The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	936567	945262	3997420	tRNA	uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_004512995.1|936567_937722_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	31.1	8.7e-22
WP_004512996.1|937711_938743_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_004512997.1|938788_939901_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.4	1.3e-91
WP_004512998.1|939967_940288_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.0e-12
WP_004512999.1|940319_941921_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.4	1.2e-05
WP_004513000.1|941930_942839_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.0	7.0e-43
WP_004513001.1|942857_943454_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004513002.1|943525_945262_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.7	5.0e-82
>prophage 2
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	1239804	1278307	3997420	plate,protease,tail,transposase	Escherichia_phage(50.0%)	32	NA	NA
WP_004514801.1|1239804_1240830_-|transposase	IS21-like element ISGme4 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	1.6e-83
WP_004513385.1|1241344_1242049_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004513386.1|1242041_1242956_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_004513387.1|1242952_1244398_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004513388.1|1244475_1245792_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004513389.1|1245849_1247445_+	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_004513390.1|1247475_1248087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513391.1|1248276_1248975_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_004513392.1|1249211_1251128_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	NA	NA	NA	NA
WP_004513393.1|1251140_1251650_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_004513394.1|1251649_1252456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513395.1|1252472_1253510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513396.1|1253511_1254546_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_004513397.1|1254545_1255883_+	ATP-binding protein	NA	A0A2D2W2A9	Stenotrophomonas_phage	35.0	2.0e-09
WP_004513398.1|1255876_1256110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513399.1|1256114_1256753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513400.1|1256754_1257045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513401.1|1257048_1258194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513402.1|1258194_1259007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513403.1|1259188_1259563_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004513404.1|1259567_1260743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513405.1|1260739_1264006_+|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_004513406.1|1264018_1265527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513407.1|1265808_1266765_+|transposase	IS110-like element ISGme8 family transposase	transposase	NA	NA	NA	NA
WP_004513408.1|1266830_1269893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513409.1|1269959_1270922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004513410.1|1270977_1271706_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_004513411.1|1271840_1274231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011365774.1|1274294_1275650_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004513414.1|1275806_1276094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004513415.1|1276758_1277562_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004513416.1|1277584_1278307_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	1586275	1594667	3997420		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_004511650.1|1586275_1586551_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	46.1	2.9e-16
WP_004511649.1|1586573_1586924_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004511648.1|1587091_1587850_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	43.1	8.1e-53
WP_004511647.1|1587965_1588616_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	5.5e-34
WP_004511646.1|1588650_1589631_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	37.5	6.2e-37
WP_004511645.1|1589660_1590176_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.3	5.4e-32
WP_004511644.1|1590775_1593394_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.2	1.0e-46
WP_004511643.1|1593395_1594667_+	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	32.5	6.8e-20
>prophage 4
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	1817956	1824973	3997420		Staphylococcus_phage(66.67%)	9	NA	NA
WP_004511445.1|1817956_1819414_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	44.3	5.1e-112
WP_004511444.1|1819515_1820061_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004511443.1|1820171_1820495_+	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_004511442.1|1820577_1821042_+	cytidine/deoxycytidylate deaminase family protein	NA	A0A1D8ESY8	Mycobacterium_phage	45.7	9.1e-23
WP_004511441.1|1821038_1821491_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_004511440.1|1821494_1822607_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.8	2.5e-50
WP_004511439.1|1822588_1823239_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.5	5.4e-29
WP_004511438.1|1823279_1824482_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.9	2.8e-100
WP_004511437.1|1824505_1824973_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	1.6e-35
>prophage 5
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	2532958	2589424	3997420	integrase,transposase	Escherichia_phage(40.0%)	46	2577821:2577840	2589985:2590004
WP_011365646.1|2532958_2534035_+|transposase	IS5-like element ISGme1 family transposase	transposase	NA	NA	NA	NA
WP_148206094.1|2534193_2534724_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041249152.1|2534895_2535765_-	cache domain-containing protein	NA	NA	NA	NA	NA
WP_011365997.1|2536009_2536387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148206095.1|2536494_2538984_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_011365999.1|2539016_2540075_-	repeat-containing protein	NA	NA	NA	NA	NA
WP_011366000.1|2540210_2541764_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.3	4.3e-32
WP_011366001.1|2541910_2543245_-	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
WP_011366002.1|2543296_2544931_-	DUF1302 family protein	NA	NA	NA	NA	NA
