The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	799479	838670	5148708	protease,transposase	Shigella_phage(33.33%)	28	NA	NA
WP_087942080.1|799479_800624_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_011038588.1|801119_801671_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011038587.1|801789_803157_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.8	3.6e-43
WP_011038586.1|803414_803714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038585.1|803932_804388_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011038584.1|804384_804885_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011038583.1|804910_806002_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011038582.1|805998_807648_-	MFS transporter	NA	NA	NA	NA	NA
WP_014509029.1|807735_808497_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_012437339.1|808687_809578_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_029628849.1|809652_811602_+	leukotriene A4 hydrolase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011038578.1|812227_812947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014509025.1|812950_813574_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_087942080.1|816193_817337_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	3.1e-88
WP_011038574.1|817664_819419_+	quinoprotein dehydrogenase-associated putative ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043877868.1|819444_820086_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011038572.1|820082_821129_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_011038571.1|821163_822270_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	9.2e-29
WP_011038570.1|822280_824665_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087942922.1|824966_825765_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_019237253.1|826158_828132_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011038567.1|828811_829744_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_011269502.1|830020_831067_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
WP_011269503.1|831399_832749_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011038565.1|832745_833231_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011038564.1|833234_835295_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011038563.1|835291_836410_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_138922025.1|837568_838670_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.3e-43
>prophage 2
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	2530725	2543342	5148708	coat	Xanthomonas_phage(62.5%)	23	NA	NA
WP_011269752.1|2530725_2531376_+	conjugal transfer protein TrbP	NA	A0A077JBM8	Xanthomonas_phage	49.1	4.0e-48
WP_011269753.1|2531324_2531789_-	DUF3693 domain-containing protein	NA	NA	NA	NA	NA
WP_043877755.1|2532173_2533115_+	replication initiation protein	NA	A0A077JDC0	Xanthomonas_phage	96.8	8.5e-177
WP_011037222.1|2533111_2533408_+	G5P family DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	90.7	2.1e-44
WP_019237633.1|2533411_2533663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005918131.1|2533690_2533819_+|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_175422440.1|2534447_2534768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019237631.1|2534761_2535001_+	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	92.4	9.1e-35
WP_011037230.1|2535011_2535332_+|coat	minor coat protein	coat	Q4LAU3	Stenotrophomonas_phage	44.2	5.0e-20
WP_011037227.1|2535333_2536656_+	zonular occludens toxin domain-containing protein	NA	Q4LAU4	Stenotrophomonas_phage	56.0	5.3e-132
WP_075272161.1|2536675_2536984_-	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	90.3	1.0e-46
WP_175422428.1|2537050_2537422_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	100.0	8.8e-61
WP_011269755.1|2537562_2537889_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	60.8	3.9e-20
WP_075272161.1|2537955_2538264_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	90.3	1.0e-46
WP_011269756.1|2538283_2539606_-	zonular occludens toxin domain-containing protein	NA	Q4LAU4	Stenotrophomonas_phage	56.3	5.8e-131
WP_011269757.1|2539607_2539928_-|coat	minor coat protein	coat	Q4LAU3	Stenotrophomonas_phage	44.2	3.5e-21
WP_016944907.1|2539938_2540178_-	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	94.9	1.1e-35
WP_005918131.1|2541084_2541213_-|coat	Phi-Lf prophage-derived major coat protein	coat	NA	NA	NA	NA
WP_016944909.1|2541240_2541492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011269760.1|2541495_2541792_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	66.3	1.9e-26
WP_043877756.1|2541788_2542898_-	replication initiation factor domain-containing protein	NA	S0F3I3	Stenotrophomonas_phage	71.9	1.0e-152
WP_043877757.1|2542890_2543073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043877758.1|2543069_2543342_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	85.7	8.3e-16
>prophage 3
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	3032110	3042586	5148708	tRNA	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_011036903.1|3032110_3034075_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.6	1.3e-12
WP_011036902.1|3035289_3035502_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	65.5	1.5e-12
WP_011269876.1|3035643_3038292_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_011036900.1|3038393_3038882_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011036899.1|3038997_3040029_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	1.6e-112
WP_011269877.1|3040201_3040843_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011036897.1|3040909_3042586_-	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	27.7	9.3e-41
>prophage 4
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	3122936	3220887	5148708	transposase,tRNA,integrase	Leptospira_phage(29.41%)	80	3132509:3132561	3203026:3203042
WP_075287475.1|3122936_3123545_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_138922046.1|3123710_3123995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011035386.1|3124217_3125432_-|transposase	IS4-like element IS1481A family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	31.5	2.7e-50
WP_172642109.1|3125909_3128984_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_148206559.1|3131437_3132515_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.3e-43
3132509:3132561	attL	CGCCCTGAGTAGCGGCCTGGTTTAGAGTCCGGGGTTGATGATATCGGTGTTTG	NA	NA	NA	NA
WP_011269890.1|3133199_3136274_+	hypothetical protein	NA	NA	NA	NA	NA
3132509:3132561	attL	CGCCCTGAGTAGCGGCCTGGTTTAGAGTCCGGGGTTGATGATATCGGTGTTTG	NA	NA	NA	NA
WP_087942918.1|3136315_3137459_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.4	7.6e-87
WP_011036811.1|3137748_3138144_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_002804328.1|3138140_3138392_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011036809.1|3138572_3139139_+	recombinase family protein	NA	Q71TD8	Escherichia_phage	53.6	7.9e-45
WP_011036808.1|3139191_3140259_-	avirulence protein	NA	NA	NA	NA	NA
WP_075287478.1|3140514_3140955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942919.1|3140932_3142065_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	8.2e-49
