The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	15907	65115	2895264	transposase,protease,bacteriocin,holin	unidentified_phage(57.14%)	45	NA	NA
WP_011673930.1|15907_16126_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011673932.1|16310_16526_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011673933.1|16693_17287_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_164920358.1|18068_18989_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_011673935.1|19346_19649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673936.1|20172_21363_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_011673937.1|21566_24140_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|24152_24854_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_011673938.1|25150_25702_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662288.1|25745_26552_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003662286.1|26556_26877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673939.1|26933_27707_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|27884_28490_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|28613_29507_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_011673941.1|29555_30194_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011673942.1|30422_31799_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|32021_32366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|32441_32801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003584098.1|33041_34484_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003662275.1|34678_35311_+	membrane protein	NA	NA	NA	NA	NA
WP_003577243.1|35483_36095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057718551.1|36148_36613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|36975_37896_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011673947.1|38997_39471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|41788_42709_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011673950.1|42779_42920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577245.1|43761_44091_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_081038121.1|44971_45169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673954.1|45532_46408_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003574021.1|46815_47736_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003562571.1|47807_48458_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011673955.1|48856_49549_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003592457.1|49825_50179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592458.1|50243_50564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673957.1|51720_53313_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	8.6e-12
WP_011673958.1|53650_55024_-	MFS transporter	NA	NA	NA	NA	NA
WP_011673959.1|55201_55525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673960.1|55705_59017_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|59013_59616_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|59866_60127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673961.1|60340_61003_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|61002_61932_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|61943_62573_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011673962.1|62575_63829_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_003577283.1|64461_65115_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	273013	322100	2895264	transposase,protease	unidentified_phage(37.5%)	45	NA	NA
WP_121497923.1|273013_274175_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	5.6e-29
WP_003573334.1|274259_274595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563091.1|274986_275889_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011674035.1|275881_277198_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_011674036.1|277334_278018_-	hydrolase	NA	NA	NA	NA	NA
WP_003563099.1|278368_279034_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_011674037.1|279035_280226_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003563103.1|280254_280971_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_003592858.1|281153_282632_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	50.5	2.1e-20
WP_003577430.1|283406_283571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563110.1|283773_283962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674038.1|284490_284673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592860.1|284864_286229_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011674039.1|286411_287260_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_011674040.1|287256_287937_-	hypothetical protein	NA	U5PU21	Bacillus_phage	33.5	3.2e-16
WP_003592867.1|287914_290299_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_003601692.1|290604_291894_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003599776.1|292017_292713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674041.1|292973_294683_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011674042.1|295063_296083_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_164920358.1|296142_297063_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_003577536.1|297479_298046_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_011674043.1|298052_299396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-15
WP_011674045.1|300134_300827_+	thiaminase II	NA	NA	NA	NA	NA
WP_003563188.1|300807_301308_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_011674046.1|301320_302163_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_011674047.1|302159_302801_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011674048.1|302790_303618_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003586619.1|304002_305451_+	amino acid permease	NA	NA	NA	NA	NA
WP_011674050.1|305758_306004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568895.1|306384_307392_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003661509.1|307451_307844_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003563207.1|308015_309518_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.3e-21
WP_003573417.1|309501_310482_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003661512.1|310538_311498_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_164920359.1|311526_312447_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	9.0e-22
WP_003563212.1|312692_313622_+	ribokinase	NA	NA	NA	NA	NA
WP_011674052.1|314039_316031_-	cell division protein FtsI	NA	NA	NA	NA	NA
WP_011674053.1|316205_317588_+	MFS transporter	NA	NA	NA	NA	NA
