The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	736506	797760	9965640	transposase,tRNA,integrase	environmental_halophage(14.29%)	37	785394:785416	800945:800967
WP_011682381.1|736506_737622_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_041858880.1|737614_738769_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	30.6	6.4e-33
WP_011682383.1|738786_739575_+	SAM-dependent chlorinase/fluorinase	NA	NA	NA	NA	NA
WP_011682384.1|739634_740420_+	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	1.3e-16
WP_011682385.1|740419_741166_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157675092.1|741162_741792_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011682387.1|741766_743836_-	acylase	NA	NA	NA	NA	NA
WP_011682388.1|743832_745497_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_041857319.1|745511_745895_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_011682390.1|746312_747977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675093.1|748102_748240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682391.1|748348_748585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041857321.1|748829_749057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682393.1|749303_750638_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157675094.1|750741_751203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682395.1|751345_752839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675095.1|752835_756072_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011682397.1|756139_757132_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041857324.1|757189_757933_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011682399.1|757965_760155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675096.1|760290_763701_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157675097.1|763706_764066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682402.1|764528_766163_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	34.8	4.4e-80
WP_011682403.1|766165_767509_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A0K0KW09	Prochlorococcus_phage	33.3	9.4e-44
WP_011682404.1|767592_769380_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_049872932.1|770004_770463_+	hypothetical protein	NA	A0A2L1IVB6	Escherichia_phage	37.0	1.5e-09
WP_157675098.1|770647_772096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682407.1|772319_786320_+	hypothetical protein	NA	NA	NA	NA	NA
785394:785416	attL	AACAGCGGATGGCAGACGCGCGG	NA	NA	NA	NA
WP_041857326.1|786512_790988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011682409.1|791081_791381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675099.1|791411_791540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011682410.1|791669_792425_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011682411.1|792475_793714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.4	1.7e-07
WP_011682412.1|794638_795637_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049872933.1|795633_796230_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011682414.1|796570_796933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011682415.1|796929_797760_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	5.8e-36
800945:800967	attR	CCGCGCGTCTGCCATCCGCTGTT	NA	NA	NA	NA
>prophage 2
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	4118342	4191597	9965640	transposase,protease,integrase	Pandoravirus(20.0%)	56	4188319:4188350	4191689:4191720
WP_157675348.1|4118342_4119404_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011684994.1|4119479_4120571_-	acetate kinase	NA	NA	NA	NA	NA
WP_011684995.1|4120590_4121544_-	DoxX family protein	NA	NA	NA	NA	NA
WP_011684996.1|4121556_4122087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041857859.1|4122164_4122344_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_011684997.1|4122497_4123826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011684998.1|4123822_4125826_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011683708.1|4126376_4127684_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_011684999.1|4127849_4128440_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011685000.1|4128426_4130979_+	protein kinase	NA	A0A0B5J6A8	Pandoravirus	32.3	1.7e-14
WP_041857860.1|4131074_4131797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685002.1|4131845_4132553_+	TIGR03435 family protein	NA	NA	NA	NA	NA
WP_011685003.1|4132637_4133222_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041857861.1|4133414_4133708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685005.1|4133757_4134591_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011685006.1|4134646_4135156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685007.1|4135608_4136592_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157675349.1|4136595_4138041_+	cytochrome C	NA	NA	NA	NA	NA
WP_011685009.1|4138344_4139163_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_011685010.1|4139167_4140406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675350.1|4140614_4141406_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011685012.1|4141398_4142292_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011685013.1|4142296_4143988_+	serine/threonine protein kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	27.9	2.7e-11
WP_011685014.1|4144079_4147169_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_011685015.1|4147165_4147948_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_011685016.1|4147931_4148726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011685017.1|4148985_4152597_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011685018.1|4152773_4153835_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011685019.1|4153930_4154716_+	aldolase	NA	NA	NA	NA	NA
