The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	40991	117289	3576473	transposase,tRNA,protease	Catovirus(22.22%)	59	NA	NA
WP_157862198.1|40991_41918_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011671426.1|42571_43279_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011671427.1|43282_44251_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.5	1.4e-33
WP_002722652.1|44234_44774_-	UpxY family transcription antiterminator	NA	NA	NA	NA	NA
WP_011671199.1|44757_45237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671428.1|46141_47839_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.5	1.3e-34
WP_011671201.1|47969_48842_+	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_011671202.1|48838_49777_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	50.3	1.5e-88
WP_011671203.1|49854_51024_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002756116.1|50982_51519_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011671204.1|51515_52835_-|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	33.3	1.7e-66
WP_011671429.1|52841_53990_-	DUF1577 domain-containing protein	NA	NA	NA	NA	NA
WP_011671206.1|53999_56054_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_011671207.1|56148_56991_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_011671208.1|57199_57523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671430.1|57532_58417_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011671210.1|60709_61900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002727881.1|61874_62783_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011671211.1|62888_63800_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	9.6e-16
WP_011671212.1|64513_65230_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_026131217.1|65548_66442_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011671431.1|66405_67821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671216.1|69221_70505_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011671433.1|70645_73828_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_011671218.1|73820_74711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671219.1|74964_78141_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_011671220.1|78234_78705_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011671221.1|78778_79300_-	dCTP deaminase	NA	R4T945	Halovirus	37.4	1.9e-16
WP_011671222.1|79300_80083_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011671223.1|80115_80910_+	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_002630872.1|81024_81234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671224.1|81323_81692_-	VOC family protein	NA	NA	NA	NA	NA
WP_011671225.1|81802_82891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671226.1|82887_84525_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011671227.1|84618_85371_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011671435.1|85359_86211_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002727865.1|86359_87205_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011671229.1|87211_87916_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002727858.1|87950_88235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002730426.1|88770_89118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671230.1|89216_89798_-	histidine kinase	NA	NA	NA	NA	NA
WP_157862215.1|90927_92199_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011669401.1|92985_94080_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011671437.1|94667_95078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002727842.1|95031_95478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669168.1|95796_97050_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_011671438.1|99179_100274_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017860016.1|100529_100769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669166.1|100907_102959_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.0	2.2e-12
WP_002732728.1|103479_104139_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011669164.1|104790_106566_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	29.1	3.0e-37
WP_040962920.1|106593_108768_+	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_011671440.1|109384_110878_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_011669162.1|110942_112007_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	45.2	9.5e-07
WP_002728633.1|112047_112653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669161.1|112897_114058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669160.1|114690_115740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002728619.1|115745_116180_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002728635.1|116623_117289_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	446669	515145	3576473	portal,transposase	Shigella_phage(18.18%)	55	NA	NA
WP_011669147.1|446669_447764_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011671516.1|448050_448323_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011670992.1|448451_449834_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011671517.1|449836_451669_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.8	2.7e-102
WP_011670990.1|451676_452723_+	GlmU family protein	NA	NA	NA	NA	NA
WP_002753831.1|455058_456336_+	ammonium transporter	NA	NA	NA	NA	NA
WP_002619748.1|456370_456715_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011671518.1|457451_458312_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011670986.1|458338_458683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671519.1|458972_460067_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002753866.1|460510_461176_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011670984.1|461175_462234_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011670983.1|462243_463494_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011670982.1|463511_464174_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002754115.1|464288_466409_-	elongation factor G	NA	D0R0F5	Streptococcus_phage	27.2	7.3e-59
WP_011670980.1|466665_468285_+	potassium transporter Trk	NA	NA	NA	NA	NA
WP_002723145.1|468547_469441_+	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011670979.1|469673_470177_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011670978.1|470279_471044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002723191.1|471745_472723_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.6	4.5e-11
