The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008530	Lactobacillus gasseri ATCC 33323 = JCM 1131, complete sequence	1894360	588135	701537	1894360	plate,portal,tail,holin,transposase,integrase,protease,terminase,bacteriocin,capsid	Lactobacillus_phage(84.13%)	153	611910:611933	651996:652019
WP_003647598.1|588135_588462_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003647597.1|588725_589505_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003652391.1|589616_592022_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003647595.1|592187_592844_+	nitroreductase	NA	NA	NA	NA	NA
WP_025012251.1|592964_593663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003647592.1|593713_595093_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003647591.1|595191_595761_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	25.1	1.6e-13
WP_003647590.1|595844_597155_-	amino acid permease	NA	NA	NA	NA	NA
WP_003647589.1|597268_597985_+	lysozyme	NA	NA	NA	NA	NA
WP_025012252.1|597995_599231_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	28.5	1.2e-34
WP_003647587.1|599230_600562_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_011678801.1|600762_601881_-|integrase	site-specific integrase	integrase	X2CYE9	Lactobacillus_phage	99.5	4.2e-215
WP_170246882.1|601883_602021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011678802.1|602094_602718_-	DUF3862 domain-containing protein	NA	X2CY59	Lactobacillus_phage	98.1	9.8e-97
WP_025012264.1|602782_603235_-	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	100.0	4.6e-88
WP_025012263.1|603239_603578_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	100.0	7.0e-57
WP_011678805.1|603731_603956_+	helix-turn-helix transcriptional regulator	NA	X2CXM8	Lactobacillus_phage	95.9	5.2e-32
WP_011678806.1|603988_604324_+	DUF771 domain-containing protein	NA	X2CYF0	Lactobacillus_phage	100.0	1.4e-60
WP_011678807.1|604292_604607_+	hypothetical protein	NA	Q20DG6	Lactobacillus_phage	100.0	2.3e-49
WP_011678808.1|604724_604871_+	hypothetical protein	NA	Q20DG5	Lactobacillus_phage	87.0	1.4e-14
WP_011678809.1|604922_605255_+	hypothetical protein	NA	X2CXW9	Lactobacillus_phage	73.6	2.1e-37
WP_011678810.1|605254_606115_+	DUF1351 domain-containing protein	NA	A9D9K7	Lactobacillus_prophage	91.6	8.7e-144
WP_011678811.1|606120_606933_+	ERF family protein	NA	A9D9L0	Lactobacillus_prophage	95.6	7.7e-126
WP_011678812.1|606942_607866_+	conserved phage C-terminal domain-containing protein	NA	A9D9L3	Lactobacillus_prophage	76.2	3.4e-130
WP_011678813.1|607871_608177_+	helix-turn-helix transcriptional regulator	NA	X2CY61	Lactobacillus_phage	97.0	9.2e-48
WP_025012261.1|608169_608955_+	antA/AntB antirepressor family protein	NA	Q20DF7	Lactobacillus_phage	94.4	3.5e-123
WP_003648027.1|608969_609155_+	hypothetical protein	NA	Q20DF6	Lactobacillus_phage	98.3	1.5e-24
WP_011678815.1|609164_609377_+	hypothetical protein	NA	X2CXE0	Lactobacillus_phage	92.9	2.1e-30
WP_011678816.1|609569_609833_+	hypothetical protein	NA	A9D9N4	Lactobacillus_prophage	38.1	5.2e-07
WP_025012259.1|609829_610030_+	hypothetical protein	NA	Q9T1H0	Lactobacillus_phage	90.2	3.1e-28
WP_025012258.1|610026_610383_+	hypothetical protein	NA	X2CY62	Lactobacillus_phage	94.9	5.3e-63
WP_011678818.1|610383_610707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011678819.1|610719_611181_+	RusA family crossover junction endodeoxyribonuclease	NA	Q20DF1	Lactobacillus_phage	99.3	1.6e-80
WP_011678820.1|611181_611403_+	hypothetical protein	NA	A9D9P7	Lactobacillus_prophage	54.8	6.3e-14
WP_011678822.1|611593_611884_+	hypothetical protein	NA	Q20DE9	Lactobacillus_phage	97.9	3.2e-50
WP_011678823.1|611886_612105_+	hypothetical protein	NA	Q20DE8	Lactobacillus_phage	98.6	4.6e-33