WP_003573425.1|317568_318003_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003583147.1|317999_318563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573429.1|318575_318791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164920358.1|319192_320113_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_003661518.1|320660_321350_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_059219855.1|321413_322100_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	334169	392055	2895264	transposase	unidentified_phage(36.36%)	44	NA	NA
WP_191979886.1|334169_335090_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.5	1.4e-22
WP_011674060.1|335928_336153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674061.1|336243_339189_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662080.1|339196_339766_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164920360.1|340485_341269_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011674064.1|341612_342521_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_011674065.1|344091_344661_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.6	7.7e-32
WP_164920361.1|344735_345505_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	6.6e-26
WP_121497921.1|346100_346788_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.2	1.2e-63
WP_011674070.1|347518_350287_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011674071.1|350267_351977_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_003586648.1|351973_352576_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_011674072.1|352568_353654_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_011674073.1|353625_354336_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_011674074.1|354351_354999_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_011674075.1|355003_355951_+	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011674076.1|355947_356853_+	type I-E CRISPR-associated endoribonuclease Cas2	NA	A0A0A8WJ41	Clostridium_phage	31.2	1.1e-11
WP_011674077.1|358247_359645_-|transposase	ISLre2-like element ISLca4 family transposase	transposase	NA	NA	NA	NA
WP_010625611.1|360362_360575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577841.1|361341_362586_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_164920362.1|362693_363572_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.0e-22
WP_003563273.1|363743_364142_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011674081.1|364254_364626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164920363.1|364682_365603_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_011674084.1|367309_368020_-	transaldolase	NA	A0A0E3FGE1	Synechococcus_phage	28.5	3.1e-14
WP_057718541.1|368225_369263_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011674086.1|369818_371147_+	6-phospho-alpha-glucosidase 1	NA	NA	NA	NA	NA
WP_057718539.1|371273_373157_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_011674088.1|373208_374021_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011674089.1|373983_374493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016376896.1|374537_375089_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_011674090.1|375183_375672_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011674091.1|375737_376415_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_011674092.1|376585_377500_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003573501.1|377887_378250_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_003573503.1|378310_379606_+	YhfT family protein	NA	NA	NA	NA	NA
WP_003597368.1|379636_380521_+	hydrolase	NA	NA	NA	NA	NA
WP_011674094.1|380513_381611_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_011674095.1|381610_382783_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003597374.1|382784_384014_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_011674096.1|384357_387336_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.7	3.4e-147
WP_011674097.1|387368_388850_+	amino acid permease	NA	NA	NA	NA	NA
WP_011674098.1|388963_390418_+	amino acid permease	NA	NA	NA	NA	NA
WP_003574021.1|391134_392055_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 4
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	450426	518506	2895264	transposase,integrase	Lactobacillus_phage(48.0%)	59	499251:499285	520864:520898
WP_011674120.1|450426_451671_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	6.7e-12
WP_003583336.1|451851_452454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674121.1|452453_453884_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.1	4.8e-38
WP_003573646.1|453902_454268_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011674122.1|454304_455450_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563473.1|455566_455878_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_011674124.1|456052_457963_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573651.1|458088_458673_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.9	5.9e-35
WP_011674125.1|458931_461661_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003577843.1|461653_462370_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003573655.1|462380_463385_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_011674126.1|463458_464535_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|464725_465460_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_011674127.1|465452_467069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674128.1|467364_468063_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	5.8e-29
WP_011674129.1|468050_469166_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003661624.1|469268_470150_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	6.6e-22
WP_011674130.1|470146_471295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011674131.1|471323_471863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674135.1|485320_487855_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.6	6.0e-68
WP_003577866.1|488438_489881_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563498.1|489992_490496_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003573683.1|490674_491568_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_003593101.1|491722_492589_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_011674136.1|492605_493439_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003593105.1|493535_494426_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003563507.1|494459_495677_+	MFS transporter	NA	NA	NA	NA	NA
