The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	196021	249449	4326849	integrase,transposase	Acidithiobacillus_phage(28.57%)	47	226438:226452	256024:256038
WP_011783405.1|196021_197323_+|transposase	IS1380-like element ISMaq4 family transposase	transposase	NA	NA	NA	NA
WP_011783744.1|197818_198712_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011783745.1|198931_200038_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011783746.1|200145_200553_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_011783747.1|200553_201921_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_011783748.1|202022_203900_-	MFS transporter	NA	NA	NA	NA	NA
WP_011783749.1|204036_204702_+	nitroreductase	NA	NA	NA	NA	NA
WP_011783750.1|204714_205083_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_011783751.1|205252_207766_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_152526048.1|207793_209044_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011783753.1|209369_210668_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_011783754.1|210712_211573_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	6.4e-30
WP_011783755.1|211765_212758_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049756838.1|212771_214160_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011783757.1|214612_217288_+	nitrate reductase	NA	NA	NA	NA	NA
WP_031211744.1|217289_217997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783759.1|218117_218636_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011783760.1|218843_220583_-	bifunctional protein-serine/threonine kinase/phosphatase	NA	A0A2H4UW49	Bodo_saltans_virus	25.4	2.6e-14
WP_011783761.1|220641_221490_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_011783762.1|221806_222562_-	TonB family protein	NA	NA	NA	NA	NA
WP_011783763.1|222558_222969_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011783764.1|222965_223361_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011783765.1|223347_224145_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_081432052.1|224313_226677_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.4	2.1e-14
226438:226452	attL	ATGGCGCGGGCAGAA	NA	NA	NA	NA
WP_011783767.1|226673_227267_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011783768.1|227445_228564_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041656582.1|230398_230638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011783770.1|230634_232341_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011783771.1|232413_233169_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	59.2	4.0e-76
WP_041656585.1|233183_234707_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	2.6e-159
WP_011783773.1|235130_235571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041656069.1|235886_236135_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041656071.1|236250_236802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756839.1|236798_238199_+	helicase	NA	NA	NA	NA	NA
WP_011783776.1|238461_239046_-	alpha-helical coiled-coil protein	NA	NA	NA	NA	NA
WP_041656072.1|239476_240082_+	exonuclease	NA	A0A1L3KJF4	Beihai_hepe-like_virus	27.4	2.4e-07
WP_011783778.1|240078_240711_+	metallophosphoesterase	NA	A0A1V0SDK2	Indivirus	34.4	1.4e-26
WP_081432092.1|240803_241112_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_011783780.1|241123_241363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011783781.1|241367_241835_+	DNA polymerase	NA	NA	NA	NA	NA
WP_011783782.1|241835_242078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680553.1|242239_242692_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011783784.1|242729_243167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783785.1|243187_243565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783786.1|243564_243807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783465.1|244258_245638_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011783464.1|245627_249449_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
256024:256038	attR	ATGGCGCGGGCAGAA	NA	NA	NA	NA
>prophage 2
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	440321	472760	4326849	integrase,transposase	Leptospira_phage(20.0%)	32	446750:446764	459338:459352
WP_011783936.1|440321_441662_+|transposase	ISNCY-like element ISMaq5 family transposase	transposase	NA	NA	NA	NA
WP_157680692.1|441843_442377_-	DUF2219 family protein	NA	NA	NA	NA	NA
WP_011783938.1|442486_443245_+	phosphotransferase	NA	NA	NA	NA	NA
WP_011783939.1|443273_445424_-	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
WP_011783940.1|445529_446258_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011783941.1|446438_447062_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
446750:446764	attL	CCAGATCATGGCGAT	NA	NA	NA	NA
WP_081432094.1|449534_449699_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157680694.1|449972_450437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011783945.1|450548_451154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157680696.1|451146_452157_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_081432053.1|452467_453736_+|integrase	site-specific integrase	integrase	A0A1V0E8G8	Vibrio_phage	26.2	3.9e-31
WP_157680698.1|454068_454257_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011783948.1|454249_455755_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_011783949.1|456085_457240_+	plasmid recombination enzyme	NA	M1NXP9	Cellulophaga_phage	28.8	2.6e-10
WP_011783950.1|457388_457628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011783951.1|457667_458135_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_085987358.1|458293_459378_-|transposase	IS3-like element ISMaq1 family transposase	transposase	S5WIU1	Leptospira_phage	39.7	8.9e-45
459338:459352	attR	ATCGCCATGATCTGG	NA	NA	NA	NA
WP_157680563.1|459427_459577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041656104.1|459653_459977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680565.1|459998_460619_-	exonuclease	NA	NA	NA	NA	NA
WP_011783955.1|460600_461290_-	metallophosphoesterase	NA	A0A291L9W7	Bordetella_phage	36.7	9.1e-27
WP_049756844.1|461512_461872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085987383.1|462563_463725_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	63.0	1.5e-114