WP_011671520.1|472952_473909_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011669461.1|474533_475628_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002738799.1|476361_476874_-	VOC family protein	NA	NA	NA	NA	NA
WP_017859271.1|477015_477189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011670975.1|477733_479782_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011670974.1|479899_480586_-	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	32.3	5.2e-14
WP_011671521.1|480602_481145_-	phosphopantothenoylcysteine decarboxylase	NA	Q9J5A8	Fowlpox_virus	32.2	6.7e-17
WP_011670973.1|481164_482499_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011670972.1|482725_485311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671522.1|485317_486325_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011671523.1|486446_487130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002732926.1|487240_488242_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_011671524.1|488244_488922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670968.1|488918_489335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671525.1|489315_491490_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011670966.1|492170_492419_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011670965.1|492412_492736_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_011671526.1|493163_494699_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002728323.1|496090_496435_-	TIGR04452 family lipoprotein	NA	NA	NA	NA	NA
WP_011670962.1|496768_497512_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011670961.1|497518_498490_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.1	2.5e-46
WP_011670960.1|498486_499266_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002754065.1|499990_501013_-	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	60.6	5.7e-118
WP_011670959.1|501374_502748_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011670958.1|503094_504396_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_011671527.1|504454_505348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671528.1|505347_507147_+|portal	portal protein	portal	NA	NA	NA	NA
WP_002754046.1|507160_507880_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_011670955.1|507969_508257_-	acylphosphatase	NA	NA	NA	NA	NA
WP_011670953.1|508504_508993_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011670952.1|509622_510054_+	SET domain-containing protein-lysine N-methyltransferase	NA	A0A2H4UVV9	Bodo_saltans_virus	30.6	2.6e-08
WP_011670951.1|510235_511024_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	25.9	7.5e-17
WP_011670950.1|511176_511560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862199.1|512197_513338_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.0	6.3e-41
WP_157862199.1|514003_515145_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.0	6.3e-41
>prophage 3
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	639496	695063	3576473	transposase,integrase,tRNA	Leptospira_phage(50.0%)	39	680342:680369	711264:711291
WP_011671552.1|639496_642145_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.8	2.1e-164
WP_002729738.1|642254_642479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671553.1|642996_644571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671554.1|644545_646084_-	spiro-SPASM protein	NA	NA	NA	NA	NA
WP_002728351.1|646133_647168_-	putative peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011671555.1|647228_649304_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.6	9.2e-06
WP_011671556.1|649488_651573_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.6	9.2e-06
WP_011670872.1|652584_653802_-	aspartate kinase	NA	NA	NA	NA	NA
WP_011670871.1|653979_655794_+	Na+:solute symporter	NA	NA	NA	NA	NA
WP_011671557.1|657257_658007_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_026054111.1|658085_658607_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_017859740.1|658596_658776_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011670866.1|658829_659747_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011670863.1|661744_662359_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011671578.1|662681_663938_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011670862.1|663990_664851_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002729103.1|664894_666220_+	thiolase family protein	NA	NA	NA	NA	NA
WP_080504680.1|666801_667386_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VSW1	Leptospira_phage	55.9	5.0e-42
WP_011671578.1|667907_669164_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011670860.1|669610_670297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002752999.1|670272_670671_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011670859.1|670670_671267_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011670858.1|671263_673453_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002729012.1|673473_673869_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011670857.1|673968_674790_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002729106.1|675154_675523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671560.1|675531_677865_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002728986.1|677921_678248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670855.1|678988_679825_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011670854.1|679898_680285_+	cation transporter	NA	NA	NA	NA	NA
680342:680369	attL	TAAGCAAAGATAAAGTATTTTTGAGATA	NA	NA	NA	NA
WP_017859288.1|680392_681304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670853.1|681786_682959_+	CoA transferase	NA	NA	NA	NA	NA
WP_002729082.1|683236_684400_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011671561.1|684933_685884_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_011670851.1|686211_687174_-	porin OmpL1	NA	NA	NA	NA	NA
WP_162010759.1|687937_688159_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	87.7	1.9e-31
WP_162010757.1|688162_688594_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	83.2	1.9e-62
WP_011670850.1|692269_692557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671562.1|693968_695063_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