WP_011674137.1|495695_496595_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011674138.1|497035_497851_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003577893.1|497884_498814_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
499251:499285	attL	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTT	NA	NA	NA	NA
WP_079322958.1|499294_499591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164920364.1|499587_500451_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
WP_011674142.1|501258_502428_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	8.6e-219
WP_003573997.1|502540_502801_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003586911.1|502890_503511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572177.1|503494_503731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572180.1|503923_504631_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|504789_505212_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|505204_505558_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|505801_506050_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|506091_506292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|506262_507096_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_010493122.1|507156_507915_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
WP_003572193.1|507915_508095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|508087_508339_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|508404_508761_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|508845_509049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572202.1|509031_509577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|509991_510912_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574012.1|511119_511866_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	55.3	1.7e-34
WP_003574014.1|511880_512705_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	2.3e-117
WP_003574016.1|512704_513223_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003574018.1|513269_513692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572217.1|513693_514431_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	1.3e-47
WP_010493149.1|514442_514730_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_010493151.1|514799_515132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674145.1|515646_516090_+	hypothetical protein	NA	A0A0P0IZI6	Lactobacillus_phage	96.6	2.8e-77
WP_011674146.1|516603_517257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674147.1|517507_518506_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	1.3e-50
520864:520898	attR	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTT	NA	NA	NA	NA
>prophage 5
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	522109	578508	2895264	transposase,holin	unidentified_phage(42.86%)	53	NA	NA
WP_079322958.1|522109_522406_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164920365.1|522402_523266_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	9.0e-24
WP_010493185.1|523947_524226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|524237_524504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|524522_524699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|524700_524928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674153.1|524970_526212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674154.1|526189_527758_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_011674155.1|527767_528187_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_011674156.1|528195_528774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674157.1|528800_531260_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_011674158.1|531256_533314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493201.1|533319_533655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674159.1|533638_534235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582237.1|534215_536144_+	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_011674160.1|536145_537156_+	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.3	6.9e-15
WP_011674161.1|537171_537816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674162.1|537812_538220_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011674163.1|538209_539031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587040.1|539633_539813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593118.1|539853_540108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674164.1|540097_540535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674165.1|540527_541772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057718519.1|541813_542059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674167.1|542045_544589_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_011674169.1|544928_545033_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_011674170.1|545188_545341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674171.1|545322_545577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674172.1|545876_546758_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_011674173.1|546774_547134_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011674174.1|548016_548247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674176.1|548655_551187_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003661531.1|551470_551908_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563323.1|551920_552415_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_011674177.1|552458_553325_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563328.1|553327_554173_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003661535.1|554206_554539_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_164920372.1|559805_560441_+	LtrC-like protein	NA	NA	NA	NA	NA
WP_057718638.1|561139_561724_+	DNA methyltransferase	NA	NA	NA	NA	NA
WP_003574021.1|561829_562750_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_164920358.1|563296_564217_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
WP_164920366.1|564593_565380_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016386960.1|565367_565625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567312.1|565901_566459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016388654.1|566659_567988_-	MFS transporter	NA	NA	NA	NA	NA
WP_011674185.1|568155_568743_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.9	4.5e-19
WP_011673997.1|568827_570231_-|transposase	IS5-like element ISLca3 family transposase	transposase	NA	NA	NA	NA
WP_003587131.1|570400_570589_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_003572070.1|570690_571407_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_164920373.1|572018_572252_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_011673997.1|572353_573757_+|transposase	IS5-like element ISLca3 family transposase	transposase	NA	NA	NA	NA