WP_157680567.1|463844_464165_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011783956.1|464186_465215_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.0	1.4e-71
WP_011783957.1|465548_466109_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	55.1	7.9e-45
WP_049756845.1|466191_466416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036149817.1|466586_468110_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	2.4e-160
WP_011783959.1|468124_468880_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.0	8.0e-77
WP_157680569.1|468944_469109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041656109.1|469095_470778_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_011783961.1|470774_472760_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	1.6e-31
>prophage 3
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	622458	691983	4326849	integrase,transposase,protease	Leptospira_phage(20.0%)	52	620878:620894	650780:650796
620878:620894	attL	GTCGATGGTGATGGTGT	NA	NA	NA	NA
WP_011784095.1|622458_623700_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_008174217.1|623711_623954_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_011784096.1|623946_625671_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_008174219.1|625682_625883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036233698.1|626622_627225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784098.1|627475_627685_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	54.1	8.3e-16
WP_011784099.1|627681_628296_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_011784100.1|628313_628904_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_011784101.1|628947_632529_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_011784102.1|632569_634240_+	ATPase	NA	NA	NA	NA	NA
WP_011784103.1|634381_636478_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	31.9	5.0e-44
WP_011784104.1|636481_637864_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_011784105.1|637869_641358_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_011784106.1|641371_642484_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011784107.1|642480_643158_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011784108.1|643154_645671_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_011784109.1|645683_647744_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_011784110.1|647753_650186_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011784111.1|650182_651427_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
650780:650796	attR	GTCGATGGTGATGGTGT	NA	NA	NA	NA
WP_011784112.1|651438_654714_+	AAA family ATPase	NA	A0A0E3ETG1	Synechococcus_phage	27.9	6.9e-08
WP_011784113.1|654721_656107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784115.1|656387_657020_-	resolvase	NA	NA	NA	NA	NA
WP_011784116.1|657140_657530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011784117.1|657600_657876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011784118.1|657868_658717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011784122.1|660585_661425_+	universal stress protein	NA	NA	NA	NA	NA
WP_011784123.1|661611_662058_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041656137.1|662377_663325_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_011784125.1|663381_664635_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011784126.1|664631_667799_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	8.4e-43
WP_113863608.1|667818_669222_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011784128.1|669205_669673_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011784129.1|669901_670522_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011784130.1|670569_671238_+	cupin	NA	NA	NA	NA	NA
WP_011784131.1|671376_671973_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011784132.1|672034_673117_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011784133.1|673188_673956_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011784134.1|674071_677107_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011784135.1|677103_678156_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011784136.1|678193_679096_-	alpha/beta hydrolase	NA	A0A212PT49	Cowpox_virus	35.0	3.6e-07
WP_011784137.1|679085_679577_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_031209883.1|679573_680059_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_011784139.1|680317_680932_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031209879.1|680973_682041_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011783959.1|682310_683066_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.0	8.0e-77
WP_036149817.1|683080_684604_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	2.4e-160
WP_011784141.1|684806_685118_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_011784142.1|685132_686545_+	cytochrome P450	NA	NA	NA	NA	NA
WP_011784143.1|686618_687869_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_011783956.1|688191_689220_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.0	1.4e-71
WP_011784144.1|689639_690584_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	55.8	1.4e-91
WP_011784145.1|691038_691983_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	57.4	5.7e-96
>prophage 4
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	1068852	1163180	4326849	transposase,integrase,tRNA,protease	Acidithiobacillus_phage(17.39%)	82	1060104:1060118	1124380:1124394
1060104:1060118	attL	GCAAGGGCACGATCC	NA	NA	NA	NA
WP_011784455.1|1068852_1070889_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	28.9	6.6e-57
WP_041656205.1|1071069_1072170_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011784457.1|1072430_1072997_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	71.0	1.7e-71
WP_011784458.1|1072993_1073593_+	YjaG family protein	NA	NA	NA	NA	NA
WP_011784459.1|1073656_1074934_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011784460.1|1074930_1075671_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_011784461.1|1075744_1076407_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	8.7e-27
WP_011784462.1|1076403_1077468_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.3	1.1e-76
