The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006274	Bacillus cereus E33L, complete sequence	5300915	262030	271725	5300915		Bacillus_phage(33.33%)	7	NA	NA
WP_001029999.1|262030_263665_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000483525.1|263950_264997_+	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	49.7	1.4e-34
WP_000481696.1|265017_265473_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_162837124.1|266138_267680_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_000833092.1|268064_269390_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	7.1e-44
WP_000929883.1|269534_270236_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_000719203.1|270219_271725_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	29.1	7.8e-31
>prophage 2
NC_006274	Bacillus cereus E33L, complete sequence	5300915	310935	319311	5300915		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625691.1|310935_312243_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	8.3e-21
WP_001170542.1|312331_313051_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278823.1|313043_313298_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666778.1|313294_313978_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055575.1|313961_316181_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.3e-162
WP_000879029.1|316165_317581_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262434.1|317686_318727_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.4	1.2e-67
WP_000088587.1|318723_319311_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	7.0e-28
>prophage 3
NC_006274	Bacillus cereus E33L, complete sequence	5300915	1894127	1903394	5300915		Bacillus_phage(71.43%)	9	NA	NA
WP_000755542.1|1894127_1895390_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194298.1|1895488_1896253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453754.1|1896493_1898254_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	8.8e-268
WP_171856546.1|1898315_1899020_+	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_001231490.1|1899016_1900078_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.6	1.6e-168
WP_000273036.1|1900055_1900655_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1900847_1901567_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103836.1|1901716_1902388_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.1	3.6e-60
WP_001258485.1|1902521_1903394_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 4
NC_006274	Bacillus cereus E33L, complete sequence	5300915	2649725	2657672	5300915		Geobacillus_phage(33.33%)	10	NA	NA
WP_000795729.1|2649725_2651093_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.6	4.3e-20
WP_000720573.1|2651529_2652048_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.9	4.3e-45
WP_000389482.1|2652050_2652974_-	phosphotransferase	NA	NA	NA	NA	NA
WP_001093443.1|2653000_2653387_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655493.1|2653452_2654160_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	26.6	6.1e-18
WP_000994646.1|2654181_2654535_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288933.1|2654547_2654952_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714657.1|2655199_2656585_+	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	60.3	7.8e-78
WP_000820170.1|2656587_2656800_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	5.6e-12
WP_000540634.1|2656865_2657672_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 5
NC_006274	Bacillus cereus E33L, complete sequence	5300915	3511681	3565374	5300915	capsid,tail,head,portal,holin,protease	Bacillus_phage(25.81%)	56	NA	NA
WP_000872364.1|3511681_3512047_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000578960.1|3512043_3512721_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000442969.1|3512733_3513147_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000624205.1|3513288_3513489_+	DUF3903 domain-containing protein	NA	NA	NA	NA	NA
WP_000974676.1|3513804_3514560_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000644411.1|3514668_3514815_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_011198927.1|3516882_3517449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000386808.1|3517455_3518475_-	NERD domain-containing protein	NA	A0A1L2JY40	Aeribacillus_phage	27.2	8.7e-26
WP_000136733.1|3518593_3520357_-	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	23.2	3.2e-15
WP_000862476.1|3520356_3522108_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.3	1.8e-47
WP_001123317.1|3522231_3522453_-	YneF family protein	NA	NA	NA	NA	NA
WP_000860645.1|3522531_3522972_-	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_000019770.1|3523128_3525129_-	transketolase	NA	NA	NA	NA	NA
WP_000047898.1|3525431_3526235_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_001000753.1|3526234_3527029_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_000569253.1|3527025_3527799_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	2.7e-11
WP_000915045.1|3527882_3528821_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001069257.1|3529005_3530589_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000948565.1|3530628_3530868_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_000991464.1|3530913_3531570_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000413738.1|3531711_3532332_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976121.1|3532433_3533237_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000032392.1|3533237_3533780_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102621.1|3533772_3534096_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000947629.1|3535073_3535385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534159.1|3535557_3535866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453442.1|3536737_3538336_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	39.7	2.2e-76
WP_000282194.1|3538510_3538723_-	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	71.4	2.8e-19