WP_164920374.1|576190_577531_-	site-specific DNA-methyltransferase	NA	S5VTV9	Campylobacter_phage	33.1	1.5e-38
WP_003574021.1|577587_578508_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 6
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	937805	947148	2895264		Streptococcus_phage(33.33%)	8	NA	NA
WP_011674333.1|937805_940697_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	7.1e-307
WP_011674334.1|941048_941588_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|941750_942638_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|942634_943663_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564251.1|943667_944615_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003569571.1|945000_945456_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|945572_946163_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_011674335.1|946485_947148_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	67.3	6.5e-14
>prophage 7
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	1264927	1340560	2895264	transposase,tRNA,lysis	uncultured_Mediterranean_phage(14.29%)	60	NA	NA
WP_003570145.1|1264927_1265590_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_003594381.1|1265891_1266428_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003574913.1|1266539_1266800_+	membrane protein	NA	NA	NA	NA	NA
WP_003570151.1|1266902_1267613_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_003565195.1|1267628_1268792_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.1	2.3e-30
WP_003574915.1|1269002_1269344_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003594382.1|1269561_1271844_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.8	5.9e-123
WP_003565200.1|1272414_1273548_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003565202.1|1273977_1274640_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011674455.1|1274677_1275346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674456.1|1275332_1277801_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	27.3	3.8e-51
WP_011674457.1|1277807_1279025_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011674458.1|1279098_1280049_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.7	2.2e-15
WP_011674459.1|1280338_1282021_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003565214.1|1282025_1282238_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003565216.1|1282858_1283308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565218.1|1283338_1283632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565220.1|1284815_1285370_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.6e-13
WP_003565222.1|1286142_1286958_+	ATPase	NA	NA	NA	NA	NA
WP_003565223.1|1287218_1288331_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011674460.1|1288333_1289311_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011674461.1|1289328_1290984_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_003565229.1|1290986_1292390_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	1.2e-44
WP_011674462.1|1292515_1294051_+|transposase	IS3-like element ISLca1 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.7	1.3e-44
WP_003565232.1|1294239_1295130_+	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003565234.1|1295119_1295401_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_003565236.1|1295403_1296195_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003570179.1|1296453_1298298_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011674463.1|1298537_1299707_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_011674464.1|1299699_1303137_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_003605069.1|1303154_1303511_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003565250.1|1303497_1304064_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003565253.1|1304056_1304560_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	34.4	6.4e-22
WP_057718566.1|1304537_1305620_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011674466.1|1305815_1306013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674467.1|1305987_1306341_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011674468.1|1306441_1307944_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_016371982.1|1308043_1308727_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003579020.1|1310901_1311945_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003565265.1|1312035_1312290_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003565267.1|1312537_1312807_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_011674472.1|1312998_1313694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565271.1|1313869_1315552_+	ribonuclease J	NA	NA	NA	NA	NA
WP_003579029.1|1315638_1316550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565275.1|1316760_1317951_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.9	1.4e-30
WP_164920369.1|1318076_1319321_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.0	4.3e-11
WP_003596308.1|1320791_1321808_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_003579034.1|1323030_1324368_+	trigger factor	NA	NA	NA	NA	NA
WP_003565283.1|1326032_1326629_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003565285.1|1326632_1326923_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	46.2	3.2e-18
WP_011674477.1|1326966_1327128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674478.1|1327282_1328740_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003565291.1|1328729_1329476_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	2.8e-29
WP_011674479.1|1329651_1331460_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011674480.1|1331834_1333805_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003565298.1|1333814_1334729_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003565300.1|1334725_1335475_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003565302.1|1335723_1337010_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_011674481.1|1337049_1339044_+	acetyltransferase	NA	W6MVL2	Pseudomonas_phage	29.6	2.7e-23
WP_011674482.1|1339231_1340560_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	1884045	1953463	2895264	protease,tail,capsid,integrase,holin,portal,terminase,transposase,head	Lactobacillus_phage(72.73%)	79	1903845:1903871	1950805:1950831
WP_011674624.1|1884045_1885581_+|transposase	IS3-like element ISLca1 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.7	1.3e-44