WP_138922048.1|3142125_3142941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036805.1|3142999_3143647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036804.1|3143686_3147703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036803.1|3147739_3148381_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_040942343.1|3148911_3149193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036802.1|3149220_3149820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036801.1|3149948_3150308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036800.1|3150370_3150850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029628983.1|3150901_3151552_-	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_011036798.1|3151645_3152125_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_016945339.1|3152523_3152856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016945337.1|3153580_3154087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019237757.1|3154826_3155294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036793.1|3155458_3155728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019237759.1|3156108_3157500_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011036791.1|3157525_3158521_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043877799.1|3158695_3158965_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_138922049.1|3159371_3160106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011035385.1|3160158_3161139_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	1.3e-98
WP_087942069.1|3161320_3162453_-|transposase	IS3-like element IS476 family transposase	transposase	S5WIU1	Leptospira_phage	44.1	3.8e-54
WP_100101058.1|3162816_3163918_+|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_087942065.1|3164782_3165891_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	2.9e-43
3163888:3163940	attR	CAAACACCGATATCATCAACCCCGGACTCTAAACCAGGCCGCTACTCAGGGCG	NA	NA	NA	NA
WP_011036786.1|3166187_3167312_-	hypothetical protein	NA	NA	NA	NA	NA
3163888:3163940	attR	CAAACACCGATATCATCAACCCCGGACTCTAAACCAGGCCGCTACTCAGGGCG	NA	NA	NA	NA
WP_011036785.1|3167421_3167763_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019237765.1|3167874_3168636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036783.1|3168681_3168996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029628985.1|3168992_3169373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036781.1|3169612_3170827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138922050.1|3170823_3171354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036780.1|3171335_3173315_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_138922051.1|3173572_3174016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036779.1|3174077_3175364_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_019237801.1|3175450_3176917_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011036777.1|3177262_3178282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011036776.1|3178559_3179840_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	1.8e-97
WP_012438644.1|3179949_3180603_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012438645.1|3180716_3181280_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011036773.1|3181263_3182580_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016944749.1|3182695_3183898_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011036771.1|3183964_3185050_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.7	4.1e-74
WP_011036770.1|3185225_3186194_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_011036769.1|3186345_3187002_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_011036768.1|3186943_3187753_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011036767.1|3187864_3188140_+	polyhydroxyalkanoic acid system family protein	NA	NA	NA	NA	NA
WP_011269893.1|3188275_3188836_+	phasin family protein	NA	NA	NA	NA	NA
WP_011269894.1|3189077_3190079_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_011269895.1|3190262_3190967_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_019237797.1|3191079_3192450_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_011036762.1|3192510_3193716_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_011036761.1|3193728_3195270_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.1	6.7e-78
WP_011036760.1|3195304_3196147_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_011269897.1|3196162_3197830_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_012438658.1|3198004_3198742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011269898.1|3198962_3201425_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_011036756.1|3201617_3204317_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.4	2.4e-107
WP_011036755.1|3204526_3205591_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_012438660.1|3205638_3206325_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011036753.1|3206436_3207411_-	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	26.1	9.2e-17
WP_011036752.1|3207407_3209909_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.6	3.9e-120
WP_014507402.1|3210095_3211220_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7BZP2	Faustovirus	24.8	9.1e-08
WP_011036750.1|3211401_3212136_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_011036749.1|3212192_3215696_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_005991240.1|3217198_3217648_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005991243.1|3217940_3218171_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011036747.1|3218182_3218617_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_014507399.1|3218965_3219304_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_011036745.1|3219492_3220887_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.2	2.2e-80
>prophage 5
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	3339233	3402486	5148708	protease,transposase,tRNA,integrase	Bacillus_phage(18.75%)	54	3331324:3331357	3342039:3342072
3331324:3331357	attL	CGGACGGCGGTTCGATTCCGCCCACCTCCACCAT	NA	NA	NA	NA
WP_011036647.1|3339233_3340382_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011035783.1|3340636_3342004_+|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
WP_011036645.1|3342776_3343469_+	hypothetical protein	NA	NA	NA	NA	NA
3342039:3342072	attR	CGGACGGCGGTTCGATTCCGCCCACCTCCACCAT	NA	NA	NA	NA
WP_043877925.1|3343539_3344304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942920.1|3344596_3345728_+|transposase	IS3-like element ISXca1 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.7e-49
WP_011035783.1|3345916_3347284_+|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
WP_011036642.1|3347628_3349554_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	29.1	1.8e-40
WP_011036641.1|3350822_3352298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036640.1|3352441_3353158_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011269911.1|3353162_3355052_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_162490384.1|3355071_3355299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011035386.1|3355688_3356903_-|transposase	IS4-like element IS1481A family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	31.5	2.7e-50
WP_080506193.1|3356970_3357147_-	ASCH domain-containing protein	NA	A0A2I7QYU6	Vibrio_phage	75.0	2.7e-12
