The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	404999	525455	3005051	transposase	Faecalibacterium_phage(15.0%)	102	NA	NA
WP_014568877.1|404999_406016_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569064.1|407161_408019_+	transketolase	NA	NA	NA	NA	NA
WP_014569065.1|408011_409028_+	transketolase	NA	NA	NA	NA	NA
WP_014569066.1|409219_410074_+	ROK family protein	NA	NA	NA	NA	NA
WP_005714899.1|410123_410882_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_014569067.1|411122_411596_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005714903.1|411600_411930_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569068.1|411954_413061_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014568877.1|413224_414241_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569069.1|414321_415137_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714906.1|415158_416052_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_005714907.1|416596_417073_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569071.1|417044_417473_-	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014569072.1|417490_419179_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_005714910.1|419218_419929_-	transaldolase	NA	NA	NA	NA	NA
WP_014569073.1|420132_421164_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014569074.1|421402_422317_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569075.1|422349_422700_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005714931.1|422701_423064_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_005714932.1|423124_424420_+	YhfT family protein	NA	NA	NA	NA	NA
WP_014569076.1|424449_425334_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005714935.1|425326_426433_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_014569077.1|426423_427596_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014569078.1|427597_428827_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_014569079.1|429154_429991_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_005691490.1|430073_430634_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569080.1|430635_432336_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
WP_014569081.1|432332_433160_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014569082.1|433511_434645_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003660077.1|435474_437289_+	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_014569083.1|437758_438670_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
WP_003601979.1|439011_439662_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_002819966.1|439667_439952_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_076638850.1|440690_440906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016382272.1|441029_441428_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014569086.1|441898_442978_-	class C sortase	NA	NA	NA	NA	NA
WP_014569087.1|443051_444056_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569088.1|444058_444784_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569089.1|444776_447464_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014568877.1|447604_448621_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
WP_014569090.1|449299_449857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569093.1|450895_452683_-	UvrD-helicase domain-containing protein	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
WP_014569094.1|452679_454770_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014569018.1|454887_456384_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569095.1|456677_456929_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
WP_014569096.1|456982_457774_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	2.0e-147
WP_014569097.1|458107_458956_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
WP_101495030.1|459160_459508_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003582045.1|459559_459823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587111.1|459882_462705_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
WP_005688360.1|463809_464964_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_095691959.1|465470_466258_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014569099.1|466307_466982_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
WP_029944056.1|467824_469381_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003574021.1|469731_470652_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_014569101.1|470686_471940_-	MFS transporter	NA	NA	NA	NA	NA
WP_014569018.1|472038_473535_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569102.1|473536_474859_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014569105.1|476218_479197_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
WP_005714951.1|479229_480711_+	amino acid permease	NA	NA	NA	NA	NA
WP_015764844.1|480858_482316_+	amino acid permease	NA	NA	NA	NA	NA
WP_005714953.1|482583_483438_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_031541855.1|483586_485815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014569108.1|486048_487248_+	MFS transporter	NA	NA	NA	NA	NA
WP_014569109.1|487271_488702_+	amidohydrolase	NA	NA	NA	NA	NA
WP_014569110.1|488787_489849_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014569111.1|489845_490598_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
WP_014569112.1|490607_491486_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014569113.1|491499_492168_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569114.1|492164_492851_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014569115.1|493319_494057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569116.1|494783_495329_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_005686332.1|495445_495598_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_014569117.1|495609_496374_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
WP_014569118.1|496594_497392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569119.1|497642_498146_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569120.1|498153_499215_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014569121.1|499219_499909_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
WP_014569123.1|500197_501568_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
WP_015764848.1|501814_502633_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005691594.1|502755_503028_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_014569124.1|503176_503941_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_014569125.1|504350_504779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764849.1|504772_505012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569126.1|504995_505352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764850.1|505309_505474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003605947.1|506612_508031_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_014569127.1|508555_509413_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014569128.1|509622_510639_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
WP_014569129.1|510818_511784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714981.1|512054_513749_-	oleate hydratase	NA	NA	NA	NA	NA
WP_005691618.1|513977_514544_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005686376.1|514633_515002_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_014569130.1|515277_515859_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_014569131.1|515845_516865_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014569132.1|517058_517487_-	OsmC family protein	NA	NA	NA	NA	NA