WP_003595071.1|1885760_1887431_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003573210.1|1887793_1888474_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003566249.1|1888470_1888803_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003566252.1|1889014_1889278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057718572.1|1889384_1891040_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.1	2.6e-11
WP_003595076.1|1893055_1893454_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_011674627.1|1893545_1893839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674628.1|1893987_1897770_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003605487.1|1898122_1898884_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_003595080.1|1899058_1899826_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_011674630.1|1900138_1901734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|1902326_1902578_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
1903845:1903871	attL	TACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_011674631.1|1904003_1904228_-	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	90.5	3.1e-29
WP_011674632.1|1904272_1905571_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	96.1	3.4e-224
WP_011674633.1|1905581_1906028_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	92.6	3.9e-63
WP_011674634.1|1906020_1906311_-	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	96.9	2.8e-46
WP_011674635.1|1906373_1906529_-	hypothetical protein	NA	C1KFN5	Lactobacillus_virus	60.4	1.6e-08
WP_011674636.1|1906543_1906879_-	hypothetical protein	NA	A0A0P0IZK1	Lactobacillus_phage	48.5	1.6e-16
WP_011674638.1|1910936_1912904_-|tail	phage tail family protein	tail	A0A0P0IJR2	Lactobacillus_phage	75.0	1.9e-303
WP_011674639.1|1912975_1913992_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_011674640.1|1914098_1917434_-|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	89.6	1.3e-307
WP_011674641.1|1917426_1917780_-	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	99.1	2.5e-57
WP_003566397.1|1917878_1918214_-|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	100.0	9.4e-54
WP_011674642.1|1918300_1918933_-|tail	phage tail protein	tail	A0A0N7IR90	Lactobacillus_phage	96.2	1.5e-97
WP_003566400.1|1918944_1919349_-	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	100.0	4.6e-71
WP_011674643.1|1919349_1919715_-	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	97.5	2.4e-58
WP_011674644.1|1919711_1920014_-	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	94.0	1.7e-49
WP_011674645.1|1920018_1920393_-|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.1	1.2e-57
WP_081038117.1|1920462_1920714_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_011674646.1|1920728_1921748_-|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	95.6	7.8e-184
WP_079322958.1|1921819_1922116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096836596.1|1922112_1922976_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
WP_011674648.1|1923477_1924116_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	94.8	3.0e-85
WP_011674650.1|1924760_1925087_-	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	88.9	6.8e-49
WP_011674651.1|1925096_1926095_-|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.4	3.4e-176
WP_011674652.1|1926060_1927488_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	96.8	3.3e-257
WP_011674653.1|1927492_1928746_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.3	1.5e-248
WP_011674654.1|1928729_1929302_-|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	96.8	1.4e-81
WP_154241483.1|1929370_1929532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674656.1|1929687_1930836_-	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	97.6	4.0e-221
WP_011674657.1|1931029_1931251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674658.1|1931443_1932091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674659.1|1932399_1932828_-	DUF1492 domain-containing protein	NA	U5U7A6	Lactobacillus_phage	98.6	3.3e-75
WP_011674661.1|1933342_1933561_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	95.8	6.6e-32
WP_011674663.1|1933638_1934139_-	YopX family protein	NA	C1KFT7	Lactobacillus_virus	53.4	1.7e-38
WP_011674664.1|1934149_1934380_-	hypothetical protein	NA	U5U426	Lactobacillus_phage	67.1	1.2e-20
WP_011674665.1|1934376_1934787_-	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	72.6	2.1e-47
WP_011674666.1|1934783_1934963_-	hypothetical protein	NA	A0A2D1GPE2	Lactobacillus_phage	64.4	2.6e-10
WP_011674667.1|1934955_1935282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674668.1|1935271_1935823_-	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	68.0	4.0e-57
WP_011674669.1|1935819_1936059_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	51.1	6.3e-12
WP_011674670.1|1936071_1936437_-	endodeoxyribonuclease	NA	A0A2D1GPL1	Lactobacillus_phage	98.3	6.9e-66
WP_011674671.1|1936433_1936688_-	hypothetical protein	NA	U5U728	Lactobacillus_phage	94.0	1.2e-37
WP_011674672.1|1936688_1937018_-	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	73.1	1.6e-34
WP_011674673.1|1937014_1937797_-	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	93.1	7.4e-134
WP_011674674.1|1937783_1938584_-	DUF4373 domain-containing protein	NA	F0PII1	Enterococcus_phage	37.2	5.1e-21
WP_011674675.1|1938650_1939211_-	DUF669 domain-containing protein	NA	NA	NA	NA	NA
WP_011674676.1|1939213_1940137_-	AAA family ATPase	NA	A0A0S2SY47	Bacillus_phage	39.8	4.9e-60
WP_011674677.1|1940133_1940754_-	host-nuclease inhibitor Gam family protein	NA	A0A0H3U480	Staphylococcus_phage	27.0	1.3e-11
WP_011674678.1|1940750_1940918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674679.1|1940910_1941162_-	hypothetical protein	NA	A0A0P0I7L5	Lactobacillus_phage	74.3	4.6e-05
WP_011674682.1|1941505_1942012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674683.1|1942069_1942228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674684.1|1942315_1942804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674685.1|1942763_1943006_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	47.1	1.1e-08
WP_011674686.1|1943002_1943248_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011674687.1|1943377_1944061_+	XRE family transcriptional regulator	NA	Q4ZD53	Staphylococcus_phage	32.6	9.3e-16
WP_011674688.1|1944076_1944925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674689.1|1944983_1945589_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	98.0	1.3e-77
WP_011674690.1|1945689_1946460_+	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	26.2	3.3e-17