611910:611933	attL	AAATCCTTATACGTATAAGGATTT	NA	NA	NA	NA
WP_011678824.1|612088_612259_+	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	100.0	5.5e-26
WP_011678825.1|612288_612819_+	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	97.7	1.1e-96
WP_011678826.1|613676_613961_+	ParB N-terminal domain-containing protein	NA	Q20DE4	Lactobacillus_phage	98.9	7.0e-50
WP_003648039.1|614401_615019_+	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	100.0	8.2e-120
WP_003648517.1|615201_615858_+	hypothetical protein	NA	Q20DE0	Lactobacillus_phage	100.0	1.9e-119
WP_011678827.1|615918_616440_+|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	84.7	3.1e-72
WP_011678828.1|616528_617260_+	HNH endonuclease	NA	L0P6F5	Lactobacillus_phage	42.1	3.7e-34
WP_025012257.1|617262_618486_+|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	55.3	1.2e-130
WP_011678830.1|618476_619889_+|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	100.0	2.3e-271
WP_011678831.1|619878_621411_+|capsid	minor capsid protein	capsid	X2CXX3	Lactobacillus_phage	100.0	9.9e-300
WP_025012256.1|621394_621592_+	hypothetical protein	NA	X2CXE3	Lactobacillus_phage	100.0	8.9e-28
WP_011678833.1|621709_622270_+	phage scaffolding protein	NA	X2CYF9	Lactobacillus_phage	100.0	1.6e-93
WP_011678834.1|622269_623352_+	hypothetical protein	NA	X2CY65	Lactobacillus_phage	100.0	5.0e-205
WP_011678835.1|623360_623750_+	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	100.0	8.6e-67
WP_011678836.1|623746_624109_+	hypothetical protein	NA	X2CXE4	Lactobacillus_phage	100.0	1.4e-63
WP_011678837.1|624105_624540_+	HK97 gp10 family phage protein	NA	X2CXN4	Lactobacillus_phage	100.0	4.5e-80
WP_011678838.1|624536_624944_+	hypothetical protein	NA	X2CYG1	Lactobacillus_phage	100.0	5.1e-70
WP_025012255.1|624927_625146_+	hypothetical protein	NA	X2CY66	Lactobacillus_phage	100.0	2.5e-31
WP_011678840.1|625145_626501_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	X2CXX5	Lactobacillus_phage	100.0	8.3e-250
WP_011678841.1|626512_626983_+|tail	phage tail tube protein	tail	X2CXE5	Lactobacillus_phage	100.0	1.0e-85
WP_011678842.1|626994_627414_+	hypothetical protein	NA	X2CXN5	Lactobacillus_phage	100.0	4.0e-70
WP_011678843.1|627650_631061_+	tape measure protein	NA	X2CYG3	Lactobacillus_phage	100.0	4.4e-247
WP_003654297.1|631062_631743_+	hypothetical protein	NA	X2CY67	Lactobacillus_phage	100.0	3.7e-113
WP_011678845.1|631739_632786_+	hypothetical protein	NA	X2CXX6	Lactobacillus_phage	97.7	1.8e-196
WP_011678846.1|632764_633127_+	DUF2577 domain-containing protein	NA	X2CXE6	Lactobacillus_phage	100.0	1.1e-60
WP_174221023.1|633083_633500_+	DUF2634 domain-containing protein	NA	X2CXN6	Lactobacillus_phage	100.0	1.6e-71
WP_011678848.1|633496_634648_+|plate	baseplate J/gp47 family protein	plate	X2CYG4	Lactobacillus_phage	99.7	8.7e-216
WP_003654305.1|634637_635198_+	DUF2313 domain-containing protein	NA	X2CY68	Lactobacillus_phage	100.0	3.0e-97
WP_011678849.1|635210_637379_+	hypothetical protein	NA	X2CXX7	Lactobacillus_phage	98.6	0.0e+00
WP_003648056.1|637418_637928_+	hypothetical protein	NA	Q65YW0	Lactobacillus_phage	100.0	6.2e-89
WP_003648057.1|637927_638122_+	XkdX family protein	NA	X2CXN7	Lactobacillus_phage	100.0	7.1e-30
WP_115245361.1|638048_638498_+	hypothetical protein	NA	Q65YV9	Lactobacillus_phage	100.0	2.5e-73
WP_003654315.1|638508_638787_+	hypothetical protein	NA	Q65YV8	Lactobacillus_phage	100.0	4.3e-44
WP_011678851.1|638783_639215_+|holin	phage holin	holin	Q65YV7	Lactobacillus_phage	100.0	3.5e-69
WP_011678852.1|639224_640157_+	lysin	NA	Q65YV6	Lactobacillus_phage	100.0	3.3e-181
WP_113532351.1|640405_640513_-	type I toxin-antitoxin system Fst family toxin	NA	Q65YV5	Lactobacillus_phage	100.0	9.7e-13