WP_014569133.1|517945_518629_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
WP_014569134.1|518635_519808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569018.1|520207_521704_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569136.1|522548_522701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569137.1|523074_523911_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569138.1|523958_525455_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	1099237	1138963	3005051	capsid,terminase,tail,holin,head,portal,integrase	Lactobacillus_phage(85.42%)	60	1087150:1087164	1135832:1135846
1087150:1087164	attL	TATTGAAGGTGGACA	NA	NA	NA	NA
WP_014569455.1|1099237_1100422_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
WP_005716132.1|1100592_1100799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569456.1|1100766_1101768_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
WP_005716134.1|1101878_1102082_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
WP_015764910.1|1102105_1102531_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
WP_003606997.1|1102913_1103135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606998.1|1103135_1103891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569458.1|1103997_1104699_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
WP_014569459.1|1104758_1105181_-	toxin	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
WP_003574523.1|1105170_1105509_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_014569460.1|1105643_1105886_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
WP_029943629.1|1105882_1106131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569461.1|1106127_1106355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569462.1|1106442_1106601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569463.1|1106666_1107215_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
WP_015764912.1|1107193_1107424_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
WP_014569466.1|1107567_1107795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569467.1|1108001_1108877_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
WP_014569468.1|1108896_1109661_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
WP_014569469.1|1109676_1110633_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
WP_014569470.1|1110645_1111131_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
WP_014569471.1|1111148_1111364_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
WP_015764330.1|1111360_1111552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569472.1|1111921_1112371_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
WP_014569473.1|1112417_1112672_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
WP_014569474.1|1112668_1113070_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
WP_014569475.1|1113082_1113547_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
WP_014569476.1|1113558_1113744_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
WP_014569477.1|1113740_1114247_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
WP_015764915.1|1114236_1114416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943632.1|1114402_1114606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569478.1|1114595_1115027_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
WP_101495024.1|1115020_1115386_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
WP_014569479.1|1115382_1115622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029943634.1|1115671_1115854_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
WP_005711378.1|1116148_1116577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014569480.1|1117604_1118753_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
WP_014569481.1|1118765_1119308_+	HNH endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
WP_015764918.1|1119300_1119621_+	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
WP_014569483.1|1119657_1120191_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
WP_029943635.1|1120168_1121524_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
WP_014569485.1|1121528_1122956_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
WP_014569486.1|1122921_1123914_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
WP_014569487.1|1124038_1124695_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
WP_014569488.1|1124710_1125724_+	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
WP_014569489.1|1125951_1126326_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
WP_014569490.1|1126330_1126633_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
WP_015764920.1|1126629_1126995_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
WP_014569492.1|1126995_1127400_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
WP_014569493.1|1127411_1128014_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
WP_014569494.1|1128100_1128433_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
WP_015764921.1|1128537_1128891_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
WP_014569496.1|1128883_1131973_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
WP_015764922.1|1131975_1133964_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
WP_014569498.1|1133963_1136471_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
1135832:1135846	attR	TATTGAAGGTGGACA	NA	NA	NA	NA
WP_005686996.1|1136480_1136804_+	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
WP_014569499.1|1136796_1136928_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
WP_014569500.1|1136957_1137251_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
WP_014569501.1|1137240_1137654_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
WP_014569502.1|1137664_1138963_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
>prophage 3
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	1492248	1592201	3005051	capsid,terminase,holin,tail,tRNA,head,transposase,portal,integrase	Lactobacillus_phage(36.11%)	94	1525032:1525091	1559644:1559804
WP_005685893.1|1492248_1493547_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
WP_005685894.1|1493570_1494746_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005685895.1|1494798_1495290_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_005685896.1|1495564_1498366_-	ribonuclease H-like domain-containing protein	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
WP_005685897.1|1498409_1502120_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
WP_005685898.1|1502116_1505656_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_005685900.1|1506070_1507006_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_005685903.1|1507013_1508018_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005685905.1|1507983_1509018_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014569664.1|1509124_1510456_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005685909.1|1510442_1511399_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005685911.1|1511600_1512344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685914.1|1512459_1512810_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_005685917.1|1512843_1513032_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_005685919.1|1513489_1514995_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005685921.1|1514960_1516691_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
WP_005685922.1|1517065_1517860_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_005685924.1|1517846_1518557_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_005685926.1|1518745_1519996_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_005685928.1|1520009_1521779_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