WP_011674692.1|1946728_1947154_+	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	90.1	7.5e-64
WP_011674693.1|1947177_1947381_+	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	5.2e-31
WP_011674694.1|1947435_1948278_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	35.8	1.1e-34
WP_011674695.1|1948294_1948690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674696.1|1948694_1949351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674697.1|1949482_1950646_+|integrase	tyrosine-type recombinase/integrase	integrase	Q3BLW3	Phage_SK137	30.2	5.8e-42
WP_003566292.1|1950810_1952364_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
1950805:1950831	attR	TACCGGTCATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_003566294.1|1952536_1953463_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
>prophage 9
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	1962706	2009523	2895264	transposase,tRNA,tail	Faecalibacterium_phage(17.65%)	41	NA	NA
WP_011674703.1|1962706_1963168_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011674704.1|1963279_1964632_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003566318.1|1964618_1965584_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003566320.1|1965741_1966401_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011674705.1|1966751_1968560_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003566323.1|1968572_1969331_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.9e-33
WP_011673973.1|1969708_1970725_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
WP_003566325.1|1970823_1972479_+	amino acid permease	NA	NA	NA	NA	NA
WP_003566327.1|1972614_1973496_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_011674707.1|1973633_1974929_+	GTPase HflX	NA	NA	NA	NA	NA
WP_011674708.1|1975066_1976065_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_011674709.1|1976326_1977637_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_003574021.1|1977765_1978686_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674710.1|1979044_1980622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674711.1|1980698_1982225_+	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011674624.1|1982345_1983881_-|transposase	IS3-like element ISLca1 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.7	1.3e-44
WP_133052838.1|1984069_1984642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674713.1|1984947_1985964_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_003561810.1|1986191_1987121_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_011674714.1|1988490_1989549_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_003574021.1|1989688_1990609_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674715.1|1990928_1991771_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.5	7.2e-34
WP_011674716.1|1991845_1992871_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.9	8.1e-72
WP_003575756.1|1992873_1993446_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.0	3.2e-33
WP_011674717.1|1993457_1994330_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.3	1.1e-98
WP_011674718.1|1994759_1995614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003575762.1|1995753_1997154_-	sugar transferase	NA	NA	NA	NA	NA
WP_183406568.1|1997309_1998260_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.6	2.5e-35
WP_003575766.1|1998403_1999066_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566566.1|1999081_1999726_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011674720.1|1999727_2000552_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004561979.1|2000679_2001411_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.7e-37
WP_003605571.1|2001833_2002820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566574.1|2002840_2003281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674721.1|2003572_2004019_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003566579.1|2004127_2004241_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_011674722.1|2004310_2004913_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	29.8	2.1e-11
WP_003566583.1|2005029_2005437_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011674723.1|2005543_2006746_-	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	37.0	8.5e-12
WP_011673973.1|2007002_2008019_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
WP_011674724.1|2008248_2009523_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.4	3.2e-86
>prophage 10
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	2030770	2088721	2895264	transposase,protease,integrase	unidentified_phage(25.0%)	41	2078164:2078185	2082130:2082151
WP_003574021.1|2030770_2031691_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674734.1|2032227_2034378_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.4e-121
WP_003570845.1|2034760_2035525_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011674735.1|2035702_2036596_+	LCP family protein	NA	NA	NA	NA	NA
WP_003574021.1|2039043_2039964_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674736.1|2040345_2041320_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	41.6	1.7e-66
WP_003580148.1|2042682_2043183_-	QueT transporter family protein	NA	NA	NA	NA	NA
WP_011674738.1|2043294_2044008_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003566696.1|2044004_2044229_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	34.4	1.0e-08
WP_003566698.1|2044513_2044825_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003588345.1|2045084_2045723_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003570960.1|2046031_2047009_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.9	3.6e-21
WP_003566704.1|2047010_2048063_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
WP_003566706.1|2048074_2049073_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003566708.1|2049072_2049996_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011674739.1|2050170_2051793_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011674740.1|2053890_2054454_-	elongation factor P	NA	NA	NA	NA	NA
WP_011674741.1|2055186_2055894_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_011674742.1|2055886_2057371_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003570970.1|2057367_2058150_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003566723.1|2058620_2059187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591381.1|2059439_2059775_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011674744.1|2059831_2060932_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_011674745.1|2061041_2061452_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_011674746.1|2061423_2061630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566732.1|2061626_2063051_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_011674748.1|2063914_2066137_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_011674749.1|2066199_2066943_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_011674750.1|2067219_2067966_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_011674751.1|2068330_2070913_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.4	1.5e-50
