The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007946	Escherichia coli UTI89, complete sequence	5065741	254566	297168	5065741	plate,transposase,integrase	Streptococcus_phage(28.57%)	40	295065:295124	305699:305777
WP_000224516.1|254566_255913_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|255915_256440_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|256436_257729_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|257733_258783_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|258746_260588_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|260593_261019_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|261023_262508_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|262530_263034_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263739_264258_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053636.1|264478_266461_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_000571853.1|266567_267614_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528852.1|267606_269046_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|269020_269311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|270561_271065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|271158_271647_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|271917_272688_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|272841_273315_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|273357_275802_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|276041_276620_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|276824_277592_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|277562_278303_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093936.1|278614_279364_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|279539_280037_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|280119_280278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555810.1|280356_282096_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|282040_282826_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|282896_283952_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|284003_284297_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|284299_284698_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|284707_285160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000521577.1|285349_286489_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|286485_287100_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|287156_288614_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|288874_289333_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|289424_290669_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|290726_291128_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|291237_292293_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|292581_293685_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|293696_294950_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
295065:295124	attL	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACT	NA	NA	NA	NA
WP_000068782.1|295227_297168_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000068782.1|295227_297168_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
305699:305777	attR	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTC	NA	NA	NA	NA
>prophage 2
NC_007946	Escherichia coli UTI89, complete sequence	5065741	881131	951760	5065741	portal,head,terminase,protease,holin,tail,integrase,plate,tRNA,capsid	Enterobacteria_phage(67.19%)	76	911178:911197	948472:948491
WP_000188147.1|881131_883078_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|883150_883375_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|883697_884018_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|884048_886325_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097881.1|887217_888201_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|888197_891431_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|891760_893068_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|893998_895000_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|895010_895565_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|896606_896825_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|897109_897814_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202197.1|897855_899577_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001043637.1|899577_901344_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_000537432.1|901466_902432_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|902975_903470_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077108.1|903604_907648_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|907806_908418_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|908428_909772_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|909862_911155_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
911178:911197	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078920.1|911457_911598_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488106.1|911789_912050_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132812.1|912092_913202_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000005452.1|913359_914544_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	1.1e-224
WP_000290450.1|914543_915056_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651580.1|915111_915486_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000333503.1|915494_915650_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853458.1|915636_918444_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.4	0.0e+00
WP_000979945.1|918456_918945_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|918973_919573_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_001171270.1|919677_920514_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	94.6	4.9e-152
WP_001164120.1|920517_921045_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_000972139.1|921073_921607_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	8.4e-97
WP_000108533.1|921609_923595_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	95.0	1.7e-174
WP_000071719.1|923597_924128_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111963.1|924120_925017_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
WP_001067548.1|925020_925350_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_089622660.1|925367_925934_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	6.2e-98
WP_000356336.1|925945_926581_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000920594.1|926573_927041_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780575.1|927178_927586_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
WP_000072332.1|927582_927975_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104352.1|927971_928295_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_000864901.1|928297_928498_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|928497_928992_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632354.1|929093_929894_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	1.1e-129
WP_001055104.1|929939_930992_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262654.1|931015_931852_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|932006_933758_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|933757_934804_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000206716.1|935294_935555_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	83.3	3.4e-35
WP_000224227.1|935565_935829_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001167297.1|935830_936322_-	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	7.5e-84
WP_001080499.1|936324_936639_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	94.2	1.3e-49
WP_001163786.1|936635_936968_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.3	9.3e-54
WP_000211273.1|937031_937343_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	92.2	1.2e-47
WP_000686511.1|937347_938307_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	4.2e-179
WP_000123468.1|938383_941206_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_000599371.1|941212_941578_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_170996103.1|941574_942198_-	ash family protein	NA	NA	NA	NA	NA
WP_000735345.1|942251_943076_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_001036814.1|943072_943285_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_000104291.1|943296_943596_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	1.6e-41
WP_000153700.1|943592_943859_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|943855_944059_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543035.1|944082_944493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|944586_944700_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|944696_944939_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158968.1|944950_945238_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000776265.1|945248_945599_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	94.8	2.5e-57
WP_001287827.1|945734_945926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856386.1|945932_946355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204238.1|946359_946881_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000247830.1|946984_947326_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	47.1	2.5e-17