WP_011678801.1|640848_641967_-|integrase	site-specific integrase	integrase	X2CYE9	Lactobacillus_phage	99.5	4.2e-215
WP_170246882.1|641969_642107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011678802.1|642180_642804_-	DUF3862 domain-containing protein	NA	X2CY59	Lactobacillus_phage	98.1	9.8e-97
WP_025012264.1|642868_643321_-	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	100.0	4.6e-88
WP_025012263.1|643325_643664_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	100.0	7.0e-57
WP_011678805.1|643817_644042_+	helix-turn-helix transcriptional regulator	NA	X2CXM8	Lactobacillus_phage	95.9	5.2e-32
WP_011678806.1|644074_644410_+	DUF771 domain-containing protein	NA	X2CYF0	Lactobacillus_phage	100.0	1.4e-60
WP_011678807.1|644378_644693_+	hypothetical protein	NA	Q20DG6	Lactobacillus_phage	100.0	2.3e-49
WP_011678808.1|644810_644957_+	hypothetical protein	NA	Q20DG5	Lactobacillus_phage	87.0	1.4e-14
WP_011678809.1|645008_645341_+	hypothetical protein	NA	X2CXW9	Lactobacillus_phage	73.6	2.1e-37
WP_011678810.1|645340_646201_+	DUF1351 domain-containing protein	NA	A9D9K7	Lactobacillus_prophage	91.6	8.7e-144
WP_011678811.1|646206_647019_+	ERF family protein	NA	A9D9L0	Lactobacillus_prophage	95.6	7.7e-126
WP_011678812.1|647028_647952_+	conserved phage C-terminal domain-containing protein	NA	A9D9L3	Lactobacillus_prophage	76.2	3.4e-130
WP_011678813.1|647957_648263_+	helix-turn-helix transcriptional regulator	NA	X2CY61	Lactobacillus_phage	97.0	9.2e-48
WP_025012261.1|648255_649041_+	antA/AntB antirepressor family protein	NA	Q20DF7	Lactobacillus_phage	94.4	3.5e-123
WP_003648027.1|649055_649241_+	hypothetical protein	NA	Q20DF6	Lactobacillus_phage	98.3	1.5e-24
WP_011678815.1|649250_649463_+	hypothetical protein	NA	X2CXE0	Lactobacillus_phage	92.9	2.1e-30
WP_011678816.1|649655_649919_+	hypothetical protein	NA	A9D9N4	Lactobacillus_prophage	38.1	5.2e-07
WP_025012259.1|649915_650116_+	hypothetical protein	NA	Q9T1H0	Lactobacillus_phage	90.2	3.1e-28
WP_025012258.1|650112_650469_+	hypothetical protein	NA	X2CY62	Lactobacillus_phage	94.9	5.3e-63
WP_011678818.1|650469_650793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011678819.1|650805_651267_+	RusA family crossover junction endodeoxyribonuclease	NA	Q20DF1	Lactobacillus_phage	99.3	1.6e-80
WP_011678820.1|651267_651489_+	hypothetical protein	NA	A9D9P7	Lactobacillus_prophage	54.8	6.3e-14
WP_011678822.1|651679_651970_+	hypothetical protein	NA	Q20DE9	Lactobacillus_phage	97.9	3.2e-50
WP_011678823.1|651972_652191_+	hypothetical protein	NA	Q20DE8	Lactobacillus_phage	98.6	4.6e-33
651996:652019	attR	AAATCCTTATACGTATAAGGATTT	NA	NA	NA	NA
WP_011678824.1|652174_652345_+	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	100.0	5.5e-26
WP_011678825.1|652374_652905_+	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	97.7	1.1e-96
WP_011678826.1|653762_654047_+	ParB N-terminal domain-containing protein	NA	Q20DE4	Lactobacillus_phage	98.9	7.0e-50
WP_003648039.1|654487_655105_+	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	100.0	8.2e-120
WP_003648517.1|655287_655944_+	hypothetical protein	NA	Q20DE0	Lactobacillus_phage	100.0	1.9e-119
WP_011678827.1|656004_656526_+|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	84.7	3.1e-72
WP_011678828.1|656614_657346_+	HNH endonuclease	NA	L0P6F5	Lactobacillus_phage	42.1	3.7e-34
WP_025012257.1|657348_658572_+|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	55.3	1.2e-130
WP_011678830.1|658562_659975_+|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	100.0	2.3e-271
WP_011678831.1|659964_661497_+|capsid	minor capsid protein	capsid	X2CXX3	Lactobacillus_phage	100.0	9.9e-300