WP_011674752.1|2070953_2071544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674753.1|2071969_2072575_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_011674755.1|2073260_2074073_-	sugar kinase	NA	NA	NA	NA	NA
WP_011674757.1|2075076_2075883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674758.1|2075930_2078066_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
2078164:2078185	attL	ACGCTTGGGAAAAGCGTAAGTT	NA	NA	NA	NA
WP_081038102.1|2078192_2079341_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003580311.1|2079422_2080349_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	1.1e-78
WP_011673973.1|2080600_2081617_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
WP_011674759.1|2082195_2083794_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	48.5	1.5e-117
2082130:2082151	attR	AACTTACGCTTTTCCCAAGCGT	NA	NA	NA	NA
WP_011674760.1|2083811_2086862_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003574021.1|2087800_2088721_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 11
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	2305088	2394491	2895264	transposase,protease,bacteriocin,tRNA	Faecalibacterium_phage(20.0%)	83	NA	NA
WP_003659543.1|2305088_2306495_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	5.7e-52
WP_011674855.1|2306735_2308130_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003580771.1|2308255_2308843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567227.1|2308842_2309034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576207.1|2309509_2311003_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011674856.1|2311150_2312131_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003595950.1|2312246_2312918_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_011674857.1|2313101_2313932_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011674858.1|2314077_2314917_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003595954.1|2314929_2315946_-	membrane protein	NA	NA	NA	NA	NA
WP_003567242.1|2315952_2316327_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003595958.1|2316492_2317764_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_011674859.1|2318081_2318858_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567248.1|2318875_2319763_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567252.1|2320065_2321181_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_011674860.1|2321202_2322567_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2322583_2323126_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003595964.1|2323346_2323637_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2323753_2324131_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003595976.1|2324375_2325695_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	5.9e-59
WP_003576225.1|2325925_2327272_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_011674861.1|2327499_2328600_+	ABC transporter	NA	NA	NA	NA	NA
WP_003595983.1|2328596_2329793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2329855_2330734_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003595985.1|2330895_2332950_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.1	1.6e-63
WP_011674863.1|2333106_2335737_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.9e-88
WP_003576237.1|2335898_2336522_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011674864.1|2337022_2337694_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003595993.1|2338203_2339325_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_011674865.1|2339338_2339623_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_011674866.1|2339813_2340929_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2341116_2341323_-	CsbD family protein	NA	NA	NA	NA	NA
WP_011674867.1|2341472_2342663_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_080513738.1|2342682_2343915_-	MFS transporter	NA	NA	NA	NA	NA
WP_003591669.1|2343959_2344703_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_011674713.1|2346797_2347814_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_011674713.1|2349335_2350352_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
WP_003567286.1|2351112_2351370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2351440_2351647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596008.1|2351871_2352123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596011.1|2352450_2353683_+	MFS transporter	NA	NA	NA	NA	NA
WP_011674871.1|2353760_2355017_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.5	1.1e-97
WP_003596013.1|2355106_2355940_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
WP_003588746.1|2356256_2356451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576253.1|2356704_2357241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674872.1|2357429_2358653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596022.1|2358888_2359716_-	class C sortase	NA	NA	NA	NA	NA
WP_011674873.1|2359722_2361282_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_011674874.1|2361278_2362601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674877.1|2365884_2366442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674878.1|2366536_2367733_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003576275.1|2367941_2368997_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003596039.1|2369247_2369877_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003596042.1|2370012_2370342_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003580841.1|2370338_2371127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674879.1|2371179_2371968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2372012_2372291_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2372314_2372599_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003596056.1|2372791_2373088_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2373189_2374545_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2374850_2375162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2375234_2375585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596059.1|2375758_2377138_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_011673997.1|2379508_2380912_+|transposase	IS5-like element ISLca3 family transposase	transposase	NA	NA	NA	NA