WP_011784463.1|1077656_1078976_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_011784464.1|1078997_1079558_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011784465.1|1079554_1080253_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_011784466.1|1080296_1081094_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	31.7	1.4e-15
WP_011784467.1|1081104_1081446_+	YqcC family protein	NA	NA	NA	NA	NA
WP_011784468.1|1081462_1082302_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_011784469.1|1082527_1084828_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011784470.1|1084933_1085545_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_011784471.1|1085544_1086432_+	histidine kinase	NA	NA	NA	NA	NA
WP_011784472.1|1086548_1088579_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.1	7.6e-21
WP_011784473.1|1088609_1089167_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011784474.1|1089190_1090075_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011784475.1|1090079_1092932_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	2.1e-141
WP_011784476.1|1093023_1093533_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_041656703.1|1093522_1095013_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.1	1.5e-55
WP_011784478.1|1095250_1096354_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011784479.1|1096346_1097408_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011784480.1|1097416_1097953_-	RDD family protein	NA	NA	NA	NA	NA
WP_011784481.1|1098111_1100742_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.9	2.8e-84
WP_011784482.1|1100847_1102086_+	aspartate kinase	NA	NA	NA	NA	NA
WP_011784483.1|1102258_1102456_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	74.5	6.2e-13
WP_011784484.1|1103000_1103537_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_011784485.1|1103641_1105015_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.1	7.1e-47
WP_011784486.1|1105240_1105492_+	OadG family protein	NA	NA	NA	NA	NA
WP_011784487.1|1105534_1107322_+	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011784488.1|1107335_1108670_+	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_011784489.1|1108727_1111847_-	error-prone DNA polymerase	NA	R4TMT6	Streptomyces_phage	27.0	1.9e-92
WP_011784490.1|1111846_1113268_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011784491.1|1113271_1113964_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011784492.1|1114091_1114427_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011784493.1|1114420_1115410_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	43.6	8.7e-63
WP_011784494.1|1115872_1116724_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	30.8	3.2e-13
WP_011784495.1|1116723_1117848_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_041656209.1|1118173_1118674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784497.1|1119464_1120790_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	23.5	1.4e-12
WP_011784498.1|1121082_1122384_+|transposase	IS1380-like element ISMaq3 family transposase	transposase	NA	NA	NA	NA
WP_157680591.1|1122741_1123083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157680593.1|1123192_1123495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784500.1|1123643_1125215_+|transposase	transposase	transposase	NA	NA	NA	NA
1124380:1124394	attR	GCAAGGGCACGATCC	NA	NA	NA	NA
WP_041656218.1|1125427_1125742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784501.1|1125861_1126434_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_041656220.1|1126603_1126828_+	addiction module protein	NA	NA	NA	NA	NA
WP_008170042.1|1127027_1127783_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.5	4.7e-69
WP_011784502.1|1127794_1129336_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	50.4	1.8e-144
WP_041656222.1|1131013_1131430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756922.1|1131490_1131883_+	VOC family protein	NA	NA	NA	NA	NA
WP_041656223.1|1131981_1132257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784505.1|1132377_1133121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041656225.1|1133236_1133734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784506.1|1134501_1135527_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011784506.1|1136302_1137328_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011784508.1|1137448_1138252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157680595.1|1138355_1138697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041656712.1|1138928_1140452_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.7	8.4e-158
WP_011784510.1|1140466_1141222_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	58.8	5.2e-76
WP_157680597.1|1141261_1141759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756850.1|1141862_1142213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085987361.1|1142311_1143473_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	63.0	9.7e-114
WP_041656226.1|1143565_1144138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011784513.1|1144228_1144615_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_041656717.1|1144710_1145244_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011784516.1|1146177_1147161_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011784517.1|1147276_1148095_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011784518.1|1148246_1148948_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	3.5e-26
WP_011784519.1|1148950_1150417_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011784520.1|1150513_1151707_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011784521.1|1151858_1152545_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_011784522.1|1152606_1153815_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011784523.1|1153842_1156218_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023011106.1|1156222_1156948_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.4e-33
WP_011784525.1|1157106_1157979_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_041656229.1|1157995_1160401_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011784526.1|1160369_1161251_+	universal stress protein	NA	NA	NA	NA	NA
