012813117.1|31134_32058_+	plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_012813118.1|32268_33324_+	DUF1870 family protein	NA	F0PIG8	Enterococcus_phage	27.8	3.2e-15
WP_012813119.1|33310_34183_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	32.3	1.5e-10
WP_012813123.1|38441_38720_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	46.1	9.3e-15
WP_041633166.1|38728_39031_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_012813124.1|39116_39425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813125.1|39421_40018_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_012813126.1|40594_41980_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
39978:40500	attR	TCGACGCGGAAATCTCACAGAAGGGTTGTACATCGGGTTAGATTATGAAAAAGTCTGTTTTGCACAAAAGAAATTTCCATAATCATCAAGAAAACCCGATGCAGACAGAGTGTAGCGCAGGCGCGTATGAGTTTCCAGCCTCCTGTGGACGGCGTGTTGTGGCCCGTTTTGACGGGGGTCGCATGAGTTCGGATGGGGGCGTAATTCTGGTGAAGCAGGCTGATGACATTCTGGGTCTCAGCCGCCGCTTTGCTGCCTGTTTTCGCGATAAGCGGCATCCCGGCTTTGTGGAATACCGGGTTGAAGACCTTGTCCGTCAGCGGATCATGGGCCTGGCACTGGGCTATGAAGATCTCAATGATCACGATGCCCTGCGGCATGACCTGATCTTTGGTCTGGCCTCGGGTCGTCTGTCAGGAGGCCGGGCAAACTGCGCAGCATTGGCTGGCAAATCTACACTGAACCGGTTGGAGCGCAGTGGGCACAAGGCAGATCGTTACTGTCGGATCATTGCTGATCATGA	NA	NA	NA	NA
WP_012812390.1|42263_43649_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813128.1|44963_45557_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003631147.1|45644_46802_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003631146.1|46886_48278_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012812328.1|49677_50928_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012813131.1|51241_51691_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012813132.1|51727_53050_-	porin	NA	NA	NA	NA	NA
WP_082179775.1|53325_53415_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012813133.1|53417_55124_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_012813134.1|55138_57247_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	30.3	3.6e-34
WP_012813135.1|57257_57881_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_012813136.1|57880_60568_+	sensor histidine kinase KdpD	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.5	1.7e-07
WP_012813137.1|60564_61248_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	9.3e-24
WP_012813138.1|61505_62768_+	sodium:proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	33.9	7.8e-16
WP_012813139.1|63072_63795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082179776.1|63966_65352_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	1.2e-30
WP_012813141.1|65836_66799_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012813142.1|66788_67619_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	29.8	9.0e-21
WP_012813143.1|68163_70137_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.1	9.6e-37
WP_012813144.1|70488_71574_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813145.1|71586_72633_-	Fic family protein	NA	NA	NA	NA	NA
WP_012813146.1|72629_72986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813147.1|73077_74394_-	replication protein C	NA	NA	NA	NA	NA
WP_012813149.1|75534_76920_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	4.2e-31
WP_012813150.1|77327_79796_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012813151.1|79808_80918_+	glycerophosphodiester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	31.6	7.1e-05
>prophage 2
NC_017104	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_011, complete sequence	191799	88924	156126	191799	transposase	Streptococcus_phage(29.41%)	56	NA	NA
WP_012813158.1|88924_90310_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.6	1.0e-32
WP_012813160.1|91583_91916_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_012813161.1|91918_92410_+	type II toxin-antitoxin system YhaV family toxin	NA	Q8HA46	Vibrio_phage	42.5	1.5e-23
WP_012813162.1|92844_93117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|93490_94876_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813165.1|96438_97812_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_012813166.1|97997_98513_+	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_012813167.1|98499_100230_-	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.7	6.7e-10
WP_012813168.1|100780_102373_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_003627697.1|102518_102737_+	CbtB-domain containing protein	NA	NA	NA	NA	NA
WP_012813169.1|102760_103495_+	CbtA family protein	NA	NA	NA	NA	NA
