The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007204	Psychrobacter arcticus 273-4, complete sequence	2650701	401245	410876	2650701		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_011279631.1|401245_403693_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	75.9	9.8e-108
WP_011279632.1|404365_404842_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	7.7e-25
WP_011279633.1|405106_405619_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.2	7.7e-31
WP_011279634.1|405691_405940_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	61.8	4.9e-23
WP_011279635.1|405943_407254_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	1.2e-19
WP_011279636.1|407265_407985_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_011279637.1|409079_410876_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	35.2	5.7e-20
>prophage 2
NC_007204	Psychrobacter arcticus 273-4, complete sequence	2650701	482732	588985	2650701	terminase,protease,capsid,head,portal,integrase,transposase,tail,holin,tRNA	Psychrobacter_phage(19.44%)	93	550056:550083	585388:585415
WP_011279693.1|482732_483539_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011279694.1|483609_484632_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.0	3.2e-60
WP_148201643.1|485507_488804_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	43.5	8.7e-75
WP_011279696.1|489142_489631_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011279697.1|489871_490483_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_011279698.1|490540_492499_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011279699.1|492824_494051_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_011279700.1|494364_495033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279701.1|495043_497791_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011279702.1|497966_498761_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011279704.1|500232_500403_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_011279705.1|500448_500598_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_011279706.1|500670_502233_-	DNA cytosine methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	26.6	7.3e-32
WP_041757468.1|502493_503840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279708.1|503978_507794_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	69.0	4.0e-15
WP_011279709.1|508532_509117_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_011279710.1|509428_510031_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_011279666.1|511926_512808_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011279711.1|513934_514567_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	29.2	1.9e-07
WP_011279712.1|514838_515999_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011279713.1|516093_516618_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011279714.1|516805_517165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279666.1|517954_518836_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011279715.1|520956_522330_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011279716.1|522538_522829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279717.1|523114_523795_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011279718.1|524326_525019_+	methyltransferase domain-containing protein	NA	A0A1E1GDT2	Vibrio_phage	33.3	1.2e-05
WP_148201644.1|525006_526065_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011279720.1|526061_527150_-	type III polyketide synthase	NA	NA	NA	NA	NA
WP_011279722.1|527665_528094_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	28.6	7.2e-06
WP_011279723.1|528254_531563_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_011279724.1|531986_532658_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011279725.1|532979_533927_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.9e-21
WP_011279726.1|534079_534853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011279727.1|535093_535951_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	33.6	1.0e-35
WP_011279728.1|536240_537959_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	28.4	5.8e-06
WP_011279729.1|538821_540447_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	30.6	4.6e-53
WP_011279730.1|540584_541268_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_187147120.1|541447_542650_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011279732.1|542792_543629_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011279733.1|543895_544849_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011279734.1|545091_546459_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011279735.1|546689_547805_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011279736.1|548131_548662_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_011279737.1|548677_549640_-	DUF1853 family protein	NA	NA	NA	NA	NA
550056:550083	attL	TTGGTCGGAACGGCAGGATTTGAACCTG	NA	NA	NA	NA
WP_011279738.1|550210_550699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279739.1|550715_551261_-	N-acetylmuramoyl-L-alanine amidase	NA	E5EYD9	Acinetobacter_phage	59.7	1.1e-54
WP_011279740.1|551326_551650_-|holin	phage holin family protein	holin	G3ENC0	Psychrobacter_phage	92.5	9.4e-51
WP_011279741.1|551714_552266_-	DUF4376 domain-containing protein	NA	A0A0R6PHE3	Moraxella_phage	40.6	1.2e-18
WP_011279742.1|552270_555444_-	host specificity protein J	NA	G3ENB7	Psychrobacter_phage	88.1	0.0e+00
WP_011279743.1|555446_556010_-|tail	tail assembly protein	tail	G3ENB6	Psychrobacter_phage	89.5	1.3e-87
WP_011279744.1|556065_556815_-|tail	phage tail protein	tail	G3ENB5	Psychrobacter_phage	77.2	3.3e-115
WP_011279745.1|556814_557633_-|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	49.8	1.1e-63
WP_041757476.1|557634_557919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041757479.1|557920_558988_-	DNA polymerase	NA	H7BVN7	unidentified_phage	36.5	6.1e-46
WP_011279747.1|559268_559652_-	four helix bundle protein	NA	D4HTV8	Vibrio_phage	41.2	9.2e-13
WP_011279748.1|559677_561144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279749.1|561152_561491_-|tail	phage tail protein	tail	G3ENB1	Psychrobacter_phage	93.6	1.2e-56
WP_011279750.1|561552_561825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279751.1|562010_565082_-	hypothetical protein	NA	D4FUM0	Pseudomonas_phage	37.3	1.6e-59