WP_000383803.1|3538956_3539109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286793.1|3539548_3540913_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000340858.1|3540905_3541883_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_000731144.1|3542071_3543127_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	73.8	7.9e-155
WP_000461737.1|3543123_3543363_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	84.8	6.8e-30
WP_000398740.1|3543362_3543599_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	92.3	5.5e-16
WP_000077309.1|3543709_3543985_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P7E8	Bacillus_phage	81.2	1.8e-34
WP_001260141.1|3544002_3548880_-|tail	phage tail protein	tail	A0A2H4JF18	uncultured_Caudovirales_phage	46.1	0.0e+00
WP_000094111.1|3548876_3550358_-|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	79.7	4.5e-241
WP_000180084.1|3550399_3552580_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	78.8	1.9e-30
WP_011198932.1|3552844_3553102_-	hypothetical protein	NA	A0A1B1P763	Bacillus_phage	84.7	6.4e-34
WP_000477711.1|3554584_3554746_-	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	94.3	2.0e-22
WP_000415943.1|3554799_3555162_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	74.8	9.2e-47
WP_001004916.1|3555166_3555760_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	84.1	5.3e-92
WP_000172073.1|3555760_3556090_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.2e-47
WP_000065124.1|3556086_3556443_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.3	2.7e-30
WP_000997895.1|3556435_3556735_-|head	phage head closure protein	head	R9TPZ2	Paenibacillus_phage	38.3	1.7e-09
WP_000979030.1|3556731_3557004_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	58.4	6.5e-21
WP_000015464.1|3557006_3557297_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	37.8	4.8e-06
WP_000854836.1|3557333_3558497_-|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	54.7	4.1e-80
WP_001043897.1|3558510_3559095_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	50.5	1.0e-39
WP_000522230.1|3559060_3560272_-|portal	phage portal protein	portal	J9QE83	Clostridium_phage	59.4	7.7e-138
WP_000834963.1|3561527_3562268_-	GIY-YIG nuclease family protein	NA	G3MA96	Bacillus_virus	29.2	1.5e-14
WP_000985226.1|3563004_3563376_-	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	55.0	1.3e-24
WP_001051279.1|3563543_3563840_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	59.4	1.0e-27
WP_000352022.1|3564172_3564334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000109231.1|3564604_3565027_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	58.3	2.6e-40
WP_011198935.1|3565095_3565374_-	helix-turn-helix domain-containing protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.8	1.5e-09
>prophage 6
NC_006274	Bacillus cereus E33L, complete sequence	5300915	3574434	3586174	5300915	integrase	Bacillus_phage(76.47%)	24	3563549:3563564	3592266:3592281
3563549:3563564	attL	CTTTTTTTATTAAATC	NA	NA	NA	NA
WP_000884068.1|3574434_3574809_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	70.7	6.4e-43
WP_000520474.1|3574813_3575101_-	hypothetical protein	NA	A6M999	Geobacillus_virus	71.3	1.4e-34
WP_000424750.1|3575230_3575746_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001032094.1|3575966_3576179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000382670.1|3576282_3577029_-	FAD-dependent thymidylate synthase	NA	A0A2P1JUN2	Bacillus_phage	62.2	2.5e-78
WP_000615367.1|3577067_3577640_-	dUTP diphosphatase	NA	A0A0A7AQI4	Bacillus_phage	73.3	1.3e-79
WP_000553935.1|3577734_3577857_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_000861090.1|3577859_3578489_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	41.4	4.4e-28
WP_000156891.1|3578485_3578656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573308.1|3578652_3578841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001229823.1|3578864_3579695_-	ATP-binding protein	NA	U5PWH5	Bacillus_phage	38.7	1.2e-36
WP_000067432.1|3579630_3580395_-	phage protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.7	7.4e-62
WP_000849733.1|3580391_3580664_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	80.9	6.5e-37
WP_001002738.1|3580677_3581349_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	45.8	8.0e-28
WP_000780688.1|3581345_3581828_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	47.5	1.2e-33
WP_000391987.1|3581842_3582007_-	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	64.8	7.4e-12
WP_000510718.1|3582077_3582395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483547.1|3582545_3582812_-	hypothetical protein	NA	S5MC08	Brevibacillus_phage	57.0	6.6e-26
WP_000517003.1|3582831_3583542_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	50.5	1.7e-52
WP_000791069.1|3583541_3583787_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.3	1.7e-12
WP_000579784.1|3583924_3584353_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	48.6	5.1e-28
WP_000673782.1|3584375_3584804_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	2.8e-34
WP_000582644.1|3584819_3584987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135915.1|3585028_3586174_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.0	7.4e-66
3592266:3592281	attR	CTTTTTTTATTAAATC	NA	NA	NA	NA
>prophage 1
NC_007103	Bacillus cereus E33L plasmid pE33L466, complete sequence	466370	35552	76638	466370	integrase,transposase	Bacillus_phage(20.0%)	25	61172:61188	80160:80176
WP_000747906.1|35552_36395_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	32.6	3.0e-32
WP_144405432.1|37032_37221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161501.1|37283_38201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910070.1|40092_41181_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	60.2	5.3e-122
WP_000591603.1|43533_45132_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.8	1.1e-22