WP_012813170.1|104297_104675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082179784.1|105159_105426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813171.1|105425_105785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365135.1|106862_107620_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	3.5e-11
WP_012812328.1|107799_109050_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_148194246.1|109953_111164_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	6.6e-97
WP_012813177.1|111531_112488_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012813178.1|112539_112782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813179.1|112890_113970_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012813180.1|113978_114314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813181.1|114610_117325_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_012813182.1|117386_119042_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_012813183.1|119041_119602_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_012813184.1|119622_120681_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_012813185.1|120686_121466_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_012813186.1|121465_122155_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_012813187.1|122167_123127_+	type I-E CRISPR-associated endonuclease Cas1	NA	A0A2I7RCU9	Vibrio_phage	22.5	1.6e-05
WP_012813188.1|123107_123449_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_041633306.1|124968_125928_-|transposase	IS481 family transposase	transposase	E2FK51	Porcine_endogenous_retrovirus	28.5	8.0e-05
WP_003627483.1|125985_126366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035362983.1|126353_126638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813190.1|126947_127430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364823.1|127467_128678_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	8.6e-97
WP_012813192.1|129075_129525_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012812390.1|130034_131420_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813194.1|131485_132067_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_012813195.1|132094_132394_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_148194249.1|133405_134493_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	1.2e-41
WP_012813198.1|134642_135005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003618686.1|135218_135479_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003618711.1|135475_135769_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	2.1e-17
WP_012813200.1|135970_136954_-	Abi family protein	NA	A3QSC6	Clostridium_virus	26.7	2.6e-19
WP_012813201.1|137211_139011_-	oleate hydratase	NA	NA	NA	NA	NA
WP_012813204.1|141136_142522_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.7	5.5e-31
WP_006117547.1|143118_144321_-	porin	NA	NA	NA	NA	NA
WP_124307076.1|144363_144606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813149.1|144945_146331_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	4.2e-31
WP_012813206.1|147041_149264_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012813207.1|149340_149871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813208.1|150199_151192_+	TonB family protein	NA	NA	NA	NA	NA
WP_012812328.1|151237_152488_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_006115564.1|152850_153930_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_170315285.1|154160_154379_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_006115563.1|154457_154736_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	47.8	4.9e-16
WP_088365127.1|154942_156126_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.6	4.2e-96
>prophage 3
NC_017104	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_011, complete sequence	191799	160399	168126	191799	transposase	Streptococcus_phage(66.67%)	4	NA	NA
WP_012813126.1|160399_161785_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_003631418.1|162681_163455_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_012812390.1|164405_165791_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813217.1|166353_168126_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	20.7	1.7e-08
>prophage 4
NC_017104	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_011, complete sequence	191799	181007	186990	191799	transposase	Streptococcus_phage(66.67%)	4	NA	NA
WP_012813229.1|181007_182393_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813230.1|182688_184074_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	2.5e-31