WP_011036637.1|3357800_3357971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011269914.1|3358272_3358515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043877806.1|3358702_3360358_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	9.2e-17
WP_011036634.1|3360374_3360620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011036633.1|3360857_3361832_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.0	8.9e-20
WP_011036632.1|3361926_3363351_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011036631.1|3363344_3364076_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011036630.1|3364109_3367280_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011036629.1|3367461_3368652_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_029628996.1|3368648_3369422_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011036627.1|3369775_3370810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011036626.1|3371581_3372307_-	OmpA family protein	NA	NA	NA	NA	NA
WP_019237804.1|3372440_3373859_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.6	2.1e-46
WP_011036624.1|3374149_3375580_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	1.5e-119
WP_011036623.1|3375768_3376323_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	41.2	1.6e-18
WP_011036622.1|3376397_3378341_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	31.5	6.8e-27
WP_011036621.1|3378363_3378987_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_029216863.1|3379216_3381763_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_011036619.1|3381855_3383019_-	glutaryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011036618.1|3383195_3383972_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011036617.1|3384116_3384332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036616.1|3384331_3385099_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011036615.1|3385144_3385975_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011036614.1|3386022_3386451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036613.1|3386570_3387053_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003483561.1|3387129_3387345_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	5.0e-16
WP_011036612.1|3387573_3388059_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011036611.1|3388225_3389356_+	phospholipase A	NA	NA	NA	NA	NA
WP_029628998.1|3389549_3390188_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_011036609.1|3390372_3391008_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_019237813.1|3391036_3391462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019237814.1|3391655_3393173_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_019237815.1|3393405_3395283_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	39.1	3.0e-24
WP_011036605.1|3395506_3396286_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011036604.1|3396444_3396930_-	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	35.5	1.4e-13
WP_019237816.1|3397103_3399302_+	dipeptidyl carboxypeptidase II	NA	A0A1V0SID3	Klosneuvirus	27.6	2.0e-43
WP_011036602.1|3399529_3400030_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019237817.1|3400094_3400931_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_011036600.1|3400969_3401254_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012438794.1|3401469_3401670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011036598.1|3401877_3402486_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 6
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	4289028	4295411	5148708		Enterobacteria_phage(50.0%)	6	NA	NA
WP_014506571.1|4289028_4290375_+	phosphohexose mutase	NA	A0A127AWJ1	Bacillus_phage	26.4	1.2e-30
WP_011035868.1|4290420_4291824_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	1.1e-47
WP_011035867.1|4291945_4292854_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.6	2.6e-29
WP_011035866.1|4292850_4293408_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	4.3e-43
WP_012439277.1|4293404_4294292_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	1.2e-95
WP_011270013.1|4294355_4295411_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	3.1e-82
>prophage 7
NC_007086	Xanthomonas campestris pv. campestris str. 8004, complete sequence	5148708	4592730	4629482	5148708	plate,transposase,tRNA	Leptospira_phage(22.22%)	34	NA	NA
WP_011038897.1|4592730_4593795_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	3.9e-101
WP_002808376.1|4594075_4594291_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011038898.1|4594517_4594964_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	2.7e-24
WP_019238042.1|4595802_4596750_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011038900.1|4596830_4598579_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
WP_011038901.1|4598575_4599076_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_070698071.1|4599122_4600157_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011038903.1|4600386_4601964_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014506322.1|4601983_4602880_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011038905.1|4602882_4604046_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_011038906.1|4604056_4604632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038907.1|4604659_4605385_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_011038908.1|4605445_4605664_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011038909.1|4605760_4606636_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_011038910.1|4606672_4607269_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011038911.1|4607265_4607439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038912.1|4607419_4609024_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.2	7.8e-05
WP_011038913.1|4609063_4610047_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_016944221.1|4610063_4610540_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011038915.1|4610818_4614019_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_011035783.1|4614265_4615633_+|transposase	IS5-like element IS1478 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.6	2.8e-80
WP_129588839.1|4615746_4615983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172642105.1|4616209_4617019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011038660.1|4617398_4617998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012437268.1|4618163_4618562_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_012437267.1|4618558_4618831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175422437.1|4619130_4620396_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_100101058.1|4620496_4621599_-|transposase	IS3-like element IS1404 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_012437264.1|4621943_4622825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038664.1|4622989_4623400_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_087942065.1|4623356_4624465_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	2.9e-43
WP_087942071.1|4625783_4626928_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	1.8e-88
WP_011038670.1|4627261_4628275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011035385.1|4628501_4629482_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.0	1.3e-98
