The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008600	Bacillus thuringiensis str. Al Hakam, complete sequence	5257091	326594	334971	5257091		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|326594_327902_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|327990_328710_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278823.1|328702_328957_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666777.1|328953_329637_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|329620_331840_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|331824_333240_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|333346_334387_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|334383_334971_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 2
NC_008600	Bacillus thuringiensis str. Al Hakam, complete sequence	5257091	1883599	1892918	5257091		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|1883599_1884862_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194301.1|1884960_1885725_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453763.1|1885965_1887726_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_171856546.1|1887787_1888492_+	response regulator	NA	W8CYM9	Bacillus_phage	93.6	5.0e-121
WP_001231497.1|1888488_1889562_+	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_000823554.1|1889586_1890174_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1890370_1891090_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103838.1|1891239_1891911_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_001258513.1|1892045_1892918_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
>prophage 3
NC_008600	Bacillus thuringiensis str. Al Hakam, complete sequence	5257091	2671182	2678388	5257091		Geobacillus_phage(33.33%)	9	NA	NA
WP_001065246.1|2671182_2672550_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000720567.1|2672987_2673506_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001093444.1|2673715_2674102_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655496.1|2674167_2674875_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_000994639.1|2674896_2675250_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288934.1|2675263_2675668_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714651.1|2675915_2677301_+	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.5	1.1e-76
WP_000820167.1|2677303_2677516_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000540634.1|2677581_2678388_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 4
NC_008600	Bacillus thuringiensis str. Al Hakam, complete sequence	5257091	4194990	4261068	5257091	integrase,protease,coat,tRNA,bacteriocin	uncultured_Mediterranean_phage(36.36%)	60	4231271:4231290	4267281:4267300
WP_000903175.1|4194990_4195758_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000840895.1|4196107_4197883_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	7.1e-15
WP_033681243.1|4197895_4199167_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001242605.1|4199521_4199698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001266953.1|4199883_4200324_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001262809.1|4200341_4202525_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_000346214.1|4202735_4203248_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	6.5e-30
WP_000941260.1|4203295_4205635_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	4.5e-86
WP_001994720.1|4205736_4206630_-	cation transporter	NA	NA	NA	NA	NA
WP_001119073.1|4206783_4209048_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.0	3.3e-33
WP_000886975.1|4209318_4209603_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_000198280.1|4209777_4211337_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_000455389.1|4211366_4212014_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000349134.1|4212117_4212501_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_000991116.1|4212537_4212798_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.3	2.5e-06
WP_000125362.1|4212825_4213965_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354030.1|4213977_4215030_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|4215049_4215250_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344460.1|4215246_4216248_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000464508.1|4216253_4216871_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|4217059_4218004_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871185.1|4218016_4218547_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001079930.1|4218667_4219597_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000426920.1|4219664_4219985_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000721241.1|4220430_4220865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093533.1|4220898_4221543_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000690816.1|4221721_4223569_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025291.1|4223943_4225050_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092246.1|4225080_4225914_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138561.1|4225933_4227463_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|4227615_4228755_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|4228757_4229300_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510428.1|4229381_4230029_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|4230110_4230962_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026353.1|4231058_4232975_-	ABC transporter permease	NA	NA	NA	NA	NA
4231271:4231290	attL	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_001011372.1|4233024_4234947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|4234921_4235698_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865391.1|4235791_4236874_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|4236863_4237571_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|4237710_4238997_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|4238996_4239545_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000944957.1|4239608_4239899_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|4239902_4240247_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4240258_4240567_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855457.1|4240736_4242125_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599073.1|4242192_4243053_-|protease	stage IV sporulation intramembrane metalloprotease SpoIVFB	protease	NA	NA	NA	NA