WP_025012256.1|661480_661678_+	hypothetical protein	NA	X2CXE3	Lactobacillus_phage	100.0	8.9e-28
WP_011678833.1|661795_662356_+	phage scaffolding protein	NA	X2CYF9	Lactobacillus_phage	100.0	1.6e-93
WP_011678834.1|662355_663438_+	hypothetical protein	NA	X2CY65	Lactobacillus_phage	100.0	5.0e-205
WP_011678835.1|663446_663836_+	hypothetical protein	NA	X2CXX4	Lactobacillus_phage	100.0	8.6e-67
WP_011678836.1|663832_664195_+	hypothetical protein	NA	X2CXE4	Lactobacillus_phage	100.0	1.4e-63
WP_011678837.1|664191_664626_+	HK97 gp10 family phage protein	NA	X2CXN4	Lactobacillus_phage	100.0	4.5e-80
WP_011678838.1|664622_665030_+	hypothetical protein	NA	X2CYG1	Lactobacillus_phage	100.0	5.1e-70
WP_025012255.1|665013_665232_+	hypothetical protein	NA	X2CY66	Lactobacillus_phage	100.0	2.5e-31
WP_011678840.1|665231_666587_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	X2CXX5	Lactobacillus_phage	100.0	8.3e-250
WP_011678841.1|666598_667069_+|tail	phage tail tube protein	tail	X2CXE5	Lactobacillus_phage	100.0	1.0e-85
WP_011678842.1|667080_667500_+	hypothetical protein	NA	X2CXN5	Lactobacillus_phage	100.0	4.0e-70
WP_011678843.1|667736_671147_+	tape measure protein	NA	X2CYG3	Lactobacillus_phage	100.0	4.4e-247
WP_003654297.1|671148_671829_+	hypothetical protein	NA	X2CY67	Lactobacillus_phage	100.0	3.7e-113
WP_011678845.1|671825_672872_+	hypothetical protein	NA	X2CXX6	Lactobacillus_phage	97.7	1.8e-196
WP_011678846.1|672850_673213_+	DUF2577 domain-containing protein	NA	X2CXE6	Lactobacillus_phage	100.0	1.1e-60
WP_174221023.1|673169_673586_+	DUF2634 domain-containing protein	NA	X2CXN6	Lactobacillus_phage	100.0	1.6e-71
WP_011678848.1|673582_674734_+|plate	baseplate J/gp47 family protein	plate	X2CYG4	Lactobacillus_phage	99.7	8.7e-216
WP_003654305.1|674723_675284_+	DUF2313 domain-containing protein	NA	X2CY68	Lactobacillus_phage	100.0	3.0e-97
WP_011678849.1|675296_677465_+	hypothetical protein	NA	X2CXX7	Lactobacillus_phage	98.6	0.0e+00
WP_003648056.1|677504_678014_+	hypothetical protein	NA	Q65YW0	Lactobacillus_phage	100.0	6.2e-89
WP_003648057.1|678013_678208_+	XkdX family protein	NA	X2CXN7	Lactobacillus_phage	100.0	7.1e-30
WP_115245361.1|678134_678584_+	hypothetical protein	NA	Q65YV9	Lactobacillus_phage	100.0	2.5e-73
WP_003654315.1|678594_678873_+	hypothetical protein	NA	Q65YV8	Lactobacillus_phage	100.0	4.3e-44
WP_011678851.1|678869_679301_+|holin	phage holin	holin	Q65YV7	Lactobacillus_phage	100.0	3.5e-69
WP_011678852.1|679310_680243_+	lysin	NA	Q65YV6	Lactobacillus_phage	100.0	3.3e-181
WP_113532351.1|680491_680599_-	type I toxin-antitoxin system Fst family toxin	NA	Q65YV5	Lactobacillus_phage	100.0	9.7e-13
WP_003647585.1|681210_682353_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2K9V8D8	Bandra_megavirus	31.6	5.2e-35
WP_025012227.1|682386_682899_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003647583.1|682891_683338_-	flavodoxin	NA	NA	NA	NA	NA
WP_003651099.1|683522_684347_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003647582.1|684362_685286_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003649175.1|685344_686253_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	5.1e-78
WP_011678856.1|686372_687206_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_003647579.1|687329_688292_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	1.4e-25
WP_003647578.1|688284_689835_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003647577.1|689848_690259_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003647576.1|690359_690533_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003656472.1|691163_691775_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_003647574.1|691779_692445_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	1.3e-22