711264:711291	attR	TATCTCAAAAATACTTTATCTTTGCTTA	NA	NA	NA	NA
>prophage 4
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	953630	1038890	3576473	transposase,integrase,tRNA	Leptospira_phage(42.86%)	58	949010:949028	970553:970571
949010:949028	attL	CAACTTCGACGTTCTTTCC	NA	NA	NA	NA
WP_011670693.1|953630_954545_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VSW1	Leptospira_phage	60.4	1.1e-96
WP_011670692.1|954673_955348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670691.1|955513_956569_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011670690.1|956599_956884_+	Cys-rich protein	NA	NA	NA	NA	NA
WP_011670689.1|956896_958633_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011671625.1|958955_959432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671626.1|959695_960700_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011671627.1|961983_962982_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011671628.1|963103_963751_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_002727027.1|965031_965538_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_011670685.1|965557_968635_+	TAT-variant-translocated molybdopterin oxidoreductase	NA	NA	NA	NA	NA
WP_002727039.1|968660_970028_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_011670684.1|970027_970579_+	DUF3341 domain-containing protein	NA	NA	NA	NA	NA
970553:970571	attR	GGAAAGAACGTCGAAGTTG	NA	NA	NA	NA
WP_050754924.1|970682_971282_+	cytochrome c	NA	NA	NA	NA	NA
WP_011671630.1|971287_972511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002756177.1|972524_973004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670681.1|973337_974144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671631.1|974490_975303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670679.1|975999_976545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002726996.1|976541_977000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670678.1|977160_977847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080504683.1|981310_983188_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011670677.1|983940_985098_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080504586.1|985517_986891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017859081.1|986981_987731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040962942.1|989665_991201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671632.1|991301_993827_-	cAMP-binding protein	NA	NA	NA	NA	NA
WP_011671633.1|993954_995130_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_011670674.1|995611_997099_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	33.5	6.9e-48
WP_011670673.1|997095_997575_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002756175.1|998127_998541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671634.1|998958_1000353_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_011670671.1|1001848_1002286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020779893.1|1002282_1003755_-	amino acid permease	NA	NA	NA	NA	NA
WP_011671635.1|1009881_1010460_+	DUF1564 family protein	NA	NA	NA	NA	NA
WP_181742550.1|1011103_1012240_-|transposase	transposase	transposase	S5VTD8	Leptospira_phage	40.9	6.7e-51
WP_011671637.1|1012966_1013710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040962815.1|1013962_1015801_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002733012.1|1015818_1016379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002725263.1|1016409_1016892_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002750684.1|1016888_1018013_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.5	1.3e-78
WP_002745051.1|1018082_1018418_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011671638.1|1018465_1020118_+	lipoprotein LipL71	NA	NA	NA	NA	NA
WP_011671639.1|1021062_1021977_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_011670662.1|1021982_1024007_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.0	1.7e-09
WP_011671640.1|1024020_1025823_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002733102.1|1025833_1026901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080504589.1|1027527_1027707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671641.1|1027645_1028947_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	2.9e-18
WP_011671642.1|1028947_1029727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670658.1|1030023_1030830_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_002725220.1|1030927_1031266_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011670656.1|1031317_1031812_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_011671562.1|1033721_1034816_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011669731.1|1035974_1036352_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_002727231.1|1036341_1036644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669733.1|1037048_1037474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080504590.1|1038347_1038890_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VSW1	Leptospira_phage	51.1	1.1e-38
>prophage 5
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	1043199	1106383	3576473	transposase,tRNA,protease	Bodo_saltans_virus(16.67%)	52	NA	NA
WP_011671562.1|1043199_1044294_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002721507.1|1045836_1046280_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002733069.1|1046421_1047225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669730.1|1047316_1048147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671645.1|1048185_1050006_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_002750674.1|1050002_1051352_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011671646.1|1051434_1052028_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_011669727.1|1052024_1052669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669726.1|1054822_1055758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669725.1|1058374_1060195_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_157862218.1|1060522_1061794_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011671648.1|1062100_1062982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669723.1|1063083_1063941_-	pirin family protein	NA	NA	NA	NA	NA
