The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	12663	73322	3275944	tRNA,protease,plate	uncultured_virus(28.57%)	53	NA	NA
WP_011627766.1|12663_14745_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_041718101.1|14737_15646_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011627768.1|16029_17445_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011627769.1|17554_18082_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011627770.1|18230_19283_+	nitrogen regulation protein NR(II)	NA	NA	NA	NA	NA
WP_011627771.1|19279_20686_+	nitrogen regulation protein NR(I)	NA	A0A220YL79	Alteromonas_virus	25.0	1.1e-05
WP_011627772.1|20901_21531_-	7-carboxy-7-deazaguanine synthase	NA	S4TZT1	uncultured_phage	34.7	5.1e-08
WP_049753484.1|21527_22685_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011627774.1|22812_24474_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.8	5.4e-174
WP_011627775.1|24516_24804_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	46.8	7.1e-18
WP_011627776.1|25023_25398_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_011627777.1|25407_27252_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_011627778.1|27248_27752_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011627779.1|27879_28338_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011627780.1|28337_28802_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011627781.1|28821_30165_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011627782.1|30212_30788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011627783.1|30818_31628_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011627784.1|31747_32710_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_011627785.1|32713_33955_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	44.3	9.5e-83
WP_011627786.1|33967_35407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011627787.1|35511_36552_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_011627788.1|36585_37299_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011627789.1|37300_38089_-	thiazole synthase	NA	NA	NA	NA	NA
WP_041718106.1|38146_38347_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011627791.1|39903_40293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011627792.1|40292_41309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011627794.1|41925_43257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041718108.1|43277_43475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011627796.1|46573_47473_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011627798.1|49078_49588_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011627799.1|49622_51101_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011627800.1|51107_51536_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011627801.1|51555_53319_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_041718109.1|53282_54302_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011627803.1|54306_55017_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011627804.1|55013_55586_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011627805.1|55585_56923_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_156774688.1|56931_57741_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_041717844.1|57758_59315_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_049753623.1|59362_59959_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_011627809.1|59946_61389_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011627810.1|61424_65042_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011627811.1|65284_65803_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011627812.1|65889_66189_+	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_011627813.1|66331_66931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011627814.1|67015_67855_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011627815.1|67912_68611_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_011627816.1|68617_69532_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	32.1	4.9e-12
WP_011627817.1|69592_70225_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011627818.1|70271_71252_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011627819.1|71433_71985_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011627820.1|71999_73322_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	30.5	1.9e-44
>prophage 2
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	416393	423531	3275944		Staphylococcus_phage(50.0%)	8	NA	NA
WP_011628122.1|416393_417188_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	66.3	4.8e-104
WP_011628123.1|417266_418118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011628124.1|418390_419650_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.6e-101
WP_041717871.1|419662_420115_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_156774698.1|420158_421235_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.6	5.0e-40
WP_011628127.1|421266_421932_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.5	6.3e-25
WP_011628128.1|421932_423048_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.4	2.3e-59
WP_011628129.1|423060_423531_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	1.3e-29
>prophage 3
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	848180	880282	3275944	tRNA,coat,protease,integrase	Tupanvirus(50.0%)	27	878912:878934	887657:887679
WP_011628512.1|848180_850574_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011628513.1|850628_851660_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.1	4.1e-31
WP_011628514.1|851846_852206_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_011628515.1|852236_852434_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_083761823.1|852512_853067_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	30.4	2.3e-12
WP_011628517.1|853070_854996_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.5	4.6e-137
WP_011628518.1|855108_856101_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_011628519.1|856100_857621_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_156774631.1|857631_858615_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_011628521.1|858648_859374_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_011628522.1|859390_860449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011628523.1|860445_861381_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_011628524.1|861380_862850_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_011628525.1|863049_863850_+|protease	cysteine protease	protease	NA	NA	NA	NA
