The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007954	Shewanella denitrificans OS217, complete genome	4545906	1246070	1318933	4545906	integrase,transposase	Staphylococcus_phage(21.43%)	58	1302860:1302902	1308893:1308935
WP_011495538.1|1246070_1246958_+|transposase	IS982-like element ISSde7 family transposase	transposase	NA	NA	NA	NA
WP_011495539.1|1247055_1249143_-	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	31.3	1.5e-96
WP_011495540.1|1249504_1250194_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_011495541.1|1250908_1252771_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.8	1.2e-41
WP_011495542.1|1252905_1253565_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011495543.1|1253673_1254489_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011495544.1|1254498_1255686_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011495545.1|1255973_1256870_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_011495546.1|1256951_1258208_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011495547.1|1258303_1259335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011495548.1|1259338_1260256_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_011495549.1|1260770_1262210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495550.1|1262287_1263211_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041405694.1|1263668_1264064_+	DUF2391 family protein	NA	NA	NA	NA	NA
WP_011495552.1|1264171_1264963_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_157599836.1|1264989_1265316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495554.1|1265399_1266650_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_011495555.1|1266646_1267183_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011495556.1|1267179_1270053_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_011495557.1|1270504_1270993_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011495558.1|1271111_1271810_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011495559.1|1272107_1273316_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_041405695.1|1273530_1274016_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011495561.1|1274390_1275464_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	41.6	1.3e-67
WP_011495562.1|1275805_1276708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495563.1|1276872_1277625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041405696.1|1277977_1278181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495564.1|1278497_1279679_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011495565.1|1280182_1283908_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	59.0	3.0e-15
WP_011495566.1|1284404_1285328_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	1.8e-14
WP_041406094.1|1285327_1286374_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011495568.1|1286600_1287389_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_041406095.1|1287619_1288231_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_041406096.1|1288468_1289215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495571.1|1289459_1289762_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_011495572.1|1289821_1290790_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011495573.1|1291291_1292341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495574.1|1292347_1293406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495575.1|1293639_1294059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157599917.1|1294074_1294218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011495578.1|1295949_1297956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041405697.1|1298219_1298867_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011495580.1|1299207_1300167_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.6	8.4e-55
WP_157599837.1|1300857_1301358_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_011495582.1|1301741_1302317_+	sel1 repeat family protein	NA	NA	NA	NA	NA
1302860:1302902	attL	TGGCGAAATTGATTAGATCAGATAGCACCATGCGTGTCTACTA	NA	NA	NA	NA
WP_157599838.1|1302969_1303344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495583.1|1303351_1304323_-|transposase	IS110-like element ISSde13 family transposase	transposase	NA	NA	NA	NA
WP_041405698.1|1304646_1305207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011495585.1|1305485_1306574_-|transposase	IS91-like element ISSde12 family transposase	transposase	NA	NA	NA	NA
WP_011495586.1|1306570_1307461_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.9	5.5e-24
WP_086022097.1|1309902_1311061_+|transposase	IS3-like element ISSde8 family transposase	transposase	U5P429	Shigella_phage	38.3	6.6e-38
1308893:1308935	attR	TGGCGAAATTGATTAGATCAGATAGCACCATGCGTGTCTACTA	NA	NA	NA	NA
WP_011495588.1|1311454_1313122_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.6	1.1e-38
WP_011495589.1|1313311_1314565_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.4	9.2e-102
WP_011495590.1|1314678_1315128_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_011495591.1|1315260_1316397_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.2	6.9e-48
WP_011495592.1|1316499_1317153_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	32.5	2.8e-25
WP_011495593.1|1317228_1318332_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.5	1.9e-66
WP_011495594.1|1318453_1318933_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	1.5e-28
>prophage 2