WP_000023738.1|947395_948388_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000850286.1|948687_951132_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
948472:948491	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000213098.1|951142_951760_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 3
NC_007946	Escherichia coli UTI89, complete sequence	5065741	1237646	1282849	5065741	portal,head,terminase,protease,integrase,tail,lysis,tRNA,capsid	Enterobacteria_phage(54.39%)	65	1228166:1228179	1257937:1257950
1228166:1228179	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1237646_1238753_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1238806_1239268_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1239277_1239931_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1240102_1241353_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1241466_1242609_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1242598_1242835_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1242974_1243214_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1243197_1243524_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1243523_1243745_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1244131_1244323_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1244295_1244478_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1244474_1245155_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1245151_1245937_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1245942_1246239_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1246314_1246458_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1246426_1246591_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1246663_1247032_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1247214_1247415_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1247628_1248210_+	superinfection exclusion B family protein	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1248226_1248499_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1248476_1248659_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1248935_1249688_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1249684_1250242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1250281_1250977_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1251052_1251268_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1251409_1251706_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1251738_1252638_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1252634_1253336_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1253332_1253623_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1253696_1254137_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1254133_1254661_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1254657_1254834_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1254836_1255178_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1255384_1255747_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1255743_1255884_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1255969_1256353_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1256541_1257624_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1258212_1258428_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1257937:1257950	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1258427_1258925_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1259141_1259324_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1259414_1259708_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1260188_1260515_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1260721_1260904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1261467_1262016_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1261987_1263916_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1263899_1264106_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1264102_1265695_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1265684_1267190_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1267226_1267574_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1267631_1268660_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1268711_1269086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1269078_1269432_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1269443_1270022_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|1270018_1270414_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|1270421_1271162_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1271177_1271600_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1271581_1272016_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|1272008_1274570_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1274566_1274896_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1274895_1275594_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1275599_1276343_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1276279_1276912_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515324.1|1276972_1280455_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000290543.1|1280513_1282574_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1282570_1282849_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 4
NC_007946	Escherichia coli UTI89, complete sequence	5065741	1360703	1451328	5065741	portal,head,terminase,protease,holin,integrase,transposase,tail,lysis,capsid	Enterobacteria_phage(30.91%)	98	1354098:1354114	1407015:1407031
1354098:1354114	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1360703_1361903_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1362695_1363538_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1363587_1364046_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1364158_1365064_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1365155_1366169_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1366370_1367279_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1367422_1367836_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1368439_1369057_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1370514_1373190_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1373666_1374314_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000051910.1|1374471_1374633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|1375051_1376683_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1376768_1377689_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1377703_1378612_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1378623_1379637_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1379633_1380638_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1380690_1381020_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1381054_1382515_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1382657_1382831_+	YciY family protein	NA	NA	NA	NA	NA
WP_024250944.1|1382885_1384139_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1384438_1384735_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1384958_1385675_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1385714_1386113_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1386218_1386758_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1386787_1387531_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1387886_1388525_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1388570_1389701_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1389678_1389927_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1389991_1392463_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1392555_1392747_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1392743_1392932_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171970.1|1393497_1393719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1393878_1394034_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1394326_1394665_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1395056_1395299_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1395282_1395708_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1395779_1396850_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|1396890_1397313_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|1397504_1398467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1398482_1399484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813256.1|1400101_1400257_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|1400424_1400703_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1400704_1401751_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1401763_1402138_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1402134_1402956_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1403180_1403378_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1403528_1404578_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1405852_1406080_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1406348_1406564_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1406568_1406913_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1406878_1407151_-	hypothetical protein	NA	NA	NA	NA	NA