WP_082179782.1|184216_184657_-	DNA helicase II	NA	NA	NA	NA	NA
WP_012813232.1|184770_186990_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.4	1.2e-64
>prophage 1
NC_017105	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_020, complete sequence	182940	679	82965	182940	transposase	uncultured_Caudovirales_phage(27.78%)	60	NA	NA
WP_012813237.1|679_973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012813238.1|1138_1738_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012813239.1|1734_2079_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012813240.1|3143_3854_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006115724.1|3924_4245_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012813241.1|4241_4643_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_012813242.1|4642_6256_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.8	2.5e-43
WP_012813243.1|6780_7854_-	alkene reductase	NA	NA	NA	NA	NA
WP_012812328.1|8111_9362_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012813244.1|9485_10493_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_012813247.1|12976_13903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006117386.1|13997_15152_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_012813248.1|15148_16765_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9M4	Catovirus	29.4	1.8e-49
WP_003630594.1|16764_18159_-	cytosine permease	NA	NA	NA	NA	NA
WP_012813249.1|18280_18688_-	enamine deaminase RidA	NA	NA	NA	NA	NA
WP_012813250.1|18825_20307_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012813251.1|20306_21566_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006115463.1|21625_22396_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_148194252.1|23140_24227_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.2e-43
WP_082179787.1|24262_24439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813253.1|24479_25454_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012813254.1|25450_26062_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_082179788.1|26061_29451_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012813259.1|33818_35474_-	alginate export family protein	NA	NA	NA	NA	NA
WP_012813262.1|37201_37906_-	VIT family protein	NA	NA	NA	NA	NA
WP_012813263.1|37962_39315_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	27.1	6.8e-10
WP_003626138.1|39311_39983_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012813264.1|39982_43057_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012813265.1|43056_44211_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006115452.1|44207_45443_-	TolC family protein	NA	NA	NA	NA	NA
WP_012813266.1|45461_45932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812328.1|46614_47865_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_041633342.1|49326_50310_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_012813270.1|50337_51366_+	methionine synthase	NA	NA	NA	NA	NA
WP_052583250.1|51475_52402_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087651418.1|52462_53216_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_006115735.1|53359_53656_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813272.1|53652_53994_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012813273.1|54307_55387_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	56.2	5.3e-82
WP_012813274.1|55395_56094_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.7	4.1e-83
WP_170315290.1|56117_57416_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.6	1.6e-133
WP_006115730.1|57412_57835_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_006115729.1|57831_58185_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012813275.1|58321_59059_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012813276.1|59061_62358_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.9	9.0e-64
WP_012813277.1|62389_63544_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012813278.1|63533_65060_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.3	4.6e-87
WP_012813279.1|65095_65692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148194249.1|65927_67015_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	1.2e-41
WP_006115729.1|67519_67873_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006115730.1|67869_68292_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_148194250.1|68811_70021_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.9e-96