NC_007954	Shewanella denitrificans OS217, complete genome	4545906	3187471	3194872	4545906		Enterobacteria_phage(33.33%)	8	NA	NA
WP_011497086.1|3187471_3188572_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	30.2	5.0e-11
WP_011497087.1|3188576_3189347_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011497088.1|3189381_3190485_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.7	1.7e-38
WP_011497089.1|3190484_3191399_-	isomerase	NA	NA	NA	NA	NA
WP_011497090.1|3191412_3191952_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.4	7.1e-51
WP_011497091.1|3191952_3192828_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.4	1.2e-39
WP_011497092.1|3192829_3193699_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	68.2	1.0e-107
WP_011497093.1|3193783_3194872_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.7	2.4e-98
>prophage 3
NC_007954	Shewanella denitrificans OS217, complete genome	4545906	3536803	3609567	4545906	protease,transposase,tRNA,tail	Streptococcus_phage(14.29%)	51	NA	NA
WP_011497383.1|3536803_3537760_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_011497384.1|3538186_3538852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497385.1|3539566_3541660_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	5.9e-61
WP_011497386.1|3541965_3542844_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.8	8.6e-14
WP_011495916.1|3542840_3544043_-|transposase	IS4-like element ISSde1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	49.7	2.1e-111
WP_083759694.1|3544141_3544750_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011497388.1|3545050_3549604_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011497389.1|3549728_3550640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011497390.1|3550704_3551436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157599871.1|3551647_3552115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497392.1|3552074_3552788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497393.1|3552797_3553481_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_011497394.1|3553534_3554602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041405847.1|3554628_3555261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497396.1|3555498_3556836_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011497397.1|3557252_3558452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049763060.1|3558530_3559142_+|protease	SprT family zinc-dependent metalloprotease	protease	A0A125ST76	Ralstonia_phage	44.8	6.6e-05
WP_083759695.1|3559346_3559967_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_011497400.1|3559980_3560715_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_011497401.1|3560750_3561710_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011497402.1|3561712_3563098_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011497403.1|3563214_3564252_+	methyltransferase	NA	NA	NA	NA	NA
WP_011497404.1|3564539_3566207_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_083759659.1|3566268_3566700_+	DUF4144 domain-containing protein	NA	NA	NA	NA	NA
WP_011497406.1|3566789_3567971_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011497407.1|3568144_3569032_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011497408.1|3569044_3570394_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_011497409.1|3570823_3571261_-	DUF3293 domain-containing protein	NA	NA	NA	NA	NA
WP_011497410.1|3571926_3572643_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_157599951.1|3572761_3575026_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_011497412.1|3575610_3576603_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	38.1	2.4e-44
WP_011497413.1|3576693_3577947_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011497414.1|3578129_3579038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497415.1|3579025_3580246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497416.1|3580242_3580890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497417.1|3580889_3584579_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041406440.1|3585018_3585447_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_011497419.1|3585778_3586231_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011497420.1|3586624_3587653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497421.1|3587801_3590555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497422.1|3590551_3591988_-	ATP-binding protein	NA	A0A1C9EGA6	Acidianus_two-tailed_virus	37.8	2.4e-13
WP_011497423.1|3592089_3597723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497424.1|3597712_3600433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497425.1|3600422_3601340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497426.1|3601332_3605574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041406443.1|3605563_3605980_-	GPW/gp25 family protein	NA	D6PHT9	uncultured_phage	28.2	1.1e-06
WP_011497428.1|3606134_3606434_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_041405848.1|3606444_3608235_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011497430.1|3608269_3608911_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_157599872.1|3608920_3609091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497431.1|3609093_3609567_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NC_007954	Shewanella denitrificans OS217, complete genome	4545906	3831636	3891614	4545906	integrase,terminase,protease,tail,tRNA,portal	Vibrio_phage(25.0%)	62	3862220:3862235	3887400:3887415