WP_011685020.1|4154712_4155729_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_011685021.1|4155735_4155975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685022.1|4156017_4156434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685023.1|4156451_4157120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011685024.1|4157295_4159740_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049873097.1|4159795_4160326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041859454.1|4160453_4160930_+	VOC family protein	NA	NA	NA	NA	NA
WP_011685028.1|4161618_4163451_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.0	6.8e-37
WP_011685029.1|4163728_4164376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011685030.1|4164495_4165029_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_011685031.1|4165029_4165518_-	DinB family protein	NA	NA	NA	NA	NA
WP_011685032.1|4165565_4166891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011685033.1|4167442_4175755_-	Ig domain-containing protein	NA	NA	NA	NA	NA
WP_041857865.1|4176124_4176475_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011685035.1|4176478_4179202_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011685036.1|4179416_4180043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041857867.1|4181372_4182152_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_011685039.1|4182148_4182391_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011685040.1|4182390_4182789_-	DUF2255 family protein	NA	NA	NA	NA	NA
WP_011685041.1|4182811_4183828_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011685042.1|4183837_4184833_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_085952965.1|4184835_4185255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011685044.1|4185439_4186390_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011685045.1|4186899_4188093_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
4188319:4188350	attL	AGGCACTATGCCGCGTCCCGGACTATGCCGCG	NA	NA	NA	NA
WP_011685046.1|4188435_4189674_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	30.4	2.2e-07
WP_011685047.1|4189670_4190615_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011685048.1|4190598_4191597_+|integrase	site-specific integrase	integrase	U5JA40	Bacillus_phage	23.6	4.9e-05
4191689:4191720	attR	CGCGGCATAGTCCGGGACGCGGCATAGTGCCT	NA	NA	NA	NA
>prophage 3
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	5943694	6012553	9965640	transposase,integrase	Only_Syngen_Nebraska_virus(20.0%)	58	5987632:5987649	6022362:6022379
WP_011686406.1|5943694_5944933_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011686407.1|5945172_5945517_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_041858140.1|5945539_5946496_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011686409.1|5946489_5948322_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_041859760.1|5948616_5948967_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011686411.1|5949028_5951569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011686412.1|5951625_5954283_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011686413.1|5954287_5954638_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011686414.1|5954686_5956261_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157675469.1|5956273_5956429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011686415.1|5956553_5957588_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_011686416.1|5957598_5958471_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_011686417.1|5958673_5959543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011686418.1|5959567_5960443_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011686419.1|5960520_5961150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011686420.1|5961504_5962398_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_041858143.1|5962446_5963052_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011686422.1|5963207_5964524_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011686423.1|5964549_5965506_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.5	3.0e-28
WP_011686424.1|5965506_5966106_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011686425.1|5966102_5968088_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157675922.1|5968344_5969115_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_049873199.1|5969550_5971569_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_011686428.1|5971591_5971897_+	isochorismate lyase	NA	NA	NA	NA	NA
WP_157675470.1|5971907_5972510_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_011686430.1|5972506_5973052_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011686431.1|5973048_5973606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011686432.1|5973602_5973926_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011686433.1|5973976_5975380_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011686434.1|5975449_5977429_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.3	1.2e-79
WP_011686435.1|5977459_5978164_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_083783834.1|5978160_5979183_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_011686437.1|5979207_5980608_+	peptidase C45	NA	NA	NA	NA	NA
WP_063720758.1|5980608_5983905_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011686439.1|5984118_5985882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011686440.1|5985973_5986933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049873200.1|5987032_5987431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011686442.1|5987427_5988021_-	hypothetical protein	NA	NA	NA	NA	NA
5987632:5987649	attL	CTCGGCGACGGCGGCGGC	NA	NA	NA	NA
WP_011684349.1|5988851_5989784_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.5	4.7e-34