WP_000797461.1|4243045_4243792_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|4243925_4244723_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|4244725_4245412_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|4245447_4245993_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|4246007_4246859_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|4246900_4247920_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000366809.1|4248354_4249776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907107.1|4249735_4252777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913003.1|4252806_4254570_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001087615.1|4254556_4255309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081956.1|4256865_4258233_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000051680.1|4258260_4260453_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
WP_000849670.1|4260662_4260839_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001089676.1|4260861_4261068_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
4267281:4267300	attR	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
>prophage 1
NC_008598	Bacillus thuringiensis str. Al Hakam plasmid pALH1, complete sequence	55939	0	22541	55939	terminase	Bacillus_phage(62.96%)	35	NA	NA
WP_000113786.1|664_1594_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	91.1	8.2e-132
WP_000504255.1|2150_2975_-	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	60.6	1.2e-73
WP_000583549.1|2987_3572_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	6.5e-26
WP_000393224.1|4074_4305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000432046.1|4393_4720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042329745.1|5795_6182_-	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	97.7	7.5e-63
WP_000529718.1|6319_6949_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.8	5.9e-49
WP_001114345.1|6951_7131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001292053.1|7155_7344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784801.1|7346_7544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000455713.1|8940_9540_-	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	45.6	1.9e-44
WP_011731650.1|9580_9790_-	hypothetical protein	NA	I1TLG8	Bacillus_phage	95.7	2.0e-33
WP_000932236.1|9827_10325_-	dUTP diphosphatase	NA	S6AVW3	Thermus_phage	31.1	1.0e-16
WP_000712437.1|10329_10506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201869.1|10516_10798_-	glutaredoxin family protein	NA	M4W5X4	Bacillus_phage	56.3	1.1e-15
WP_000434347.1|11100_11241_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	93.5	3.8e-17
WP_000219525.1|11249_11963_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	51.4	4.1e-38
WP_000811957.1|11974_12238_-	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_011731652.1|12234_12522_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	80.0	6.4e-35
WP_000332351.1|12436_12700_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_041184387.1|12712_13594_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000073890.1|13544_14360_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_000487938.1|14360_14582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043060.1|14781_15456_-	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000780697.1|15452_15935_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_000655888.1|15947_16097_-	hypothetical protein	NA	A0A0M5M3T1	Bacillus_phage	72.1	1.8e-09
WP_001006520.1|16554_17325_-	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_080011779.1|17364_17586_-	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_000578778.1|17717_18068_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_000721629.1|18388_18538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189353.1|18577_19726_-	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000859163.1|20222_20570_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_000448836.1|20774_21479_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000831284.1|21498_21843_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000451516.1|21977_22541_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
>prophage 2
NC_008598	Bacillus thuringiensis str. Al Hakam plasmid pALH1, complete sequence	55939	28643	29465	55939		Enterococcus_phage(100.0%)	1	NA	NA
WP_001018643.1|28643_29465_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	43.8	1.3e-51
>prophage 3
NC_008598	Bacillus thuringiensis str. Al Hakam plasmid pALH1, complete sequence	55939	33426	55316	55939	portal,capsid,tail,plate	Bacillus_phage(47.06%)	27	NA	NA
WP_000128985.1|33426_34017_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.7	2.3e-10
WP_000473803.1|34127_34391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272608.1|34886_36152_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.6	1.7e-108
WP_001057807.1|36148_36490_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000249931.1|36659_37568_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001173690.1|37580_37934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001266380.1|38130_38892_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	1.3e-122
WP_001131587.1|38891_39116_-	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	79.4	5.2e-24
WP_000151216.1|39118_39400_-	hypothetical protein	NA	D2XR31	Bacillus_phage	84.9	4.8e-35
WP_001152008.1|39441_40110_-	hypothetical protein	NA	A0A2H4J9X9	uncultured_Caudovirales_phage	74.8	7.9e-52
WP_042329765.1|40124_41714_-|plate	BppU family phage baseplate upper protein	plate	D2XPZ7	Bacillus_virus	41.4	2.9e-76
WP_000222205.1|41774_42041_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000289463.1|42050_43898_-|tail	phage tail protein	tail	A0A2P1JTV8	Anoxybacillus_phage	44.2	2.9e-128
WP_000383069.1|43909_44791_-|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.6	1.7e-73
WP_000235292.1|44790_47517_-	hypothetical protein	NA	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_001229383.1|47532_47793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001210040.1|47870_48287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000852141.1|48352_48817_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000273213.1|48831_49233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168162.1|49235_49727_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.9	1.1e-39
WP_000056960.1|49711_50104_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_001128458.1|50103_50493_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	3.2e-21
WP_001131834.1|50498_50681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059035.1|50697_51615_-|capsid	phage major capsid protein	capsid	A5GYL9	Lactococcus_phage	34.8	1.2e-45
WP_000746379.1|51630_52818_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	46.5	2.8e-76
WP_001169137.1|52864_53791_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.3	4.5e-45
WP_000182666.1|53777_55316_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	38.6	1.3e-94
