The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	537076	543107	4585229		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|537076_537223_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|537238_537382_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400612.1|538371_540294_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.5	1.9e-300
WP_000703599.1|540310_540565_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|540533_540923_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377775.1|542165_543107_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.5	2.7e-146
>prophage 2
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	772362	781533	4585229	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569167.1|772362_773310_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824856.1|773293_774025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|774005_774113_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|774172_774904_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272855.1|775126_776812_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.9	3.7e-279
WP_000598637.1|776808_777528_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|777574_778042_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265354.1|778098_778629_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703141.1|778800_779259_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195335.1|779499_781533_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	860062	867718	4585229		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000697846.1|860062_861148_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023655.1|861147_862047_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000857533.1|862094_862973_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_000973711.1|862973_863525_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018223.1|863530_864505_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648782.1|864520_865294_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565906.1|865298_866378_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000126347.1|866404_867718_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	957383	964610	4585229		Morganella_phage(33.33%)	7	NA	NA
WP_000394197.1|957383_957803_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457650.1|957805_959074_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000208509.1|959519_959732_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|959742_959931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080667.1|960191_961370_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_000377044.1|962410_963106_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001157323.1|963179_964610_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	1666915	1675108	4585229		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|1666915_1667155_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_011233072.1|1668028_1668838_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_001277616.1|1668910_1669288_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|1669435_1669978_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_011233073.1|1670169_1670898_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_011233074.1|1670914_1671328_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_000915986.1|1672274_1673399_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444503.1|1673857_1675108_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 6
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	2486779	2531488	4585229	lysis,terminase,portal,coat,protease,integrase,holin	Salmonella_phage(51.52%)	67	2517569:2517582	2528864:2528877
WP_000915523.1|2486779_2487142_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703606.1|2487138_2488071_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.7	1.2e-175
WP_000671498.1|2488060_2489518_+	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.2	1.4e-239
WP_000129927.1|2489576_2491580_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
WP_000532177.1|2491715_2491964_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_077906264.1|2491984_2492284_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	99.0	7.4e-50
WP_000868979.1|2492416_2494348_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	99.1	0.0e+00
WP_000190212.1|2494347_2495718_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	99.3	1.6e-248
WP_000964851.1|2495727_2496417_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	2.9e-81
WP_000627703.1|2496419_2496875_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000774919.1|2496874_2497513_-	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_001122416.1|2497516_2498935_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.8	2.4e-276
WP_001166094.1|2498894_2499395_-	packaged DNA stabilization gp4 family protein	NA	E7C9U0	Salmonella_phage	98.8	1.2e-89
WP_000538674.1|2499378_2499939_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001196936.1|2499979_2501272_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_000433852.1|2501271_2502183_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774658.1|2502196_2504374_-|portal	portal protein p19	portal	I6R968	Salmonella_phage	98.6	0.0e+00
WP_000417866.1|2504373_2505873_-|terminase	terminase large subunit	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|2505850_2506339_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|2506342_2506747_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|2506749_2506992_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|2507315_2507837_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|2508049_2508499_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|2508516_2508954_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|2508937_2509264_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|2509698_2510322_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|2510318_2510507_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001046347.1|2510503_2510866_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	7.8e-62
WP_000002244.1|2510862_2511153_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|2511145_2511358_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|2511350_2511527_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_011233124.1|2511519_2511861_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	5.1e-63
WP_000113770.1|2511863_2512040_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679702.1|2512006_2512180_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000811302.1|2512176_2512623_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
WP_000049340.1|2512579_2512876_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_000344579.1|2512878_2513199_-	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	1.1e-22
WP_000975822.1|2513210_2513366_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000248682.1|2513377_2513584_-	hypothetical protein	NA	I6RSI5	Salmonella_phage	100.0	1.1e-31
WP_000131495.1|2513659_2515096_-	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	99.2	3.0e-274
WP_000065656.1|2515085_2515985_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	2.5e-154
WP_001125982.1|2515977_2516124_-	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_001103491.1|2516158_2516440_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.6e-43
WP_000182204.1|2516550_2516766_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|2516876_2517566_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
2517569:2517582	attL	AGCCAATGGCCTGA	NA	NA	NA	NA
WP_000680395.1|2517923_2518169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786965.1|2518207_2518417_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000216028.1|2518780_2519083_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	8.2e-49
WP_001066166.1|2519095_2519683_-	superinfection exclusion B family protein	NA	A0A0M4R594	Salmonella_phage	98.5	1.4e-84
WP_000213983.1|2519896_2520091_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000542409.1|2520127_2520421_+	hypothetical protein	NA	B8K1E3	Salmonella_phage	95.7	4.1e-45
WP_001200114.1|2520735_2520888_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	98.0	9.2e-25
WP_000156730.1|2520868_2521057_+	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_000902088.1|2521046_2521190_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	2.7e-18
WP_001046981.1|2521186_2521894_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_001111312.1|2522224_2522518_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|2522528_2522699_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_000665851.1|2522695_2523355_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	61.6	2.2e-62
WP_001017879.1|2523351_2523852_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	62.6	1.0e-64
WP_000582227.1|2523851_2524607_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	5.5e-150
WP_000208071.1|2524617_2525703_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	76.7	2.0e-153
WP_000002128.1|2525695_2525980_+	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_157804913.1|2526048_2526189_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	7.2e-16
WP_000051901.1|2526418_2527582_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	99.7	4.1e-229
WP_000893229.1|2527787_2529038_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.0e-97
2528864:2528877	attR	TCAGGCCATTGGCT	NA	NA	NA	NA
WP_001285277.1|2529049_2530153_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	9.0e-61
WP_001043666.1|2530435_2531488_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.3e-112
>prophage 7
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	2599922	2726774	4585229	lysis,terminase,capsid,plate,tail,portal,tRNA,head,integrase,holin	Salmonella_phage(51.85%)	128	2662064:2662112	2727874:2727922