WP_011628526.1|863852_864323_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011628527.1|864319_866656_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_083761824.1|866707_867490_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_011628529.1|867483_867975_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011628530.1|868403_870677_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011628531.1|870676_871354_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011628532.1|871411_872422_+	polyferredoxin-like protein	NA	NA	NA	NA	NA
WP_011628533.1|872408_873422_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011628534.1|873418_874681_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_011628535.1|874677_875502_+	CoA activase	NA	NA	NA	NA	NA
WP_011628536.1|875533_876547_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_011628537.1|876543_878430_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
878912:878934	attL	GATGGTCACAGATTGGTCACACG	NA	NA	NA	NA
WP_011628538.1|878947_880282_+|integrase	tyrosine-type recombinase/integrase	integrase	M5AAB1	Nitratiruptor_phage	27.2	1.1e-07
WP_011628538.1|878947_880282_+|integrase	tyrosine-type recombinase/integrase	integrase	M5AAB1	Nitratiruptor_phage	27.2	1.1e-07
887657:887679	attR	GATGGTCACAGATTGGTCACACG	NA	NA	NA	NA
>prophage 4
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	1691994	1751833	3275944	tRNA,transposase,integrase	Bacillus_phage(27.78%)	56	1726021:1726040	1756139:1756158
WP_011629225.1|1691994_1694604_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.9	7.3e-77
WP_011629226.1|1694652_1695111_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011629227.1|1695118_1696162_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.0	3.5e-115
WP_011629228.1|1696295_1696802_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	48.1	2.4e-29
WP_011629229.1|1696848_1699485_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.8	1.2e-31
WP_011629230.1|1699592_1699916_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_011629231.1|1700742_1701480_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011629232.1|1701576_1702491_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.0	1.0e-25
WP_011629233.1|1702465_1703263_-	slipin family protein	NA	NA	NA	NA	NA
WP_011629234.1|1703404_1704487_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011629235.1|1704568_1704988_+	SufE family protein	NA	NA	NA	NA	NA
WP_049753664.1|1705356_1706226_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011629238.1|1706495_1707866_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011629239.1|1707908_1708298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156774651.1|1708426_1709137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083761846.1|1708925_1711184_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.2	1.8e-18
WP_011629242.1|1711288_1712263_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	34.4	3.9e-07
WP_011629243.1|1712244_1713576_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011629244.1|1713724_1714381_-	porin family protein	NA	NA	NA	NA	NA
WP_011629245.1|1714509_1715598_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011629246.1|1715621_1716203_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.6	2.9e-26
WP_011629247.1|1716241_1717246_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011629248.1|1717261_1718119_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_011629249.1|1718123_1718981_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_011629250.1|1719101_1720547_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011629251.1|1720552_1720897_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011629252.1|1720913_1721513_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011629253.1|1721520_1721844_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011629254.1|1721874_1723821_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.3	1.7e-41
WP_041717965.1|1724157_1724460_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011629256.1|1724450_1724786_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011629257.1|1724772_1725447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629258.1|1725694_1727182_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
1726021:1726040	attL	CTTCCTGCGCCGGGAGCTGG	NA	NA	NA	NA
WP_011629259.1|1727199_1727784_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	44.2	2.7e-24
WP_011629260.1|1727818_1728715_-	universal stress protein	NA	NA	NA	NA	NA
WP_011629261.1|1728707_1731149_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011629262.1|1731292_1732531_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_011629263.1|1732547_1733483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629264.1|1733734_1734211_-	cupin	NA	NA	NA	NA	NA
WP_011629265.1|1734270_1734984_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.0e-16
WP_011629266.1|1735183_1737355_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_011629267.1|1737485_1737875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629268.1|1738029_1738842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629269.1|1739327_1740050_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011629270.1|1740139_1740745_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_041717969.1|1740869_1741184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011629272.1|1741237_1742125_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011629273.1|1742503_1744021_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.9	1.1e-45
WP_083761848.1|1744172_1745699_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	1.1e-21
WP_011629275.1|1745685_1746426_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	40.0	1.5e-43
WP_011629273.1|1746502_1748020_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.9	1.1e-45
WP_011629276.1|1748060_1748975_+|integrase	site-specific integrase	integrase	A0A1S5RG65	Helicobacter_phage	29.0	9.6e-08
WP_011629277.1|1749102_1749591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041717971.1|1749636_1749843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011629278.1|1749839_1750196_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.7	2.8e-19