WP_011671605.1|1064519_1065614_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020780011.1|1066140_1067355_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	21.1	5.7e-08
WP_011671649.1|1068328_1069075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669147.1|1071270_1072365_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011669737.1|1073473_1074616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002727291.1|1074767_1075118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669739.1|1075092_1076475_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011669740.1|1076482_1077256_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011669741.1|1077871_1078348_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	40.2	8.0e-14
WP_011669742.1|1078379_1078985_-	DUF3332 domain-containing protein	NA	NA	NA	NA	NA
WP_002727299.1|1079152_1080607_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.6	1.3e-54
WP_002750065.1|1080737_1081097_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_002727273.1|1081160_1081784_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	28.8	6.1e-06
WP_002750286.1|1081789_1082353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669743.1|1082377_1083424_-	sugar phosphotransferase	NA	NA	NA	NA	NA
WP_181742547.1|1083479_1084403_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011669745.1|1084405_1085215_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011669746.1|1085230_1086052_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_026054144.1|1086054_1087110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669747.1|1087106_1087481_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002619461.1|1087484_1087706_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002727323.1|1087714_1088092_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_002727255.1|1088114_1088375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669748.1|1088378_1089263_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_080504595.1|1089270_1089876_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_002727321.1|1089879_1090620_+	UMP kinase	NA	NA	NA	NA	NA
WP_002727297.1|1090609_1091164_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002750335.1|1091165_1091891_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.1	8.1e-18
WP_002727305.1|1091883_1092798_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011669751.1|1092804_1093974_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011671652.1|1093967_1095695_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011671653.1|1095699_1097430_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011669754.1|1097432_1098635_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_002727293.1|1098631_1099426_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011671654.1|1099488_1099962_-	DUF1564 family protein	NA	NA	NA	NA	NA
WP_011671655.1|1100111_1102424_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	37.0	2.2e-48
WP_011669757.1|1102452_1104360_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011669758.1|1104401_1104872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671656.1|1105288_1106383_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	1488577	1526112	3576473	transposase,tRNA,protease	Acinetobacter_phage(14.29%)	24	NA	NA
WP_157862221.1|1488577_1489849_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_002622178.1|1490242_1491091_+	flagellin	NA	NA	NA	NA	NA
WP_011670149.1|1491265_1491571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040962842.1|1491612_1493013_+	TolC family protein	NA	NA	NA	NA	NA
WP_002622159.1|1497619_1498471_-	flagellin	NA	NA	NA	NA	NA
WP_004281802.1|1498799_1499351_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011670151.1|1499326_1500631_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.8	3.6e-64
WP_011671721.1|1500679_1501951_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_157862204.1|1503252_1504394_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.4	4.4e-42
WP_193338944.1|1504938_1505704_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	2.1e-32
WP_011671722.1|1508315_1511906_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	54.5	0.0e+00
WP_040962847.1|1512925_1513975_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002728555.1|1514652_1514943_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011670154.1|1514945_1516214_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SGL7	Hokovirus	33.7	1.0e-31
WP_002728529.1|1516220_1517348_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011670155.1|1517354_1517909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670156.1|1517963_1518602_+	DedA family protein	NA	NA	NA	NA	NA
WP_011670157.1|1519044_1520604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670158.1|1520754_1521066_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_011670159.1|1521062_1522613_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_011670160.1|1522600_1523170_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011670161.1|1523201_1524137_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.8	7.5e-24
WP_011670162.1|1524123_1524666_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011670163.1|1524678_1526112_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.6	1.3e-46
>prophage 7
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	2082837	2179745	3576473	transposase	uncultured_virus(20.0%)	58	NA	NA
WP_011671833.1|2082837_2083932_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017859582.1|2085980_2086379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669880.1|2086860_2087487_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_002619721.1|2088428_2088719_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	5.9e-20
WP_002730932.1|2088732_2090373_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.1	4.8e-159
WP_017859584.1|2090632_2091259_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_002756428.1|2095108_2095360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002756373.1|2095448_2095586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040962869.1|2097001_2098237_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_011669877.1|2098223_2098871_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011669876.1|2098846_2099734_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020780295.1|2099737_2101723_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_111303902.1|2101764_2101986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671836.1|2102320_2102809_-	rod-binding protein	NA	NA	NA	NA	NA