1407015:1407031	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000992052.1|1407256_1407790_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|1408088_1408553_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1408860_1409271_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1409328_1409562_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1409948_1410497_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622378.1|1410468_1412397_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000259002.1|1412380_1412587_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831813.1|1412583_1414176_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
WP_001253958.1|1414165_1415671_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|1415707_1416055_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1416112_1417141_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|1417192_1417576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1417568_1417922_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1417937_1418471_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1418467_1418863_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1418870_1419623_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479101.1|1419636_1420068_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.1e-41
WP_000533402.1|1420094_1420508_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1420488_1423062_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|1423058_1423388_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|1423387_1424086_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1424090_1424834_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1424770_1425373_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1425446_1425785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|1425851_1429331_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|1429398_1429998_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1430149_1433257_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1433256_1433841_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1433895_1434564_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1434620_1434890_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1435004_1435175_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|1435662_1436169_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1436214_1436715_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1436800_1436980_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1437360_1438167_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1438166_1439360_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1439371_1440730_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1440733_1442329_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1442328_1443891_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1443982_1444027_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1444164_1445046_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1445042_1445663_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1445690_1447586_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1447798_1448674_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1448713_1449304_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1449300_1450059_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1450278_1451328_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_007946	Escherichia coli UTI89, complete sequence	5065741	2244152	2252961	5065741		Enterobacteria_phage(57.14%)	8	NA	NA
WP_105453002.1|2244152_2245298_-	O18ab/O18ac family O-antigen polymerase	NA	Q9AYY5	Salmonella_phage	42.9	5.3e-80
WP_000052607.1|2245399_2246647_-	O18 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100795.1|2246643_2247201_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000857501.1|2247208_2248084_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023638.1|2248141_2249041_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699397.1|2249040_2250126_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_000183053.1|2250498_2251392_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116035.1|2251566_2252961_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	6.3e-19
>prophage 6
NC_007946	Escherichia coli UTI89, complete sequence	5065741	2349183	2358628	5065741		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|2349183_2350320_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|2350316_2352320_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2352444_2352906_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2352946_2353417_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2353463_2354183_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2354179_2355865_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2356086_2356818_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2356877_2356985_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2356965_2357697_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2357701_2358628_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 7
NC_007946	Escherichia coli UTI89, complete sequence	5065741	2567236	2637775	5065741	portal,head,terminase,protease,holin,integrase,tail,lysis,tRNA,coat	Enterobacteria_phage(93.44%)	86	2584194:2584210	2628526:2628542
WP_001283598.1|2567236_2568049_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2568048_2569062_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2569127_2570264_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2570362_2571358_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2571354_2572533_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2572797_2574018_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2574176_2576183_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2576303_2576582_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|2576615_2577164_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447368.1|2577163_2577973_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043802.1|2577972_2578797_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2578800_2579886_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2579920_2580853_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2581018_2581570_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2581889_2582732_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2582733_2583261_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2583257_2583737_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2583733_2584237_-	fimbrial protein	NA	NA	NA	NA	NA
2584194:2584210	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2584253_2585006_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2585025_2587674_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|2588862_2589348_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|2589550_2591695_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2591694_2593005_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2593185_2593470_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2593841_2595182_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2595239_2595995_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2596288_2597221_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2597532_2598690_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000129909.1|2599873_2602819_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	100.0	0.0e+00
WP_000835351.1|2602919_2603843_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	100.0	1.7e-177
WP_000865489.1|2604106_2604247_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283825.1|2604352_2604610_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	100.0	4.5e-40
WP_001555939.1|2604633_2604882_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	100.0	3.1e-38
WP_001555940.1|2604942_2605524_+	hypothetical protein	NA	A5VW61	Enterobacteria_phage	100.0	1.7e-103
WP_000431541.1|2605508_2605928_+	type II toxin-antitoxin system YafO family toxin	NA	A5VW62	Enterobacteria_phage	100.0	1.6e-74
WP_000288815.1|2605950_2606274_+	hypothetical protein	NA	A5VW63	Enterobacteria_phage	100.0	4.9e-23
WP_001029855.1|2606274_2608434_-	hypothetical protein	NA	A5VW64	Enterobacteria_phage	100.0	0.0e+00
WP_000246973.1|2608433_2609783_-	DNA transfer protein	NA	A5VW65	Enterobacteria_phage	100.0	4.5e-248
WP_000964906.1|2609793_2610486_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	100.0	6.6e-118