WP_011629279.1|1750240_1751833_+|transposase	IS66-like element ISAeh1 family transposase	transposase	S5VTD3	Leptospira_phage	40.0	1.4e-86
1756139:1756158	attR	CTTCCTGCGCCGGGAGCTGG	NA	NA	NA	NA
>prophage 5
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	2004577	2055979	3275944	integrase,transposase,tail	Bacillus_phage(36.36%)	48	2029765:2029782	2060964:2060981
WP_011629488.1|2004577_2005405_-|tail	phage tail protein	tail	J9PUM0	Bacillus_phage	33.3	4.0e-05
WP_011629489.1|2005453_2006608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629490.1|2006611_2006911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629491.1|2006910_2007558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629492.1|2007560_2007791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629493.1|2007783_2009136_-	ATP-binding protein	NA	A0A2D2W2A9	Stenotrophomonas_phage	46.5	1.2e-09
WP_011629494.1|2009132_2010146_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_011629496.1|2011220_2012012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629497.1|2012047_2012557_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011629498.1|2012569_2014144_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	29.8	1.1e-56
WP_011629499.1|2014668_2015565_-	prenyltransferase	NA	NA	NA	NA	NA
WP_011629500.1|2015633_2016389_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_011629501.1|2016385_2017516_-	patatin	NA	NA	NA	NA	NA
WP_011629502.1|2017552_2018365_-	hypothetical protein	NA	A0A0B5A5A2	Paracoccus_phage	41.3	5.6e-52
WP_011629503.1|2018554_2020336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011629504.1|2020350_2020764_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_011629505.1|2020922_2021477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156774663.1|2021578_2022220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156774664.1|2022446_2023337_+	DUF547 domain-containing protein	NA	NA	NA	NA	NA
WP_011629508.1|2023409_2024855_-	GntP family permease	NA	NA	NA	NA	NA
WP_011629509.1|2024859_2025942_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011629510.1|2026201_2026411_+	DUF3185 family protein	NA	NA	NA	NA	NA
WP_011629511.1|2026434_2027709_-	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_156774732.1|2027945_2029661_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011629513.1|2029647_2030781_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
2029765:2029782	attL	GAGCGTGCCCAGCGCGAG	NA	NA	NA	NA
WP_011629514.1|2030938_2031988_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_011629515.1|2032075_2032669_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011629518.1|2033630_2034053_-	GFA family protein	NA	NA	NA	NA	NA
WP_156774733.1|2034142_2034562_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_083761857.1|2034809_2035571_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_083761899.1|2035781_2036006_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	38.1	8.0e-09
WP_011629521.1|2036727_2038320_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	40.3	7.3e-88
WP_011629522.1|2038364_2038721_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.7	4.7e-19
WP_041717971.1|2038717_2038924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156774665.1|2038945_2040430_+	AsmA family protein	NA	NA	NA	NA	NA
WP_011629524.1|2040447_2040711_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_011629525.1|2040707_2040950_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011629527.1|2041303_2044393_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_011629528.1|2044396_2045008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629529.1|2045004_2046264_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011629530.1|2046260_2048438_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	23.8	9.2e-33
WP_011629531.1|2048597_2049212_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	36.3	4.0e-26
WP_156774666.1|2049282_2050188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629533.1|2050277_2051126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011629534.1|2051260_2051893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156774667.1|2051889_2052999_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.2	2.7e-12
WP_011629536.1|2053053_2054343_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011629537.1|2054590_2055979_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.7	1.8e-58
2060964:2060981	attR	CTCGCGCTGGGCACGCTC	NA	NA	NA	NA
>prophage 6
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	2627019	2635512	3275944		Escherichia_phage(37.5%)	8	NA	NA
WP_011630051.1|2627019_2628123_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.8	3.1e-93
WP_011630052.1|2628119_2629040_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	30.6	1.0e-20
WP_011630053.1|2629039_2629921_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.6	1.3e-102
WP_011630054.1|2629942_2630491_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	52.0	2.7e-50
WP_041718052.1|2630814_2632623_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	1.1e-26
WP_011630056.1|2632646_2633645_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	35.6	1.9e-41
WP_011630057.1|2633644_2634805_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	36.0	4.0e-35
WP_011630058.1|2634801_2635512_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	34.9	4.2e-11
>prophage 7
NC_008340	Alkalilimnicola ehrlichii MLHE-1, complete genome	3275944	2972807	2983636	3275944	tRNA	Bacillus_phage(16.67%)	9	NA	NA
WP_011630357.1|2972807_2974997_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.5	1.0e-07
WP_011630358.1|2974978_2975569_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_011630359.1|2975565_2976879_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011630360.1|2976882_2977827_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	1.9e-06
WP_011630361.1|2977823_2978360_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	1.0e-17
WP_011630362.1|2978527_2979544_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	27.8	2.0e-06
WP_011630363.1|2979567_2980707_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.1	1.8e-32
WP_011630364.1|2980706_2981180_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011630365.1|2981242_2983636_+	DNA topoisomerase I	NA	A0A1V0SCS0	Indivirus	34.5	2.4e-119