WP_003647573.1|692454_693729_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.3	4.6e-08
WP_003647572.1|693787_696172_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003647571.1|696296_696710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003647570.1|696725_697220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003647569.1|697402_699937_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	9.3e-69
WP_011678858.1|700025_700796_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_021314810.1|700841_701537_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_008530	Lactobacillus gasseri ATCC 33323 = JCM 1131, complete sequence	1894360	909677	920035	1894360	tRNA,protease	Moraxella_phage(16.67%)	9	NA	NA
WP_003647378.1|909677_911126_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.5e-10
WP_003647377.1|911128_911968_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003647376.1|911964_912717_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.1	9.3e-25
WP_003647375.1|912768_913614_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.3	4.1e-29
WP_003647374.1|913679_915761_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.5	4.2e-99
WP_003647373.1|915858_917175_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003654973.1|917177_918101_+	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	28.2	2.6e-21
WP_003647372.1|918105_918630_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003647371.1|918640_920035_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.8	8.0e-30
>prophage 3
NC_008530	Lactobacillus gasseri ATCC 33323 = JCM 1131, complete sequence	1894360	1134649	1141828	1894360		Enterobacteria_phage(50.0%)	8	NA	NA
WP_003647171.1|1134649_1135075_-	HIRAN domain-containing protein	NA	G3M9Z4	Bacillus_virus	32.0	1.6e-05
WP_003651702.1|1135399_1135597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003647169.1|1136036_1137023_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.6	1.2e-27
WP_003647168.1|1137039_1137648_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.8	1.7e-45
WP_003647167.1|1137680_1138565_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.6	1.5e-95
WP_003647166.1|1138571_1139609_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	3.4e-86
WP_003657170.1|1139690_1140866_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011678908.1|1140868_1141828_-	Abi family protein	NA	X2L062	Streptococcus_phage	52.1	2.4e-86
>prophage 4
NC_008530	Lactobacillus gasseri ATCC 33323 = JCM 1131, complete sequence	1894360	1427092	1481999	1894360	tRNA,portal,tail,holin,protease,terminase,head,capsid	Erysipelothrix_phage(50.0%)	53	NA	NA
WP_011678938.1|1427092_1427740_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_025012219.1|1427764_1428085_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003646890.1|1429515_1430169_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003656734.1|1430180_1431392_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011678939.1|1431384_1432131_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	3.5e-16
WP_003646887.1|1432227_1432662_+	HIT family protein	NA	D7NW73	Streptomyces_phage	38.8	1.5e-11
WP_003646886.1|1432745_1433234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646885.1|1433233_1433584_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_003646884.1|1433705_1434602_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003646883.1|1434656_1435634_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003646882.1|1435636_1438072_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003646881.1|1438052_1439276_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_003646880.1|1439281_1439635_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003646879.1|1439660_1441718_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003646878.1|1441824_1442673_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	23.3	3.2e-05