WP_001145709.1|45150_45633_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.5	1.6e-22
WP_001013016.1|45697_46312_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000855459.1|46453_47146_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_000391639.1|47530_47848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003824.1|51402_52395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369814.1|53247_54420_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.0	1.4e-06
WP_000189824.1|54823_55825_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000212603.1|55979_56393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028472.1|57827_59258_+|transposase	IS4-like element ISBce5 family transposase	transposase	NA	NA	NA	NA
WP_000129108.1|59985_60990_+	serine hydrolase	NA	NA	NA	NA	NA
61172:61188	attL	GAAAGGATGGCGTTTTT	NA	NA	NA	NA
WP_001053939.1|61190_62621_+|transposase	IS4-like element ISBce4 family transposase	transposase	NA	NA	NA	NA
WP_000720173.1|63680_64439_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	8.5e-18
WP_000291799.1|64442_66761_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_041184995.1|66738_68052_-	MFS transporter	NA	NA	NA	NA	NA
WP_001208356.1|68068_68707_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158319935.1|69189_69477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576159.1|69647_70193_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	46.6	1.5e-37
WP_001214170.1|70224_73176_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.7	9.4e-214
WP_001032577.1|74387_75200_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	27.6	8.8e-05
WP_001178743.1|75192_76638_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	25.5	8.0e-17
80160:80176	attR	AAAAACGCCATCCTTTC	NA	NA	NA	NA
>prophage 2
NC_007103	Bacillus cereus E33L plasmid pE33L466, complete sequence	466370	94906	151637	466370	transposase	Bacillus_phage(55.56%)	46	NA	NA
WP_000586195.1|94906_96028_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.2	6.4e-163
WP_000928761.1|96263_97250_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000413709.1|97476_98970_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	4.3e-82
WP_000104881.1|100103_101636_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000746038.1|102153_102573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428156.1|102911_104987_-	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	25.7	1.1e-06
WP_041185000.1|105077_106247_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.5	4.2e-24
WP_000473811.1|107993_108353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704700.1|109232_109793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000438868.1|110331_110820_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	79.5	2.0e-68
WP_000438658.1|110879_111251_-	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	46.2	1.2e-20
WP_000540406.1|111250_111781_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	80.6	1.1e-77
WP_079995860.1|111738_111921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000475644.1|112198_112681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158319930.1|112750_112897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028472.1|114408_115839_-|transposase	IS4-like element ISBce5 family transposase	transposase	NA	NA	NA	NA
WP_000810182.1|116202_116796_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001294035.1|116823_118074_+	MFS transporter	NA	NA	NA	NA	NA
WP_000592342.1|120093_120504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056969.1|120978_122361_+|transposase	IS4-like element ISBce9 family transposase	transposase	NA	NA	NA	NA
WP_041184975.1|122933_123098_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000482675.1|123142_123331_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000788512.1|123357_123693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000995741.1|124072_124903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000736075.1|125107_125290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102204.1|125832_126141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158319929.1|126343_126502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011270223.1|126721_127360_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_000746489.1|127864_128008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620764.1|128268_128886_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_001023785.1|129118_129427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125179.1|129793_130591_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000819587.1|131042_131819_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_000564717.1|132188_132914_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000567185.1|134456_134720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041185005.1|135503_136859_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	31.8	9.5e-44
WP_001180113.1|137301_137598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861532.1|137892_138318_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	1.9e-59
WP_000270220.1|139336_140779_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_001156502.1|140943_142035_-	endospore germination permease	NA	NA	NA	NA	NA
WP_000572768.1|142075_143173_-	endospore germination permease	NA	NA	NA	NA	NA
WP_000871284.1|143204_143429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000176111.1|143425_144637_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000898925.1|144670_146242_-	spore germination protein	NA	NA	NA	NA	NA
WP_000927573.1|149784_150051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071774.1|150740_151637_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_007103	Bacillus cereus E33L plasmid pE33L466, complete sequence	466370	358518	435170	466370	integrase,transposase	Bacillus_phage(58.33%)	59	399024:399060	447036:447072