WP_000108009.1|2599922_2600417_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371499.1|2600432_2602316_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|2602312_2603308_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367632.1|2603318_2604362_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|2604892_2605624_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|2605687_2606155_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801242.1|2606151_2606874_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052769.1|2606908_2607664_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|2607735_2609103_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207237.1|2609158_2609929_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|2610006_2610807_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127560.1|2610938_2612114_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648518.1|2612218_2613133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154860.1|2613154_2613958_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_001235092.1|2619960_2622534_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|2622663_2623395_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079127.1|2623391_2624372_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2624503_2625241_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2625512_2625851_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2625954_2626002_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200087.1|2626101_2627262_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210975.1|2627222_2628131_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225183.1|2628188_2629310_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2629319_2630390_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|2630829_2631348_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|2631340_2632561_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|2632717_2633065_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|2633105_2633873_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2633917_2634466_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2634484_2634733_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460060.1|2634984_2636346_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2636511_2637303_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127908301.1|2637322_2638609_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000271804.1|2638738_2639344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2639384_2639975_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2640097_2640976_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2641061_2642723_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203433.1|2642871_2643210_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2643375_2643666_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|2643655_2644132_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2644280_2644763_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237661.1|2645381_2656856_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533854.1|2656920_2658330_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196157.1|2658326_2660507_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|2660514_2661678_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2662064:2662112	attL	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_001039750.1|2662207_2662585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|2662671_2662890_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011749.1|2662957_2664058_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	3.0e-189
WP_000980405.1|2664054_2664540_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001282813.1|2664539_2667320_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
WP_000763315.1|2667312_2667432_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|2667446_2667749_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|2667803_2668319_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|2668328_2669501_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|2669603_2669822_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161709.1|2670035_2670758_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|2670955_2671363_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_001274654.1|2671369_2672989_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	91.2	3.2e-155
WP_001086800.1|2672985_2673591_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	1.3e-117
WP_000268328.1|2673583_2674492_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.7	3.5e-159
WP_000177408.1|2674478_2674838_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993747.1|2674834_2675413_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_000343944.1|2675481_2675928_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039961.1|2675920_2676352_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024131238.1|2676447_2676876_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|2676872_2677250_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001069889.1|2677254_2677764_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.2e-92
WP_000171565.1|2677744_2677960_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2677963_2678167_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|2678166_2678631_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|2678724_2679375_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|2679378_2680443_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|2680459_2681293_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098454.1|2681435_2683202_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
WP_011233140.1|2683201_2684245_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.0	1.2e-174
WP_000080839.1|2684293_2684989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789324.1|2685008_2686073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|2686069_2687134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|2687143_2687362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|2687457_2687691_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|2687702_2687891_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_000301196.1|2688058_2690461_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.5	0.0e+00
WP_000104130.1|2690451_2691312_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|2691308_2691893_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|2691889_2692117_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|2692116_2692350_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|2692417_2692759_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|2692722_2692923_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|2692930_2693440_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|2693472_2693715_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|2693831_2694464_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|2694467_2695493_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001177838.1|2695736_2695985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|2697609_2698728_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000977532.1|2699407_2701111_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000200793.1|2701110_2701656_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_000267952.1|2701627_2702353_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000421117.1|2702342_2702870_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000084304.1|2702887_2704915_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_001001826.1|2704924_2705512_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000136924.1|2705504_2706689_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001002797.1|2706685_2707015_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811085.1|2707011_2708982_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_000411339.1|2709169_2709427_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376372.1|2709573_2709906_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000175560.1|2709905_2710247_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|2710243_2710537_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166742.1|2710546_2711002_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_000220202.1|2710998_2712126_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000560074.1|2712122_2712830_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000084220.1|2712826_2713333_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001680743.1|2713329_2713782_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218536.1|2713878_2714580_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_000550496.1|2714583_2715606_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|2715667_2716468_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151947.1|2716628_2718404_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038210.1|2718400_2719462_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|2719458_2719782_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960960.1|2719755_2719974_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001137729.1|2720086_2721838_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_016504913.1|2721964_2722108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233149.1|2722148_2722961_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.3	8.8e-122
WP_000057334.1|2722951_2723182_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|2723249_2723651_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000643374.1|2724065_2724293_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_023211710.1|2724302_2724806_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000687097.1|2725188_2725761_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_012532529.1|2725760_2726774_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
2727874:2727922	attR	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
>prophage 8
NC_006511	Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150, complete sequence	4585229	4459799	4470474	4585229	integrase	Enterobacteria_phage(55.56%)	12	4456220:4456236	4464888:4464904
4456220:4456236	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
WP_000152556.1|4459799_4460819_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	7.9e-43
WP_000772671.1|4461289_4462549_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	4.8e-74
WP_000970946.1|4462602_4463598_-	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
WP_010376679.1|4463653_4463890_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000667328.1|4463886_4464450_+	type II restriction endonuclease PvuII	NA	A0A1B0UXL9	Roseobacter_phage	42.9	7.2e-30
WP_000210078.1|4464669_4465236_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
4464888:4464904	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
WP_000984211.1|4465252_4465498_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000556591.1|4466770_4467037_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_000980371.1|4467033_4467585_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
WP_001216601.1|4467581_4467809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743148.1|4467805_4468126_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783718.1|4468140_4470474_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