WP_011497618.1|3831636_3832095_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_011497619.1|3832094_3832724_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011497620.1|3832818_3833514_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011497621.1|3833513_3834728_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011497622.1|3834727_3835318_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011497623.1|3835769_3836666_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011497624.1|3836669_3837830_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011497625.1|3837862_3839170_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011497626.1|3839193_3839463_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_041405866.1|3839546_3840473_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_011497628.1|3840465_3842463_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.0	1.1e-56
WP_011497629.1|3842469_3843837_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	29.3	7.6e-17
WP_041405868.1|3843839_3844298_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011497631.1|3844442_3844898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497632.1|3845153_3845876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011497633.1|3847171_3847717_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	38.7	2.3e-25
WP_011497634.1|3847825_3848887_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_011497635.1|3848919_3849789_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_011497636.1|3849952_3850675_+	glycerophosphodiester phosphodiesterase	NA	A0A0D3MUY6	Staphylococcus_phage	28.5	6.8e-17
WP_011497637.1|3850750_3851086_-	DUF3392 domain-containing protein	NA	NA	NA	NA	NA
WP_011497638.1|3851273_3851465_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011497639.1|3851688_3854001_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	7.6e-86
WP_011497640.1|3853993_3855154_-	L-sorbosone dehydrogenase	NA	NA	NA	NA	NA
WP_011497641.1|3855290_3857177_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	5.8e-92
WP_011497642.1|3857222_3857798_-	esterase	NA	NA	NA	NA	NA
WP_011497643.1|3857919_3858759_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_041406483.1|3858786_3859230_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_011497645.1|3859297_3859921_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_011497646.1|3860277_3861576_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_011497647.1|3861877_3862621_-	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
3862220:3862235	attL	CACATCAAGCTCGGCC	NA	NA	NA	NA
WP_011497648.1|3862686_3863658_-	DUF2333 family protein	NA	NA	NA	NA	NA
WP_011497649.1|3863670_3864162_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_011497650.1|3864197_3864935_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011497651.1|3865013_3865214_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_157599880.1|3865239_3865422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497652.1|3865418_3865736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049763066.1|3866060_3867089_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011497654.1|3867208_3868279_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	55.9	9.9e-113
WP_011497655.1|3868296_3868869_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_011497656.1|3868869_3870126_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	43.4	1.4e-89
WP_011497657.1|3870126_3870534_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1L5C2A3	Pseudoalteromonas_phage	52.3	6.1e-23
WP_011497658.1|3870626_3870839_-	hypothetical protein	NA	A0A2I7QRW3	Vibrio_phage	58.6	6.0e-14
WP_011497659.1|3870864_3872646_-	hypothetical protein	NA	A0A2I7QS09	Vibrio_phage	44.9	1.1e-140
WP_011497660.1|3872649_3872949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497661.1|3872941_3873946_-	hypothetical protein	NA	A0A088C4T9	Shewanella_sp._phage	33.6	3.6e-32
WP_011497662.1|3873970_3876376_-	hypothetical protein	NA	A0A2I7QRV0	Vibrio_phage	61.0	5.9e-283
WP_041405870.1|3876386_3876758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497664.1|3876784_3881044_-|tail	phage tail tape measure protein	tail	A0A2I7QRW8	Vibrio_phage	43.3	3.9e-229
WP_011497665.1|3881134_3881854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497666.1|3881850_3882276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497667.1|3882295_3882853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497668.1|3882856_3883189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497669.1|3883181_3883502_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_083759699.1|3883567_3885619_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	58.9	7.5e-202
WP_011497671.1|3885563_3887138_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	47.9	5.1e-126
WP_011497672.1|3887252_3887459_-	hypothetical protein	NA	NA	NA	NA	NA
3887400:3887415	attR	CACATCAAGCTCGGCC	NA	NA	NA	NA
WP_041405871.1|3887487_3889470_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	50.5	4.3e-194
WP_011497674.1|3889444_3889975_-	DNA packaging protein	NA	O64316	Escherichia_phage	47.8	4.1e-35
WP_157599881.1|3889974_3890265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497676.1|3890363_3890801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011497677.1|3890790_3891270_-	lysozyme	NA	A0A1S5R1I9	Pseudomonas_phage	49.4	3.3e-36
WP_011497678.1|3891266_3891614_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	54.6	3.3e-25