WP_001053945.1|358518_359949_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000418191.1|360138_360564_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000352025.1|361133_362540_+	MFS transporter	NA	NA	NA	NA	NA
WP_000472958.1|363170_363614_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001036751.1|363905_364844_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_000948662.1|364866_365475_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000066253.1|365512_366463_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_000681320.1|366459_367074_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000286701.1|368136_368922_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	1.3e-24
WP_185768395.1|369214_369829_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000391546.1|370400_371492_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_000761926.1|373781_374594_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_000724500.1|374620_375253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751604.1|375586_376018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079995878.1|376360_376480_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000754400.1|377349_379020_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_001027484.1|379170_379989_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.5	6.0e-09
WP_001056151.1|380882_381539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422009.1|382839_384573_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.3	3.8e-13
WP_000791311.1|385513_387220_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_001039320.1|388955_389849_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	29.9	3.7e-28
WP_000440492.1|389832_390813_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_000078107.1|390831_391308_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_041185029.1|392149_392821_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000947401.1|393986_394490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079995870.1|394593_394749_+	hypothetical protein	NA	A0A1W6JQ19	Staphylococcus_phage	51.0	2.6e-06
WP_000216157.1|396385_396589_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_001023782.1|396869_397175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000801086.1|397388_397988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000698339.1|398091_398943_-	metallophosphoesterase	NA	NA	NA	NA	NA
399024:399060	attL	TTTATCATTTTAGCCAAGAAGACTCCTTCCTCAAGGA	NA	NA	NA	NA
WP_000906727.1|399209_400331_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.7	2.0e-172
WP_000440805.1|400500_401667_+	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_011270302.1|401981_402320_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049770100.1|402354_402558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342412.1|402690_403029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107050.1|404598_405162_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_000973293.1|407429_408551_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.2	3.4e-172
WP_158319934.1|409784_409970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125391.1|412212_412419_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000018942.1|413167_414037_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000116705.1|414759_416184_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001035968.1|417618_418191_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.9	3.9e-31
WP_001176156.1|418592_419708_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_079995879.1|419806_420928_+	MFS transporter	NA	NA	NA	NA	NA
WP_000158321.1|421430_422216_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_041185031.1|423416_423770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000565446.1|424098_424731_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000932263.1|424938_425040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190823.1|425186_426203_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_000277052.1|427993_428524_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	74.4	2.1e-68
WP_000831281.1|428547_428892_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	81.6	7.0e-44
WP_000451520.1|429026_429590_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	49.3	7.9e-37
WP_165375055.1|429969_430134_-	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	65.4	1.2e-06
WP_000395492.1|430471_431365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158319933.1|431557_431713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000038581.1|431926_432433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001128820.1|432652_432853_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000791549.1|432842_433202_-	DUF3796 domain-containing protein	NA	NA	NA	NA	NA
WP_000117003.1|433739_435170_+|transposase	IS4-like element ISBce5 family transposase	transposase	NA	NA	NA	NA
447036:447072	attR	TTTATCATTTTAGCCAAGAAGACTCCTTCCTCAAGGA	NA	NA	NA	NA
>prophage 4
NC_007103	Bacillus cereus E33L plasmid pE33L466, complete sequence	466370	457644	464513	466370		Bacillus_phage(75.0%)	10	NA	NA
WP_001101735.1|457644_458145_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	69.9	6.1e-57
WP_185768396.1|458116_458260_+	hypothetical protein	NA	A0A0A7AQI1	Bacillus_phage	52.9	4.0e-06
WP_000706148.1|458499_458967_+	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	51.6	2.0e-38
WP_041185034.1|459173_459452_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	55.7	5.3e-18
WP_144405433.1|459725_460223_+	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	87.2	7.9e-73
WP_000446239.1|460224_460410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993188.1|460448_460667_+	DUF3797 domain-containing protein	NA	Q24LE0	Clostridium_phage	45.1	4.7e-06
WP_158319932.1|460703_460862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000503879.1|461190_461616_+	hypothetical protein	NA	H0USU9	Bacillus_phage	85.7	1.9e-46
WP_000108303.1|462713_464513_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	7.9e-30