WP_011366003.1|2545605_2546388_-	glucose 1-dehydrogenase	NA	W8CYX9	Bacillus_phage	45.5	6.7e-10
WP_187148446.1|2546457_2547276_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_011366005.1|2547380_2548706_-	MFS transporter	NA	NA	NA	NA	NA
WP_081431796.1|2548738_2549461_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.5	3.5e-21
WP_011366007.1|2551002_2551446_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_041249156.1|2551513_2551984_-	ferritin family protein	NA	NA	NA	NA	NA
WP_011366010.1|2552506_2552689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366011.1|2552712_2554680_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_011365616.1|2554871_2556041_+|transposase	IS481-like element ISGme9 family transposase	transposase	NA	NA	NA	NA
WP_011366012.1|2556129_2557458_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_011366013.1|2557623_2558439_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011366015.1|2559033_2559816_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011366016.1|2560314_2561190_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_011366017.1|2561204_2562365_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_011366018.1|2562439_2563345_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011366019.1|2563530_2564307_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011366020.1|2564360_2566346_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011366021.1|2566360_2567329_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011366022.1|2567328_2568111_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011366023.1|2568176_2570255_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011366024.1|2570328_2571558_-	thiolase family protein	NA	NA	NA	NA	NA
WP_081431814.1|2571612_2572467_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011366026.1|2572521_2574369_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004514801.1|2575733_2576759_+|transposase	IS21-like element ISGme4 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	1.6e-83
WP_004514800.1|2576755_2577550_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.2e-84
2577821:2577840	attL	ATGGAGCGGGAAACGGGATT	NA	NA	NA	NA
WP_148206083.1|2578047_2579079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011366028.1|2579355_2579748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041249158.1|2579762_2579945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011366029.1|2580078_2581260_+	plasmid replication initiation factor	NA	NA	NA	NA	NA
WP_011366030.1|2581249_2581591_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011366031.1|2581669_2582980_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	35.4	1.2e-08
WP_011366032.1|2583216_2584461_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	27.5	2.5e-30
WP_041249159.1|2584496_2584934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011366034.1|2585137_2585788_+	recombinase family protein	NA	A0A1B1IWV2	uncultured_Mediterranean_phage	42.6	2.3e-32
WP_187148447.1|2586503_2586704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011366036.1|2586947_2587427_-	HNH endonuclease	NA	A0A2K8IF61	Lactococcus_phage	37.3	1.7e-16
WP_011365668.1|2588200_2589424_+|transposase	ISL3-like element ISGme5 family transposase	transposase	A4PE56	Ralstonia_virus	55.4	3.6e-119
2589985:2590004	attR	ATGGAGCGGGAAACGGGATT	NA	NA	NA	NA
>prophage 6
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	2681085	2689390	3997420	transposase	Streptococcus_phage(16.67%)	7	NA	NA
WP_004513248.1|2681085_2682375_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	65.4	1.9e-158
WP_004513247.1|2682522_2683953_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.4	2.1e-102
WP_004513246.1|2683973_2684573_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	35.7	3.0e-18
WP_004513245.1|2684672_2685740_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	45.5	2.8e-83
WP_011365668.1|2685797_2687021_-|transposase	ISL3-like element ISGme5 family transposase	transposase	A4PE56	Ralstonia_virus	55.4	3.6e-119
WP_004514764.1|2687128_2687686_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_004514763.1|2687764_2689390_-	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.1	3.2e-30
>prophage 7
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	2826934	2880861	3997420	protease,tRNA,transposase	Acinetobacter_phage(16.67%)	53	NA	NA
WP_004514804.1|2826934_2828188_+|transposase	ISL3-like element ISGme6 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.9	2.2e-07
WP_011366061.1|2828111_2828870_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004514795.1|2829239_2830160_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_081431798.1|2830173_2830629_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011365646.1|2830721_2831798_+|transposase	IS5-like element ISGme1 family transposase	transposase	NA	NA	NA	NA
WP_187148450.1|2831956_2832703_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011366063.1|2832924_2833722_-	restriction endonuclease	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	30.9	1.5e-17
WP_004514654.1|2834484_2835093_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004514653.1|2835097_2836453_-	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004514652.1|2836617_2837418_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.2	3.5e-54
WP_004514651.1|2837469_2838522_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.9	7.3e-68
WP_004514650.1|2838518_2839088_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.6	4.1e-73
WP_004514649.1|2839089_2840565_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	31.9	1.0e-51
WP_004514648.1|2840811_2842764_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	1.1e-109
WP_004514647.1|2842902_2843172_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_004514646.1|2843183_2843441_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_081431800.1|2843468_2843594_+	DUF3387 domain-containing protein	NA	NA	NA	NA	NA
WP_004514645.1|2843787_2844042_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011366065.1|2844029_2844359_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	33.0	9.4e-06
WP_004514643.1|2844506_2844674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004514642.1|2844931_2845459_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_004514641.1|2845489_2846440_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004514806.1|2846499_2847669_-|transposase	IS4-like element ISGme2 family transposase	transposase	NA	NA	NA	NA