WP_014569666.1|1521964_1524034_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005685932.1|1524035_1524932_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1525032:1525091	attL	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTC	NA	NA	NA	NA
WP_014569667.1|1525337_1526507_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
WP_029943783.1|1526549_1526876_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569668.1|1527711_1528098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569669.1|1528288_1529443_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
WP_014569670.1|1529445_1529778_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
WP_003579629.1|1529790_1530024_-	hypothetical protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
WP_005689480.1|1530048_1530180_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_014569672.1|1530172_1530496_-	hypothetical protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
WP_014569673.1|1530505_1533439_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
WP_014569674.1|1533444_1535502_-|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
WP_015764958.1|1535502_1539669_-|tail	tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
WP_021354705.1|1539674_1539905_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
WP_014569677.1|1539882_1540233_-|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
WP_014569678.1|1540387_1541023_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
WP_015764960.1|1541023_1541404_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
WP_014569680.1|1541400_1541820_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
WP_029943782.1|1541822_1542167_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
WP_014569682.1|1542156_1542447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569683.1|1542518_1544447_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
WP_015764961.1|1544446_1545547_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
WP_029943780.1|1545543_1545726_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_014569685.1|1545849_1547742_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
WP_014569686.1|1547735_1548200_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
WP_015764963.1|1548681_1549242_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
WP_107755075.1|1549474_1549651_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014569687.1|1549647_1550397_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014569018.1|1550462_1551959_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
WP_014569688.1|1552615_1552894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764964.1|1552886_1553327_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
WP_015764965.1|1553425_1553830_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
WP_014569689.1|1553816_1554584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764966.1|1554584_1554791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653167.1|1554851_1555433_-	HNH endonuclease	NA	M1NMU3	Moumouvirus	33.8	5.7e-14
WP_014569690.1|1555839_1557078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029944087.1|1557116_1557344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685933.1|1559922_1560450_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1559644:1559804	attR	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTACAAATGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
WP_005685935.1|1560546_1561176_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_005685938.1|1561172_1561886_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
WP_005687657.1|1562540_1562852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687658.1|1563002_1563818_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005687659.1|1563817_1564720_-	GTPase Era	NA	NA	NA	NA	NA
WP_005713928.1|1564716_1565106_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_005687661.1|1565109_1565508_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_005687662.1|1565491_1565950_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005687663.1|1565953_1566940_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
WP_005687664.1|1567506_1567941_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.5e-14
WP_005687665.1|1567968_1568145_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005687666.1|1568417_1569248_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005687667.1|1569244_1570132_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
WP_005687668.1|1570279_1571200_-	YitT family protein	NA	NA	NA	NA	NA
WP_005687669.1|1571504_1571951_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005687670.1|1572036_1573842_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014569692.1|1573843_1575127_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005687672.1|1575680_1577189_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005687673.1|1577185_1578061_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
WP_005687674.1|1578260_1578707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687675.1|1578794_1580117_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
WP_005687676.1|1580218_1580845_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_005687677.1|1580844_1581291_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005687678.1|1581417_1583643_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_005687679.1|1583947_1584271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014569694.1|1584308_1585037_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005687681.1|1585075_1586020_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005687682.1|1586100_1586595_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_005687683.1|1586591_1587197_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005687684.1|1587302_1587551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687685.1|1587619_1588006_-	YxeA family protein	NA	NA	NA	NA	NA
WP_005687686.1|1588290_1588470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687687.1|1588469_1588856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687688.1|1589273_1589864_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005687689.1|1589866_1590424_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014569018.1|1590704_1592201_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	2103151	2110024	3005051		Lactococcus_phage(33.33%)	9	NA	NA
WP_014569868.1|2103151_2104081_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
WP_101495023.1|2104092_2104419_-	type II toxin-antitoxin system MqsR family toxin	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
WP_005715269.1|2104712_2105213_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
WP_014569870.1|2105329_2106043_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005712952.1|2106039_2106264_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
WP_005686244.1|2106544_2106856_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014569871.1|2107103_2107742_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005692769.1|2107986_2108970_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
WP_005692768.1|2108971_2110024_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
>prophage 5
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	2393613	2465513	3005051	protease,bacteriocin,tRNA	Bacillus_phage(27.27%)	59	NA	NA
WP_014570035.1|2393613_2395020_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.5	2.1e-54