WP_000627629.1|2610488_2610944_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2610943_2611645_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2611644_2613063_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2613072_2613534_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|2613514_2613703_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013270.1|2613744_2614998_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_000372589.1|2615016_2615910_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|2616000_2618199_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2618200_2619616_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2619612_2620053_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2620055_2620298_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2620525_2621068_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2621273_2621426_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2621413_2621851_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2621847_2622324_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2622307_2622631_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|2623227_2623746_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|2623742_2623931_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2623927_2624290_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2624286_2624577_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2624576_2625299_-	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950950.1|2625291_2625468_-	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_000386637.1|2625460_2625808_-	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_001254255.1|2625810_2625987_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736904.1|2625983_2626424_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001248381.1|2626698_2628075_-	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_000431320.1|2628071_2628959_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
2628526:2628542	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2629021_2629294_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2629316_2629610_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2629718_2629904_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2629984_2630635_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_011478232.1|2630755_2631145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219338.1|2631156_2631456_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_000213976.1|2631534_2631735_+	antirestriction Ral family protein	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|2631793_2632216_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|2633399_2633531_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2633515_2633668_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|2633924_2634530_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2634529_2634913_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2634936_2635233_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2635327_2635846_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2635842_2636142_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2636143_2636716_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253289.1|2636715_2637000_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|2636992_2637277_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2637349_2637517_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2637574_2637775_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 8
NC_007946	Escherichia coli UTI89, complete sequence	5065741	2853768	2941121	5065741	portal,head,terminase,protease,holin,tail,plate,lysis,tRNA,capsid	Shigella_phage(42.86%)	95	NA	NA
WP_000083664.1|2853768_2854506_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2854637_2855972_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2856004_2856886_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2856988_2857576_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2857631_2858015_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2858319_2859009_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|2859056_2860094_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2860300_2860720_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2860788_2861487_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082936.1|2861518_2864179_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2864292_2865648_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2865693_2866017_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2866013_2867312_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|2875800_2878374_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2878503_2879235_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|2879231_2880212_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2880346_2881084_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2881353_2881695_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2881798_2881846_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200106.1|2881944_2883105_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2883147_2884269_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168026.1|2884279_2885350_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2885559_2885925_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2886073_2886592_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2886581_2887808_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2887823_2888306_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2888382_2888730_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2888771_2889539_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2889569_2890118_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2890136_2890385_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2890521_2891883_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2892049_2892841_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077634785.1|2892861_2894148_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2894202_2894796_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2894918_2895797_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2895882_2897544_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2897692_2898034_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2898095_2898386_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2898375_2898852_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2898983_2899466_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|2900622_2901411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2901498_2901792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2902002_2902776_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2903827_2905717_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2905970_2906462_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2906464_2906908_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2906879_2907482_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2907481_2908225_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2908228_2908813_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2908803_2909862_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2909848_2910274_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2910273_2910822_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2910821_2911901_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2911897_2913226_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2913286_2915122_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2915263_2915533_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2915532_2915889_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2915888_2917385_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2917368_2917539_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2917547_2918108_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2918104_2918611_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2918585_2918996_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2918992_2919316_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2919318_2919519_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2919568_2920774_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2920788_2921439_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2921416_2922658_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2922657_2922840_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2922851_2924348_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2924581_2925076_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2925201_2925552_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_001332386.1|2926200_2926452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2926522_2926960_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2926956_2927433_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2927419_2927725_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2927876_2928212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2928397_2929150_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2929163_2930153_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2930160_2930958_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2930977_2931367_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2931363_2931690_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|2931686_2932340_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|2932339_2932834_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2932830_2933772_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2933761_2933941_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2934116_2934668_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2934711_2934912_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2935002_2935677_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2935879_2936392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2936860_2937223_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2937288_2938113_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2938240_2938765_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2938873_2939740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2939781_2939988_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2939948_2941121_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NC_007946	Escherichia coli UTI89, complete sequence	5065741	3016650	3024369	5065741		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|3016650_3019212_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001555984.1|3019317_3019542_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	5.8e-07