WP_011784527.1|1161278_1163180_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.2	1.0e-104
>prophage 5
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	3490851	3548720	4326849	transposase,integrase,tRNA	Acidithiobacillus_phage(22.22%)	56	3531047:3531066	3554854:3554873
WP_011786592.1|3490851_3492174_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	60.2	1.9e-118
WP_011786593.1|3492677_3494126_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011786594.1|3494334_3495096_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.0e-11
WP_011786595.1|3495111_3496398_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011786596.1|3496403_3497657_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.1	3.9e-100
WP_011786597.1|3497669_3498026_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_011786598.1|3498051_3498594_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011786599.1|3498590_3499049_+	SufE family protein	NA	NA	NA	NA	NA
WP_011786600.1|3499052_3500264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011786601.1|3500319_3500856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011786602.1|3501129_3502251_+	CCA-adding enzyme	NA	A0A292GDU1	Xanthomonas_phage	56.2	5.2e-56
WP_011786603.1|3502264_3503005_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011786604.1|3503130_3504309_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011786605.1|3504308_3504773_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_011786606.1|3504839_3505337_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011786607.1|3505473_3505890_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_041656479.1|3506090_3507638_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011786609.1|3507694_3508795_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2R3ZZL7	Microbacterium_phage	32.6	3.4e-07
WP_011786610.1|3508879_3510286_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	26.2	6.8e-29
WP_011786611.1|3510282_3511101_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011786612.1|3511097_3511871_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011786613.1|3511880_3512618_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011786614.1|3512611_3513253_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011786615.1|3513280_3513874_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011786616.1|3513976_3514438_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011786617.1|3514634_3516860_+	AsmA family protein	NA	NA	NA	NA	NA
WP_011786618.1|3516859_3517924_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_011786619.1|3517988_3518261_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_041656482.1|3518712_3519717_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	38.4	4.0e-55
WP_011783959.1|3520765_3521521_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.0	8.0e-77
WP_036149817.1|3521535_3523059_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	2.4e-160
WP_085987376.1|3523939_3525147_-|transposase	IS3-like element ISMaq2 family transposase	transposase	Q9ZXG3	Shigella_phage	46.1	1.0e-57
WP_041656485.1|3525423_3525963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153741758.1|3525985_3526126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011786624.1|3526893_3528036_+	cobyric acid synthase CobQ	NA	NA	NA	NA	NA
WP_041656487.1|3528028_3530188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141068113.1|3530180_3530687_+	hypothetical protein	NA	NA	NA	NA	NA
3531047:3531066	attL	GAATGTTCGCTTTTGTTTAG	NA	NA	NA	NA
WP_011786627.1|3531508_3533050_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	50.2	3.1e-144
WP_011786628.1|3533061_3533793_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.5	2.1e-69
WP_157680732.1|3533882_3534710_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011786630.1|3534907_3535435_+	YgjV family protein	NA	NA	NA	NA	NA
WP_041656488.1|3535690_3536161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011786631.1|3536798_3538250_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	80.9	1.6e-36
WP_011786632.1|3538252_3539182_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_011786633.1|3539353_3540283_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011786634.1|3540314_3540593_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_041656491.1|3540673_3541057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041657031.1|3541186_3541840_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_011786637.1|3541855_3542557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095209522.1|3543105_3543405_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	47.2	4.8e-17
WP_011786639.1|3543432_3543711_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	50.0	3.4e-09
WP_011786640.1|3544404_3544884_-	YqhA family protein	NA	NA	NA	NA	NA
WP_011785114.1|3544936_3546184_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	44.2	4.1e-86
WP_041656492.1|3546567_3546981_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	39.4	7.9e-18
WP_011786641.1|3547113_3547398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011786642.1|3547751_3548720_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.9	1.2e-53
3554854:3554873	attR	GAATGTTCGCTTTTGTTTAG	NA	NA	NA	NA
>prophage 6
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	3741281	3752533	4326849	protease	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_011786795.1|3741281_3742337_+	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	48.3	2.8e-96
WP_011786796.1|3742655_3743222_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	53.8	7.7e-48
WP_011786797.1|3743228_3743681_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	51.4	2.5e-33
WP_011786798.1|3743899_3747058_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.4	9.2e-66
WP_011786799.1|3747205_3748360_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	3.6e-28
WP_011786800.1|3748383_3749349_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011786801.1|3749335_3749827_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_011786802.1|3749929_3752533_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	39.3	1.5e-29
>prophage 7