WP_003571414.1|2381377_2381515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674639.1|2381884_2382901_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_012491944.1|2383351_2384194_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2384198_2385005_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003661762.1|2385366_2385564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003588828.1|2386110_2386350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057718568.1|2386609_2386783_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567358.1|2386817_2387006_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567359.1|2387327_2387552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596083.1|2388118_2388919_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003580874.1|2389481_2389814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596085.1|2390069_2390738_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003596086.1|2390718_2390910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576308.1|2391225_2391561_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003588841.1|2391679_2392276_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003659595.1|2392546_2392855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2393137_2394058_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_011674884.1|2394063_2394261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674885.1|2394257_2394491_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 12
NC_008526	Lactobacillus paracasei ATCC 334, complete sequence	2895264	2619472	2687498	2895264	transposase,protease,holin	Streptococcus_phage(15.38%)	58	NA	NA
WP_003576567.1|2619472_2620117_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003596314.1|2620640_2621315_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.0	1.1e-13
WP_003596316.1|2621442_2621859_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011674953.1|2622071_2624600_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.1	1.4e-109
WP_011674954.1|2624663_2625668_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003596321.1|2625969_2626782_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567827.1|2626844_2627189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567829.1|2627496_2627760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011674956.1|2628048_2628726_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003567833.1|2628731_2629418_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011674957.1|2629462_2630275_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567838.1|2630371_2630854_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	1.8e-21
WP_011674958.1|2630859_2631762_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567842.1|2632011_2633214_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.9	5.6e-24
WP_011674959.1|2633518_2634712_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.8	1.9e-104
WP_003567846.1|2635112_2635811_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003567848.1|2635968_2636442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576585.1|2637023_2639006_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003596342.1|2639009_2639939_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_011674961.1|2640064_2640817_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003606111.1|2640921_2642436_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_011674962.1|2643035_2644238_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.1	9.5e-88
WP_003581247.1|2644475_2644628_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_011674963.1|2644995_2647284_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_003596390.1|2647311_2648295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674964.1|2648364_2650290_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_011674965.1|2650228_2650576_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003596394.1|2650575_2651046_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003567930.1|2651165_2651981_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003577476.1|2651970_2652783_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003658805.1|2652935_2653436_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003596395.1|2653535_2654714_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_011674966.1|2654710_2655541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567939.1|2655755_2656523_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011674967.1|2656784_2657630_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_011674968.1|2657664_2658489_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.3	6.6e-16
WP_003596400.1|2659256_2660276_+	sugar kinase	NA	NA	NA	NA	NA
WP_003596401.1|2660378_2661023_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003567951.1|2661091_2661781_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011674970.1|2661938_2663903_-	membrane protein	NA	NA	NA	NA	NA
WP_011674971.1|2663914_2664856_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	38.3	6.8e-49
WP_003596406.1|2664857_2665529_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011674972.1|2665518_2666175_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003596410.1|2666383_2667775_-	HAMP domain-containing histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	22.4	1.1e-07
WP_003606146.1|2667790_2668492_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	2.1e-34
WP_003576656.1|2669061_2669154_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_003576660.1|2669381_2669693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674973.1|2670425_2671811_-	6-phospho-alpha-glucosidase 2	NA	NA	NA	NA	NA
WP_164920377.1|2673808_2675530_-	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_011674975.1|2675648_2676899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674977.1|2678025_2679042_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_011674147.1|2680556_2681555_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	1.3e-50
WP_011674979.1|2681461_2682787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674980.1|2682861_2683233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576685.1|2683238_2683859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674981.1|2683901_2684414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674982.1|2684569_2686057_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003561810.1|2686568_2687498_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