WP_005686130.1|2395163_2396039_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686125.1|2398539_2399109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686122.1|2399745_2401239_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014570039.1|2401789_2402620_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014570040.1|2402633_2403650_-	membrane protein	NA	NA	NA	NA	NA
WP_014570041.1|2403646_2404033_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570042.1|2404164_2405793_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015765046.1|2406290_2407607_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005686113.1|2408707_2409823_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_014570045.1|2409843_2411208_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005686110.1|2411227_2411767_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
WP_014570047.1|2412407_2412698_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014570048.1|2412992_2414312_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	2.3e-63
WP_005714538.1|2414456_2415803_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
WP_014570049.1|2416019_2417120_+	ABC transporter	NA	NA	NA	NA	NA
WP_014570050.1|2417116_2418313_+	ABC transporter	NA	NA	NA	NA	NA
WP_005686102.1|2418326_2419202_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
WP_014570051.1|2419353_2421408_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	2.1e-63
WP_014570052.1|2421614_2424245_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.9	2.8e-84
WP_076638835.1|2424544_2425132_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005692313.1|2425303_2425975_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014570054.1|2426132_2427251_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|2427269_2427554_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_014570055.1|2427799_2428915_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005686092.1|2429077_2429287_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014570056.1|2429852_2430041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570057.1|2430052_2430250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686089.1|2431044_2431302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|2431491_2431698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570058.1|2431926_2432142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015764702.1|2432711_2433944_+	MFS transporter	NA	NA	NA	NA	NA
WP_014570059.1|2434013_2435270_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	6.0e-109
WP_005698939.1|2435350_2436187_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	7.4e-47
WP_005692296.1|2436635_2436821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570061.1|2437397_2437940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570062.1|2438169_2438994_-	class C sortase	NA	NA	NA	NA	NA
WP_014570063.1|2439000_2440554_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_014570064.1|2440544_2441900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570065.1|2441901_2444853_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014570066.1|2445127_2445685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570067.1|2445853_2447062_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_014570068.1|2447254_2448310_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_014570069.1|2448602_2449250_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.7	2.2e-06
WP_005687855.1|2449380_2449713_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014570070.1|2449709_2450495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570071.1|2450538_2451315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570072.1|2451342_2451633_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_048653151.1|2451760_2452843_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005711099.1|2453145_2454501_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005692253.1|2454677_2455088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570076.1|2455148_2456528_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_014570077.1|2456540_2458733_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	3.6e-37
WP_005692249.1|2458981_2459116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570078.1|2459291_2460605_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014570079.1|2460597_2461386_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014570081.1|2464224_2464524_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005686855.1|2464700_2464859_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_014570083.1|2465327_2465513_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NC_017482	Lactobacillus rhamnosus GG, complete genome	3005051	2928760	2956178	3005051	capsid,terminase,transposase,portal,integrase	Lactobacillus_phage(22.22%)	31	2943893:2943913	2958022:2958042
WP_107755086.1|2928760_2929654_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
WP_005685752.1|2929847_2931242_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_029944068.1|2931388_2931964_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_005685750.1|2932077_2932497_-	YjdF family protein	NA	NA	NA	NA	NA
WP_005685749.1|2932780_2933071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685748.1|2933164_2933413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570217.1|2934859_2936185_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	52.9	2.1e-16
WP_014570218.1|2936331_2937867_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005685744.1|2937863_2938553_+	response regulator	NA	NA	NA	NA	NA
WP_005685743.1|2938738_2939254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014570220.1|2940127_2940982_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005685739.1|2941304_2941703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005685738.1|2941875_2942556_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005685737.1|2942734_2943664_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
2943893:2943913	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_014570221.1|2944010_2945168_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_014570222.1|2945285_2945897_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029944073.1|2946011_2946224_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570223.1|2946248_2946524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570224.1|2946591_2946813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570225.1|2946923_2947115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570226.1|2947159_2947432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015765113.1|2947428_2947617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570227.1|2947600_2948428_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
WP_014570228.1|2948420_2949845_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
WP_014570229.1|2950124_2950547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172619743.1|2950628_2951003_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	39.8	3.8e-11
WP_014570231.1|2951127_2951598_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_014570232.1|2951594_2953298_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
WP_015765114.1|2953263_2953443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014570233.1|2953447_2954632_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
WP_014570234.1|2954618_2956178_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2958022:2958042	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