WP_011279752.1|565253_565784_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_041757485.1|565849_566140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279754.1|566175_566541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279755.1|566614_567037_-	hypothetical protein	NA	A0A0R6PI94	Moraxella_phage	37.3	1.9e-14
WP_011279756.1|567058_567418_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011279757.1|567435_567903_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	35.8	2.1e-19
WP_011279758.1|567895_568228_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_049750933.1|568229_568535_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_083756045.1|568651_569860_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	32.8	1.2e-42
WP_011279761.1|569982_570729_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	30.3	2.0e-11
WP_011279762.1|570721_571957_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	30.8	2.7e-45
WP_011279763.1|571958_573704_-|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	46.1	4.4e-134
WP_011279764.1|573710_574184_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	30.6	4.2e-07
WP_011279765.1|574288_574735_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	37.0	4.8e-21
WP_011279766.1|574861_575263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011279767.1|575615_577316_-	hypothetical protein	NA	A0A0R6PCH4	Moraxella_phage	47.4	2.1e-133
WP_011279768.1|577512_578529_-	bacteriophage DNA primase	NA	A0A0R6PHP8	Moraxella_phage	47.9	3.6e-80
WP_011279769.1|578518_579022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083756046.1|579063_579303_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011279771.1|579445_580120_+	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	33.1	2.0e-31
WP_011279772.1|580382_580658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279773.1|580654_581611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279774.1|581603_581957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279775.1|581956_582475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041757489.1|582471_582684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187147102.1|582724_582886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279776.1|582889_583405_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	27.8	3.7e-09
WP_011279777.1|583404_583605_+	TraR/DksA family transcriptional regulator	NA	G3EN77	Psychrobacter_phage	58.7	9.7e-14
WP_049750914.1|583723_584113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011279778.1|584019_585093_+|integrase	site-specific integrase	integrase	G3EN73	Psychrobacter_phage	40.8	2.0e-60
WP_011279779.1|585579_587109_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
585388:585415	attR	TTGGTCGGAACGGCAGGATTTGAACCTG	NA	NA	NA	NA
WP_011279780.1|587108_588605_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011279781.1|588670_588985_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 3
NC_007204	Psychrobacter arcticus 273-4, complete sequence	2650701	771889	780270	2650701		Tupanvirus(28.57%)	7	NA	NA
WP_187147124.1|771889_773164_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.1	7.8e-24
WP_011279937.1|773339_774374_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	7.2e-68
WP_011279938.1|774393_776193_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.9e-23
WP_011279939.1|776378_777377_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	36.6	8.5e-42
WP_011279940.1|777377_778535_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	30.5	1.5e-37
WP_011279941.1|778546_779587_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.2	5.4e-07
WP_011279942.1|779583_780270_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.7	5.7e-13
>prophage 4
NC_007204	Psychrobacter arcticus 273-4, complete sequence	2650701	1177956	1188903	2650701		Moraxella_phage(44.44%)	19	NA	NA
WP_011280257.1|1177956_1178973_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	35.8	1.3e-45
WP_041757612.1|1178975_1179260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011280259.1|1179271_1179640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187147109.1|1179708_1179867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187147110.1|1180201_1180375_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	70.3	8.9e-08
WP_011280260.1|1180569_1180917_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011280261.1|1180938_1181484_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_187147111.1|1181636_1181795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011280262.1|1181959_1182868_-	hypothetical protein	NA	A0A0R6PJ36	Moraxella_phage	44.9	5.5e-64
WP_011280263.1|1182864_1183734_-	hypothetical protein	NA	A0A0R6PJ79	Moraxella_phage	46.3	1.9e-66
WP_041757614.1|1183849_1184245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041757616.1|1185248_1185449_+	hypothetical protein	NA	A0A0R6PHG5	Moraxella_phage	50.0	5.0e-10
WP_148201674.1|1185466_1185841_+	hypothetical protein	NA	A0A2H4J960	uncultured_Caudovirales_phage	33.3	9.7e-07
WP_187147112.1|1185837_1186008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187147113.1|1185997_1186156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011280267.1|1186218_1187163_+	replication protein	NA	A0A2I7S8M4	Vibrio_phage	53.5	1.1e-14
WP_148201654.1|1187290_1187710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011280269.1|1187936_1188281_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	64.0	3.3e-38
WP_011280270.1|1188333_1188903_+	hypothetical protein	NA	G3EN90	Psychrobacter_phage	50.3	4.5e-48
>prophage 5
NC_007204	Psychrobacter arcticus 273-4, complete sequence	2650701	1191905	1198297	2650701	capsid,terminase	Pseudomonas_phage(33.33%)	7	NA	NA
WP_187147115.1|1191905_1192469_+	hypothetical protein	NA	A0A0N7IRF1	Acinetobacter_phage	46.8	1.4e-46
WP_011280275.1|1192501_1192975_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	57.3	7.1e-39
WP_148201675.1|1192979_1194221_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	65.7	9.3e-155
WP_011280277.1|1194217_1195735_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	31.7	3.6e-52
WP_011280278.1|1195737_1196535_+|capsid	minor capsid protein	capsid	J9SWK6	Pseudomonas_phage	30.5	2.3e-13
WP_041757626.1|1196882_1197092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011280279.1|1197088_1198297_+	S49 family peptidase	NA	A0A2I6PHS0	Pseudomonas_phage	28.7	8.5e-20