WP_012813285.1|71061_71973_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_124307070.1|72154_73789_+	MFS transporter	NA	NA	NA	NA	NA
WP_124307069.1|73977_75169_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	27.9	4.9e-20
WP_006117298.1|75288_76020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813288.1|76061_76451_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_148194253.1|78989_80076_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	1.9e-42
WP_012813291.1|80270_81869_+	KUP/HAK/KT family potassium transporter	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	37.8	1.4e-67
WP_148194248.1|81877_82965_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	5.8e-44
>prophage 2
NC_017105	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_020, complete sequence	182940	86003	157056	182940	integrase,transposase	Streptococcus_phage(37.5%)	59	83591:83650	154197:156515
83591:83650	attL	TGTTGATTTTCACTGAGAACTGACCCGGGTTTTTCATCAGGAATTGACCCAGCCAGATGC	NA	NA	NA	NA
WP_012813230.1|86003_87389_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	2.5e-31
WP_012813296.1|87618_88104_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_012813298.1|88967_90353_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	6.5e-32
WP_012813299.1|90410_92441_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_158301033.1|92491_92662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813301.1|93089_94238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813302.1|94234_94750_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_064776532.1|94749_95184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813304.1|95428_96595_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_012813305.1|96591_97626_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012813306.1|97618_98077_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_012813307.1|98772_99042_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012813308.1|99043_99319_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_148194251.1|99541_102190_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_148194247.1|102288_103375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	8.4e-43
WP_012813311.1|103417_103954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813312.1|103953_105141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813313.1|105155_105308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813229.1|105473_106859_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813318.1|108633_110535_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_012813319.1|110979_112185_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082179761.1|112633_114019_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.9e-31
WP_012813321.1|114325_115231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813322.1|115473_116307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124307075.1|116426_116696_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_088365092.1|116741_117829_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	2.0e-44
WP_012813325.1|118007_118346_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_012813326.1|118353_118992_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	32.5	7.2e-10
WP_010516885.1|119379_119577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813327.1|119603_122738_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.2e-63
WP_003618801.1|122737_123772_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012813328.1|123768_125211_-	TolC family protein	NA	NA	NA	NA	NA
WP_010516881.1|125203_125854_-	cation transporter	NA	NA	NA	NA	NA
WP_003618791.1|125927_126326_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813131.1|126647_127097_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012813132.1|127133_128456_-	porin	NA	NA	NA	NA	NA
WP_082179775.1|128731_128821_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012813133.1|128823_130530_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_012813134.1|130544_132653_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	30.3	3.6e-34
WP_012813135.1|132663_133287_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_012813136.1|133286_135974_+	sensor histidine kinase KdpD	NA	Q8QNA2	Ectocarpus_siliculosus_virus	23.5	1.7e-07
WP_012813137.1|135970_136654_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	9.3e-24