WP_001296319.1|3020603_3021371_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|3021566_3022475_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|3022471_3023734_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|3023730_3024369_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NC_007946	Escherichia coli UTI89, complete sequence	5065741	4987410	5034949	5065741	portal,terminase,protease,integrase,tail,lysis	Enterobacteria_phage(48.08%)	56	4985033:4985049	5023108:5023124
4985033:4985049	attL	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001218287.1|4987410_4988625_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4989000_4989996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628710.1|4990563_4991358_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	49.8	2.7e-59
WP_001229296.1|4991354_4991720_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206713.1|4991721_4992078_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	74.1	7.7e-38
WP_001242727.1|4992077_4992440_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.7e-64
WP_000008232.1|4992430_4992967_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081290.1|4993094_4993919_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|4993984_4994347_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|4995069_4995762_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4995859_4996120_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|4996112_4996664_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087313.1|4996660_4997812_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000620696.1|4997808_4998033_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_000061519.1|4998029_4998848_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_011478357.1|4998844_4999339_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	2.6e-84
WP_000066917.1|4999338_4999992_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|4999988_5000315_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767115.1|5000311_5000701_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_001061386.1|5000720_5001518_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_001577384.1|5001525_5002515_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001204752.1|5002532_5002898_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.0	5.1e-53
WP_001033965.1|5002982_5003429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917723.1|5003699_5003903_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_000799705.1|5004053_5005106_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000839596.1|5005173_5005389_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|5005388_5005886_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|5005882_5006350_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|5006337_5006490_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000349501.1|5007165_5007657_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_000934133.1|5007656_5009759_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|5009755_5009968_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|5009895_5011476_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001360054.1|5011420_5013448_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|5013534_5013858_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5013850_5014126_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677123.1|5014137_5014728_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001079398.1|5014724_5015126_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211119.1|5015136_5015880_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
WP_001298500.1|5015940_5016327_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5016335_5016665_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372035.1|5016636_5019693_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	99.5	0.0e+00
WP_000447253.1|5019692_5020022_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152386.1|5020031_5020730_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_032142951.1|5020734_5021478_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_011478365.1|5021375_5022023_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_000515451.1|5022083_5025479_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
5023108:5023124	attR	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001228265.1|5025546_5026146_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	1.2e-99
WP_000741755.1|5026210_5028586_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	70.2	5.1e-170
WP_000654148.1|5028585_5028867_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	2.4e-18
WP_001555784.1|5028876_5029917_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	2.4e-124
WP_001555785.1|5029959_5030253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954672.1|5030556_5031315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389073.1|5031413_5032448_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.8	7.1e-76
WP_001217535.1|5032894_5033143_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000202563.1|5033362_5034949_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 1
NC_007941	Escherichia coli UTI89 plasmid pUTI89, complete sequence	114230	3303	61615	114230	transposase,integrase	Escherichia_phage(29.41%)	49	NA	NA
WP_001067837.1|3303_4008_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_077459403.1|4037_4265_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000949451.1|4254_4761_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|4943_5759_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001332815.1|6105_7992_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|8032_8560_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|8663_10043_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|10045_11329_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|11318_12449_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|12453_13149_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|13135_13621_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|13645_14131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|17037_17298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|17294_17804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|17823_18171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|18299_18635_+	colicin transporter	NA	NA	NA	NA	NA
WP_001224623.1|21104_21980_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_000981091.1|21987_22764_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|22932_25194_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|25262_26438_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_000065240.1|27759_28515_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000143800.1|28511_30011_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001189113.1|31119_32628_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|33129_33534_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|33530_33878_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|34957_35980_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_001323403.1|35979_36759_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000977394.1|37497_38289_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|38295_40266_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|41508_41781_+	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001072358.1|42627_43797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332784.1|44163_44352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066947.1|44472_45213_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309253.1|45455_46433_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_000990667.1|47607_48249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|50570_50789_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|50790_51096_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016976.1|51096_51906_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	8.7e-53
WP_000239529.1|52043_52319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|52312_52957_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103694.1|53185_54157_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340835.1|54161_54554_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000109079.1|55828_56266_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000619112.1|56262_56511_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000115885.1|56645_57164_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343766.1|57182_58403_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001298676.1|58821_59652_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000544830.1|59645_60443_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000952372.1|60442_61615_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