WP_003646877.1|1442938_1444258_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.0	3.1e-84
WP_003652733.1|1444250_1444634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646875.1|1444659_1445184_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003646874.1|1445382_1446168_-	aminoglycoside 3'-phosphotransferase	NA	A0A193CJY5	Infectious_laryngotracheitis_virus	31.0	1.6e-14
WP_003646873.1|1446167_1447205_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003652736.1|1447599_1447971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003652738.1|1447970_1449863_-	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	24.5	8.6e-19
WP_003652740.1|1449843_1451136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003652741.1|1451137_1454113_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	30.2	7.5e-94
WP_011678941.1|1456032_1456281_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	60.0	4.9e-15
WP_011678942.1|1456261_1457917_-	ATPase	NA	NA	NA	NA	NA
WP_021314868.1|1457900_1458134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041807422.1|1458117_1459338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021314871.1|1459711_1460230_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021314872.1|1460327_1460528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003652756.1|1460511_1460829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003652759.1|1460825_1461965_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.4	7.8e-108
WP_025012220.1|1461942_1462518_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.4	4.8e-74
WP_003652763.1|1462572_1464507_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.5	8.9e-229
WP_011678947.1|1464591_1464978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012221.1|1464979_1467229_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.6	5.1e-212
WP_003652766.1|1467430_1467712_+	VRR-NUC domain-containing protein	NA	A0A1X9I6B2	Streptococcus_phage	51.1	9.7e-20
WP_011678950.1|1467692_1469045_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	64.5	5.7e-150
WP_003652769.1|1469041_1469509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021314874.1|1469655_1470033_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	57.3	2.1e-33
WP_011678951.1|1470151_1470694_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	58.2	5.6e-56
WP_003652775.1|1470693_1471920_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	63.1	7.3e-152
WP_003652777.1|1471992_1472613_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	44.5	2.0e-41
WP_003652780.1|1472615_1472822_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003652786.1|1474512_1475778_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	63.0	5.7e-152
WP_003652788.1|1475774_1476446_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	3.9e-59
WP_003652790.1|1476465_1477644_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	56.2	4.0e-123
WP_003671991.1|1477660_1477939_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	41.6	2.9e-08
WP_003652792.1|1477938_1478322_+|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	31.7	8.9e-08
WP_003652795.1|1478308_1478719_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	65.6	5.9e-42
WP_003652797.1|1478718_1479597_+	1,4-beta-N-acetylmuramidase	NA	A0A2K9V3I9	Faecalibacterium_phage	36.0	5.8e-26
WP_011678953.1|1480068_1480308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011678954.1|1480337_1481999_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.9	3.5e-101