WP_011683270.1|5989780_5990137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011686444.1|5990218_5990944_-	TIGR03435 family protein	NA	NA	NA	NA	NA
WP_011686445.1|5990949_5992698_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011686446.1|5992756_5996746_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_049873201.1|5997076_5997721_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011686448.1|5997984_5999169_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011686449.1|5999311_5999653_-	response regulator	NA	NA	NA	NA	NA
WP_041859770.1|5999848_6000952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675923.1|6001093_6001618_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011686452.1|6001607_6002141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011686453.1|6002130_6002697_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_011686454.1|6002789_6003980_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_083784136.1|6004157_6005414_-|transposase	IS701-like element ISSus1 family transposase	transposase	NA	NA	NA	NA
WP_049873202.1|6005607_6006684_+	TIGR03118 family protein	NA	A0A2K9KZ30	Tupanvirus	28.5	2.5e-23
WP_011686457.1|6006763_6008242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011686458.1|6008403_6009576_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011686459.1|6009590_6010016_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011686460.1|6010209_6011520_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157675924.1|6011680_6012553_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	26.3	8.8e-19
6022362:6022379	attR	CTCGGCGACGGCGGCGGC	NA	NA	NA	NA
>prophage 4
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	7586557	7657261	9965640	transposase,integrase	Acidithiobacillus_phage(20.0%)	54	7586391:7586437	7659494:7659540
7586391:7586437	attL	TTTCGTAATCAGCAGGTCGCCGGTTCAATCCCGGCGGGTGGCTCCAT	NA	NA	NA	NA
WP_011687724.1|7586557_7588114_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	49.6	9.2e-136
WP_157675601.1|7589201_7589402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687727.1|7590174_7590879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675602.1|7591075_7591279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687729.1|7591718_7592768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041858412.1|7592864_7593062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687731.1|7593548_7594028_+	response regulator	NA	NA	NA	NA	NA
WP_157675963.1|7594097_7594226_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011687732.1|7594365_7594845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687733.1|7595346_7595673_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_157675603.1|7595909_7596074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687734.1|7596784_7597627_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.8	1.6e-33
WP_011682718.1|7597623_7597983_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_049873300.1|7598733_7599390_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011687737.1|7600639_7601389_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.9	2.6e-11
WP_011687738.1|7601469_7602258_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041858414.1|7603042_7603303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083783929.1|7604977_7607335_+	CRTAC1 family protein	NA	NA	NA	NA	NA
WP_011687743.1|7607338_7609174_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_011687744.1|7609170_7610292_+	ligand-binding sensor domain-containing protein	NA	NA	NA	NA	NA
WP_011687745.1|7610288_7610777_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_011687746.1|7610779_7612603_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011687747.1|7612865_7614134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687748.1|7614375_7617756_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157675964.1|7617800_7619429_-	CRTAC1 family protein	NA	NA	NA	NA	NA
WP_011687750.1|7619461_7620496_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011687751.1|7622879_7624229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675604.1|7624225_7624897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687753.1|7624938_7626228_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_049873303.1|7626231_7626648_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157675605.1|7626832_7627192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687757.1|7628105_7628732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687758.1|7629091_7629700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675606.1|7630063_7630393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041858422.1|7631771_7632656_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.7	6.0e-23
WP_011687762.1|7633239_7634262_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_011687763.1|7635032_7636103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687764.1|7636105_7636669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011687765.1|7637194_7637602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687766.1|7637821_7639036_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011687767.1|7640182_7641004_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_011687768.1|7641618_7643124_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011687769.1|7643364_7644879_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.6	2.7e-07