WP_111303901.1|2102805_2103921_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_011669873.1|2103989_2105054_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_011669872.1|2105050_2105935_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_002732832.1|2105953_2106748_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_002756397.1|2107759_2107978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040962870.1|2108033_2108354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002756436.1|2109109_2109415_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	54.4	3.3e-13
WP_011669870.1|2109395_2110325_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_011669869.1|2110520_2111672_-	DNA methylase	NA	NA	NA	NA	NA
WP_011669868.1|2111928_2112447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669867.1|2112462_2113293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026131114.1|2115771_2116953_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011669865.1|2117134_2118709_-	FAD-dependent thymidylate synthase	NA	NA	NA	NA	NA
WP_011669864.1|2119292_2122592_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_111303856.1|2123086_2124227_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.4	9.7e-42
WP_011670030.1|2124678_2125353_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011670029.1|2125957_2126977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671838.1|2127669_2128764_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004280367.1|2129148_2129556_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_157862221.1|2130359_2131631_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_040962965.1|2131806_2132745_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_181742548.1|2133408_2135619_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	34.4	1.1e-28
WP_011671840.1|2136679_2137042_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.1e-14
WP_011671841.1|2137049_2137424_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011671842.1|2139615_2142549_+	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	67.9	7.3e-09
WP_011670145.1|2142560_2143073_+	purine-binding chemotaxis protein CheW	NA	A0A248SKJ8	Salicola_phage	29.7	9.2e-08
WP_011671843.1|2143069_2143567_+	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_011671844.1|2143563_2144610_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011670142.1|2144748_2147496_-	biotin carboxylase	NA	NA	NA	NA	NA
WP_011670141.1|2147501_2149154_-	acetyl-CoA carboxylase carboxyltransferase subunit	NA	NA	NA	NA	NA
WP_002753350.1|2149245_2149575_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011671845.1|2149558_2152369_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_011670138.1|2153228_2153765_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	33.1	1.6e-15
WP_017859668.1|2159652_2159934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193338941.1|2160246_2161012_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	39.0	7.2e-33
WP_011669491.1|2163680_2164211_+	DUF1564 domain-containing protein	NA	NA	NA	NA	NA
WP_011670137.1|2164223_2164994_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_020780247.1|2165548_2165794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011670136.1|2166312_2167308_-	membrane protein	NA	NA	NA	NA	NA
WP_011671803.1|2167960_2168497_-	DUF1564 domain-containing protein	NA	NA	NA	NA	NA
WP_011670134.1|2171070_2173149_-	DUF1563 domain-containing protein	NA	NA	NA	NA	NA
WP_011670133.1|2174029_2176432_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002722506.1|2177303_2177870_+	lipoprotein	NA	NA	NA	NA	NA
WP_011671846.1|2178650_2179745_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	2610856	2665022	3576473	transposase,tRNA,protease	Tanapox_virus(14.29%)	38	NA	NA
WP_011671519.1|2610856_2611951_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017859141.1|2612640_2612964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011671933.1|2613316_2614681_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_011670634.1|2615189_2615801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002751725.1|2616308_2616704_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_000868962.1|2616700_2616916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164762384.1|2618704_2618878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671935.1|2621453_2622401_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	31.1	6.9e-25
WP_011670637.1|2624049_2624745_+	acireductone synthase	NA	NA	NA	NA	NA
WP_020780304.1|2625478_2626690_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011671936.1|2626790_2628077_-	DUF1577 domain-containing protein	NA	NA	NA	NA	NA
WP_002727820.1|2628602_2629130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670640.1|2629129_2629930_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_026131109.1|2629924_2631094_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_011670642.1|2631511_2632465_+	histone deacetylase	NA	A0A2K9L0I3	Tupanvirus	39.8	9.3e-46
WP_002727823.1|2633098_2633548_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002751723.1|2633722_2634010_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_011671937.1|2634065_2635007_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011671938.1|2635559_2636654_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011670644.1|2637463_2637634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002751653.1|2637782_2638886_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	28.3	5.9e-20
WP_011671938.1|2639414_2640509_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002725149.1|2641017_2641164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011670646.1|2641203_2642475_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	2.1e-69
WP_011670647.1|2642471_2642708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080504644.1|2643050_2643512_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011670649.1|2643575_2644196_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_011671940.1|2644164_2645955_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.1	1.7e-72