WP_012813329.1|136957_137527_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813330.1|137578_138406_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012813331.1|138412_139216_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012813332.1|139993_142552_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012813333.1|142585_143047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813334.1|143062_144325_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012813335.1|144321_146715_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	26.7	7.3e-23
WP_012813336.1|147119_147539_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813337.1|147587_148679_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	28.4	6.5e-19
WP_012813338.1|149044_149545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813339.1|149667_151101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813340.1|151206_151431_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012813342.1|151876_153400_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	1.1e-32
WP_012813293.1|153396_154170_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	8.9e-31
WP_012813343.1|154543_154744_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_012813344.1|154744_155050_+	CcdB family protein	NA	NA	NA	NA	NA
WP_012812390.1|155670_157056_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
154197:156515	attR	GCATCTGGCTGGGTCAATTCCTGATGAAAAACCCGGGTCAGTTCTCAGTGAAAATCAACAGGCTTGTCGTTGTGACTGGAAACTTACGAGAACTTACGAGGGTAGATGGGTTGCGATCTGAGGATTGGACGGCCGGTTAAGGGATAAGTGGAGCTTCTGCTTCGGCTTCTGCCTCATGTCAGACGTAACAGGAATTGCTGGAGTTTTCTGAAAGCAGACATATAGCGAGATGATAATATGCGCATGGAAATGTGCATAAACATGTGCTATGCTTCAGTTCTCATGTAAATAGGATCAAAGCTATGGTTCGTGTGCACTCCACCAGTCCGTTGCGTCGTCCCACTAATGTGACGTTACCTGCTCAGTTACTCGAAGAAGCCAGATCGCTTGATCTCAACATATCGCAGGCCTGCGAACAGGGGTTGAAGTCAGCGATCGCTTCGGTTCGTGCTCAACAATGGCTCGCAGAAAATCGCTCCTCCCTTGAAGCATCCCGACAGTATGTCGAAAAGAATGGTCTTCCTCTGGCGGATTATCGGAACTTCTGAATGGCCCGTTTTGATGTGTATTGTTTGGCCGGACGAGGTGAAGCGCGTTTCGTTTTAGATGTGCAGGCAGACCTGCTTGACGAGTTGGGCACCCGCATTGTGGTGCCGCTTTTATCACAGAAAGTGGCACCCAGGCCGGCAAAGAGACTGAATCCGATTTTCGTAGTCGATGACCAGTCGTTCGTTATGATGACACAGTTTATGGCTGCTGTACCTGACCGTGATCTGAAAAAAGTCGTGACGTCATTGTCTCTTTATCAGGATGAAATCATCCAGGCTATTGATCTACTTTTAACTGGTTTCTGAGGGAGAGCCTTGGTCGGCTTCCGCCTCATTGCAGACATTTGTTCCTTCTGTGGGGCTTGCCGAAAGCGGACATTTCGTATCACAATCAGCTAGGGAAGGCCGCGAACACCCGCCGTGCCTATCGCTCGGCAATCCGGGGCTGGTACGTTTGGGCGGCACGTCATGACCTTCCCGCCTTACCTGCTCGTAGTGAAGACGTTGCCACCTATCTTGCAGATCTCGCTTTGCGCGAACGTAAGCCGGCCACTATCGAACTCCATCGTGCAGCACTGCGCTATCTTCATCACATCTCCCATCTTCCCATTCCTACGACACACGCGCTCGTCTCTGAGACGCTGGCGGGCATTCATCGCTCACCAAGGAAAACGCCACCACGTCAGGTCAAAGGTTTGACATGGGAGATGATCTGCGAAGTTGTTGATAGGATCCCGATGACCTCGCTGGTGGATGCTCGTGATCGCGCCATTCTCCTCCTTGGTTATGGTGGTGCGCTACGACGCTCCGAACTGGCGGCGATCCAGCTCGACGCGGAAATCTCACAGAAGGGTTGTACATCGGGTTAGATTATGAAAAAGTCTGTTTTGTAGAAAAGAAATTTCCATAATCATCAAGAAAACCCGATGCAGACAGAGTGTAGCGCAGGCGCGTATGAGTTTCCAGCCTCCTGTGGACGGCGTGTTGTGGCCCGTTTTGACGGGGGTCGCATGAGTTCGGATGGGGGCGTAATTCTGGTGAAGCAGGCTGATGACATTCTGGGTCTCAGCCGCCGCTTTGCTGCCTGTTTTCGCGATAAGCGGCATCCCGGCTTTGTGGAATACCGGGTTGAAGACCTTGTCCGTCAGCGGATCATGGGCCTGGCACTGGGCTATGAAGATCTCAATGATCACGATGCCCTGCGGCATGACCTGATCTTTGGTCTGGCCTCGGGTCGTCTGTCAGGAGGCCGGGCAAACTGCGCAGCATTGGCTGGCAAATCTACACTGAACCGGTTGGAGCGCAGTGGGCACAAGGCAGATCGTTACTGTCGGATCATTGCTGATCATGAGGCCCTGGCTACCCTGTTCGTCACGCTCTTCCTTGACCAGCATGAGCACGCACCCGCCCGGATCGTTCTGGATGTGGATGCCACCGATGACCGTATCCATGGCCATCAGGAAGGCCGCGCCTTTCATGGATATTACGGCCATAACTGCTATCTTCCCCTGTATGTCTTCTGCGGGGACCATCTCCTCAGCGCTACCCTGCGCACGGCAGACAGGGACCCGGGGAAGGAAGCACTGGCAGACATCCGCCGGATCGTGGAGCAGATCAGGAGCCGTTGGCCCCGGGTGCGTATCCTGGTGCGTGGGGACAGCGGTTTCGCCCGGGACAGTCTGATGACATGGTGCGAAGACAACCACGTTGACTTCCTGTTCGGGCTTGCAGGCAACACCCGCCTGTATGACCGGATTGCCTCTTTGTCCGC	NA	NA	NA	NA
>prophage 1
NC_017151	Acetobacter pasteurianus IFO 3283-01-42C plasmid pAPA42C_030, complete sequence	49961	7915	15547	49961	transposase,integrase	Leptospira_phage(14.29%)	9	NA	NA
WP_088365138.1|7915_9003_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	4.9e-43
WP_167316222.1|9077_9491_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.3	1.3e-15
WP_003630649.1|9724_10318_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.3	1.4e-28
WP_012812886.1|10436_11936_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012813374.1|11935_12760_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	23.3	4.0e-05
WP_041633471.1|12837_13455_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.9	2.7e-14
WP_012813376.1|13497_14133_+	AAA family ATPase	NA	D4HTX7	Vibrio_phage	26.9	3.2e-10
WP_012813377.1|14159_14411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813378.1|14446_15547_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.9	3.1e-61