WP_011687770.1|7644875_7645805_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011687771.1|7645794_7646847_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011687772.1|7646846_7647953_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011687773.1|7647949_7649356_-	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_011687774.1|7649352_7649892_-	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_011687775.1|7649901_7652532_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083783931.1|7653337_7654393_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157675607.1|7654414_7654828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011687778.1|7654809_7655175_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157675965.1|7655228_7656116_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_083783933.1|7656112_7657261_+|transposase	transposase	transposase	NA	NA	NA	NA
7659494:7659540	attR	TTTCGTAATCAGCAGGTCGCCGGTTCAATCCCGGCGGGTGGCTCCAT	NA	NA	NA	NA
>prophage 5
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	8518862	8554752	9965640	transposase,integrase	Escherichia_phage(33.33%)	29	8521128:8521148	8531927:8531947
WP_011688432.1|8518862_8519798_+|integrase	site-specific integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.5	4.1e-06
WP_011688433.1|8520247_8520934_-	curculin domain-containing protein	NA	NA	NA	NA	NA
8521128:8521148	attL	CTCTATCGGAAGTGACGCGGC	NA	NA	NA	NA
WP_041858533.1|8521450_8521816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675661.1|8522772_8524605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688436.1|8525788_8526811_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_157675662.1|8526850_8528806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688438.1|8529323_8529656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011688439.1|8529958_8531050_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157675663.1|8531046_8531622_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041858535.1|8532007_8532400_-	hypothetical protein	NA	NA	NA	NA	NA
8531927:8531947	attR	GCCGCGTCACTTCCGATAGAG	NA	NA	NA	NA
WP_157675664.1|8533042_8533927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688443.1|8534161_8534875_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	49.3	3.1e-54
WP_011688444.1|8535078_8535357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011688445.1|8535375_8535783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675979.1|8535779_8536442_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	52.2	2.8e-57
WP_157675665.1|8536551_8537793_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.7	5.4e-38
WP_157675666.1|8537813_8538347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688449.1|8538379_8539009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675667.1|8539093_8539219_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_041858538.1|8540605_8540794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688452.1|8541266_8543423_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_011688454.1|8544481_8545864_+	MFS transporter	NA	NA	NA	NA	NA
WP_157675668.1|8545824_8546865_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011688457.1|8548839_8549331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041858544.1|8550289_8550499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011688459.1|8551286_8551565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011688460.1|8551869_8552190_-	PAS sensor domain-containing protein	NA	NA	NA	NA	NA
WP_049873353.1|8552283_8553213_-	hypothetical protein	NA	A0A076GD42	Sinorhizobium_phage	29.7	2.6e-24
WP_011682415.1|8553921_8554752_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	5.8e-36
>prophage 6
NC_008536	Candidatus Solibacter usitatus Ellin6076, complete sequence	9965640	9545563	9574169	9965640	transposase,integrase	Escherichia_phage(60.0%)	24	9529563:9529578	9564860:9564875
9529563:9529578	attL	CAATTCCGATCTGGTG	NA	NA	NA	NA
WP_011689228.1|9545563_9546277_+|transposase	IS6-like element ISSus3 family transposase	transposase	A0A077SL39	Escherichia_phage	50.2	2.1e-55
WP_157675741.1|9546855_9547128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157675742.1|9547221_9547563_+	response regulator	NA	NA	NA	NA	NA
WP_041858694.1|9547581_9547800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011689230.1|9547853_9548129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675743.1|9548762_9549032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011689233.1|9549135_9549429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675744.1|9550162_9550474_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_049873400.1|9550500_9550842_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.0	2.8e-21
WP_157676008.1|9550971_9552498_-	phosphoesterase	NA	A0A1V0SD32	Indivirus	40.5	3.2e-88
WP_041858698.1|9552720_9553170_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_157675745.1|9553405_9554137_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_157675746.1|9556156_9556882_+|transposase	transposase	transposase	K4HZD4	Acidithiobacillus_phage	49.2	6.1e-58
WP_041858700.1|9557260_9557836_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157675747.1|9558826_9559015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011683390.1|9560148_9560895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157675179.1|9561337_9561649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011689240.1|9565282_9565852_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
9564860:9564875	attR	CACCAGATCGGAATTG	NA	NA	NA	NA
WP_011689241.1|9566381_9567095_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	48.2	2.6e-53
WP_157675748.1|9567485_9568223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041858704.1|9568799_9569000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011689242.1|9569752_9570031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011689243.1|9570587_9571106_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_157675749.1|9572999_9574169_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