WP_004514778.1|2847871_2849263_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004514777.1|2849293_2850352_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_004514776.1|2850521_2851484_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004514775.1|2851494_2852658_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_004514774.1|2852851_2853418_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_004514773.1|2853705_2853927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011365652.1|2854167_2855391_-|transposase	ISL3-like element ISGme5 family transposase	transposase	A4PE56	Ralstonia_virus	55.2	2.3e-118
WP_004514812.1|2855782_2856349_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_004514535.1|2856420_2856594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004514534.1|2856705_2858073_-	TolC family protein	NA	NA	NA	NA	NA
WP_004514533.1|2858069_2861195_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.4	1.5e-100
WP_011366066.1|2861198_2862347_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004514531.1|2862589_2863897_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_004514530.1|2864108_2866175_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	1.0e-57
WP_004514529.1|2866288_2866726_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_004514528.1|2866860_2867229_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_004514527.1|2867336_2868971_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.4	7.9e-61
WP_004514526.1|2869101_2869290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004514525.1|2869418_2869934_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	30.5	8.1e-12
WP_004514524.1|2870080_2870326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004514523.1|2870549_2870657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004514522.1|2870656_2872096_-	insulinase family protein	NA	NA	NA	NA	NA
WP_004514521.1|2872114_2873599_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	21.2	4.7e-12
WP_004514520.1|2873754_2874726_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_011366068.1|2874722_2875457_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_011366069.1|2875652_2875943_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	60.4	1.3e-27
WP_004514518.1|2875952_2876249_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	43.7	2.3e-11
WP_004514517.1|2876659_2878267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004514800.1|2879044_2879839_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.2e-84
WP_004514801.1|2879835_2880861_-|transposase	IS21-like element ISGme4 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	1.6e-83
>prophage 8
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	3062881	3071504	3997420		Moraxella_phage(33.33%)	7	NA	NA
WP_004511748.1|3062881_3064126_+	response regulator	NA	W8CYM9	Bacillus_phage	29.1	2.0e-11
WP_004511747.1|3064126_3065500_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.1	8.1e-27
WP_004511746.1|3065754_3066711_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004511745.1|3066801_3068112_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.0	4.4e-54
WP_004511744.1|3068208_3068766_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.2	1.2e-05
WP_187148485.1|3068823_3070626_-	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.6	8.6e-85
WP_004511742.1|3070625_3071504_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	39.9	8.6e-38
>prophage 9
NC_007517	Geobacter metallireducens GS-15, complete sequence	3997420	3691419	3730426	3997420	plate,transposase	Escherichia_phage(33.33%)	33	NA	NA
WP_004514801.1|3691419_3692445_-|transposase	IS21-like element ISGme4 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	1.6e-83
WP_148206087.1|3692526_3693540_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011366174.1|3694108_3694927_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_004512508.1|3694970_3696743_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004512509.1|3697190_3697946_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004512510.1|3698031_3698340_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004512511.1|3698349_3700317_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_004512512.1|3700809_3701982_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004512513.1|3702036_3703644_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	68.1	8.6e-20
WP_011366176.1|3703789_3704581_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_004512516.1|3704586_3706593_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004512517.1|3706594_3707524_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	38.8	1.4e-43
WP_004512518.1|3707550_3708864_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004512519.1|3709006_3709585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004512520.1|3709617_3710307_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_004512521.1|3710324_3710981_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004512522.1|3711014_3711545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004512523.1|3711680_3713027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004512524.1|3713108_3713885_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_004512525.1|3713941_3714862_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004512526.1|3714911_3716087_+	thiolase family protein	NA	NA	NA	NA	NA
WP_004512527.1|3716369_3717716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004512528.1|3717763_3719077_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004512529.1|3719174_3720299_-	6-oxocyclohex-1-ene-1-carbonyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004512530.1|3720360_3721503_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004512531.1|3721549_3722692_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004512532.1|3722945_3724592_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004512533.1|3724595_3725057_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004512534.1|3725356_3725911_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004512535.1|3725907_3727299_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004512536.1|3727302_3727713_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004512537.1|3727742_3729473_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004512538.1|3729436_3730426_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