WP_011671941.1|2646383_2647091_+	DUF1554 domain-containing protein	NA	NA	NA	NA	NA
WP_011671942.1|2648032_2650966_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_002725176.1|2652466_2653453_-	adenosine kinase	NA	NA	NA	NA	NA
WP_002725156.1|2653457_2654360_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_011670653.1|2654368_2655127_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011671943.1|2655123_2656806_-	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011670654.1|2656919_2658314_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.8	1.1e-50
WP_011670655.1|2658605_2659043_+	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	44.4	5.4e-25
WP_011671519.1|2661401_2662496_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011671944.1|2663927_2665022_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	3038880	3099508	3576473	transposase,tRNA,protease	Staphylococcus_phage(14.29%)	49	NA	NA
WP_011669510.1|3038880_3041475_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	52.7	1.2e-252
WP_011672022.1|3042169_3043165_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_011672023.1|3043382_3044477_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011672023.1|3045905_3047000_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011669508.1|3047187_3048261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669507.1|3048267_3048999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672024.1|3049095_3050439_-	threonine synthase	NA	NA	NA	NA	NA
WP_002734290.1|3050442_3051438_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_002756879.1|3051527_3052109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672025.1|3052379_3053969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011672026.1|3054080_3055622_+	membrane protein	NA	NA	NA	NA	NA
WP_002756956.1|3055907_3056504_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011669504.1|3057274_3057868_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002756910.1|3057958_3058636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672027.1|3058766_3059441_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_002756933.1|3059472_3059829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002756872.1|3060206_3060599_-	YfeK family protein	NA	NA	NA	NA	NA
WP_011672028.1|3060783_3063243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669500.1|3063235_3064657_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_011669499.1|3064923_3065706_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002756851.1|3065827_3066934_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011672029.1|3066930_3069696_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	32.2	1.4e-46
WP_011672030.1|3070117_3071212_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040962984.1|3071518_3071698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669496.1|3071954_3072752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669495.1|3073591_3074326_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011669494.1|3074415_3075501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002725979.1|3076059_3076395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157862223.1|3077100_3078372_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011669492.1|3078752_3079787_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_017859438.1|3079897_3080113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669491.1|3080658_3081189_-	DUF1564 domain-containing protein	NA	NA	NA	NA	NA
WP_011669490.1|3081557_3082064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672032.1|3082053_3082521_-	RidA family protein	NA	NA	NA	NA	NA
WP_011669488.1|3082639_3083443_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011669487.1|3083439_3085089_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.8e-52
WP_011669486.1|3085055_3086147_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	30.3	1.7e-14
WP_011672033.1|3086127_3086913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011672034.1|3087139_3088234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_112292476.1|3088501_3089764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020780568.1|3090004_3090427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669483.1|3090493_3091891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669482.1|3092138_3093083_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_002723513.1|3093437_3094331_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002766579.1|3094435_3095194_+	NTP transferase domain-containing protein	NA	A0A1S5V090	Saudi_moumouvirus	32.8	2.4e-28
WP_002723509.1|3095190_3096129_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	1.2e-48
WP_002756938.1|3096144_3096783_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002723520.1|3096830_3097394_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002723524.1|3097549_3099508_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	44.6	4.2e-109
>prophage 10
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	3166159	3206745	3576473	transposase	Leptospira_phage(50.0%)	28	NA	NA
WP_011672043.1|3166159_3167254_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011672044.1|3167495_3168380_-	pirin family protein	NA	NA	NA	NA	NA
WP_011669414.1|3168451_3168925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669416.1|3171579_3172095_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_181742552.1|3172546_3173491_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_011672046.1|3173506_3174136_+	YceI family protein	NA	NA	NA	NA	NA
WP_011672047.1|3174297_3174627_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011669419.1|3174608_3175946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669420.1|3176471_3177515_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011669421.1|3177535_3179425_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.6e-57
WP_011669422.1|3179424_3180978_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011672048.1|3180955_3183382_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011669424.1|3184052_3184718_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.6	8.0e-20
WP_011669425.1|3184901_3185144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040962989.1|3186087_3187263_+	DUF1577 domain-containing protein	NA	NA	NA	NA	NA
WP_011672043.1|3187643_3188738_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011669411.1|3191698_3192733_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_011669410.1|3192770_3194048_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	33.0	1.8e-68
WP_011672053.1|3195861_3196956_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011672054.1|3197619_3197865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672055.1|3198357_3199389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011672056.1|3199298_3199595_-	hypothetical protein	NA	S5VY01	Leptospira_phage	83.5	7.1e-37
WP_164762382.1|3199591_3199963_-	hypothetical protein	NA	S5VY01	Leptospira_phage	75.6	2.3e-45
WP_011672057.1|3200012_3201161_-	TIGR04388 family protein	NA	S5VY01	Leptospira_phage	75.5	3.1e-128
WP_011672058.1|3201970_3202969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011669403.1|3203113_3204208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669402.1|3204295_3204973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011672059.1|3205650_3206745_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_008510	Leptospira borgpetersenii serovar Hardjo-bovis str. JB197 chromosome 1, complete sequence	3576473	3501671	3570625	3576473	transposase,tRNA	Molluscum_contagiosum_virus(11.11%)	60	NA	NA
WP_011669401.1|3501671_3502766_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011672132.1|3503305_3504928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011669205.1|3505701_3506865_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_011669204.1|3507024_3509448_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011672133.1|3509554_3510328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002721759.1|3510338_3510710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669202.1|3510837_3511806_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002721716.1|3512048_3512489_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011672134.1|3512526_3513012_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	33.3	1.4e-10
WP_011669200.1|3513295_3514090_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_011669199.1|3514093_3515905_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011672135.1|3516192_3516987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669197.1|3519321_3519576_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	43.9	1.3e-07
WP_011672136.1|3519576_3520029_-	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_002730519.1|3520230_3521496_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_011669195.1|3521535_3523446_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_011672137.1|3523478_3524006_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_011672138.1|3524866_3525898_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	49.0	5.4e-15
WP_157862214.1|3526019_3527160_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.0	4.8e-41
WP_011669192.1|3527493_3527796_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_026131136.1|3528040_3529138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669190.1|3529136_3529733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002752315.1|3529750_3530080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011669189.1|3530635_3531010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669188.1|3531018_3531606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011672139.1|3531624_3532017_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_002752321.1|3532006_3532336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040963000.1|3532328_3533933_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_011669185.1|3535211_3535775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669184.1|3537132_3537837_+	urate hydroxylase PuuD	NA	A0A1B1IVR4	uncultured_Mediterranean_phage	41.7	2.1e-23
WP_002730529.1|3537840_3538203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002732288.1|3538690_3539539_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011672141.1|3539558_3540470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672142.1|3543184_3544042_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002751986.1|3544049_3544619_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011669181.1|3544615_3545296_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011672143.1|3545301_3547569_+	VacB/RNase II family 3'-5' exoribonuclease	NA	Q0GXV6	Lactococcus_phage	33.5	2.5e-65
WP_017859520.1|3547601_3547799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011669179.1|3548346_3549849_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_193338945.1|3550566_3551244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011669170.1|3552321_3553416_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017859408.1|3553615_3553813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672144.1|3553874_3554933_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_002728004.1|3555147_3556080_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002728008.1|3556422_3556641_+	transcriptional coactivator p15/PC4 family protein	NA	NA	NA	NA	NA
WP_011669173.1|3556934_3557402_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011669174.1|3557531_3558995_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	36.6	3.9e-43
WP_002730501.1|3558999_3559347_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002732275.1|3559339_3559933_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011672145.1|3559935_3561510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672146.1|3561513_3562356_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011669177.1|3562418_3564056_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011669401.1|3564248_3565343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080504555.1|3565558_3565759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672147.1|3565874_3566483_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	26.4	3.9e-05
WP_002756305.1|3566501_3567245_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.4	1.0e-15
WP_011671189.1|3567249_3567753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011672148.1|3567975_3568824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011671191.1|3568884_3569442_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_011669401.1|3569530_3570625_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