NC_008740	Marinobacter hydrocarbonoclasticus VT8, complete sequence	4326849	4074859	4138016	4326849	plate,transposase,protease	Acidithiobacillus_phage(20.0%)	47	NA	NA
WP_011787085.1|4074859_4076311_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011787086.1|4076536_4076977_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011787087.1|4077034_4077436_-	eicosanoid and glutathione metabolism membrane-associated protein	NA	NA	NA	NA	NA
WP_011787088.1|4077437_4077680_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011787089.1|4077751_4078471_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_011787090.1|4078520_4079108_-	class GN sortase	NA	NA	NA	NA	NA
WP_011787091.1|4079104_4081243_-	marine proteobacterial sortase target protein	NA	A0A2K9L1L0	Tupanvirus	20.7	4.5e-16
WP_011787092.1|4081432_4082134_+	proteobacterial dedicated sortase system response regulator	NA	NA	NA	NA	NA
WP_011787093.1|4082137_4084174_+	proteobacterial dedicated sortase system histidine kinase	NA	NA	NA	NA	NA
WP_011787094.1|4084170_4085478_+	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_011787095.1|4085482_4086262_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011787096.1|4086512_4089320_+	transporter substrate-binding domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.5	9.5e-14
WP_011787097.1|4089336_4090308_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.4	5.5e-70
WP_011787098.1|4090384_4090963_-	porin family protein	NA	NA	NA	NA	NA
WP_011787099.1|4091083_4091380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680673.1|4091376_4092288_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011787101.1|4092498_4093098_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_011787102.1|4093099_4093987_-	DNA ligase	NA	F2Y1N0	Organic_Lake_phycodnavirus	34.0	2.2e-25
WP_011787103.1|4094038_4094476_-	YtoQ family protein	NA	NA	NA	NA	NA
WP_011787104.1|4094564_4095884_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011787105.1|4096085_4097495_+	hypothetical protein	NA	A0A2H5BGM4	Vibrio_virus	42.0	2.4e-34
WP_011787106.1|4097554_4102804_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011787107.1|4102893_4104897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787108.1|4104940_4105567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787109.1|4105772_4106177_+	YjfI family protein	NA	NA	NA	NA	NA
WP_011787110.1|4106191_4106890_+	phage shock protein A	NA	NA	NA	NA	NA
WP_011787111.1|4106956_4107289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011787112.1|4107332_4108427_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011787113.1|4108453_4108903_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011786627.1|4109566_4111108_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	50.2	3.1e-144
WP_011786628.1|4111119_4111851_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.5	2.1e-69
WP_157680675.1|4113224_4113905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011784145.1|4114176_4115121_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	57.4	5.7e-96
WP_011787117.1|4115384_4115675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787118.1|4115947_4117114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680677.1|4117118_4117772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787120.1|4117841_4118897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680679.1|4118886_4122933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113879282.1|4122963_4123503_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_041657079.1|4123521_4125645_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	1.5e-32
WP_041656535.1|4125748_4129342_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011787125.1|4129369_4130818_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_157680739.1|4130829_4131432_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_011787127.1|4131461_4133027_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_011787128.1|4133203_4135891_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	8.0e-95
WP_011787129.1|4135856_4136678_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011787130.1|4136681_4138016_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NC_008739	Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence	213290	57760	86181	213290	transposase,integrase	Shigella_phage(25.0%)	21	57732:57791	88150:88900
57732:57791	attL	GAGTTATTGTCAAATCTGGTGTATGAGCATCAGGCGGCGTCTCTGCCGGATTGATCATCC	NA	NA	NA	NA
WP_011783528.1|57760_59014_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.5	8.3e-95
WP_085987415.1|59641_60803_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	62.7	4.4e-114
WP_011783524.1|61079_62012_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_011783523.1|62250_63291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680776.1|63631_64150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011783521.1|64205_65348_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157680777.1|65353_65536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783520.1|65930_66185_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_081432107.1|66534_66822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783519.1|67409_68459_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011783518.1|68661_69705_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011783517.1|69728_69890_-	universal stress protein UspA and related nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011783514.1|72287_75002_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	31.3	5.5e-75
WP_011783513.1|75107_76346_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011783512.1|76531_77242_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_041657489.1|77906_78197_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011783510.1|78193_78538_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.9	1.3e-13
WP_011078029.1|79403_81062_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	5.6e-22
WP_085987383.1|81150_82313_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	63.0	1.5e-114
WP_011600734.1|82650_83211_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	98.4	1.6e-58
WP_011600733.1|83214_86181_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.2	0.0e+00
88150:88900	attR	GGATGATCAATCCGGCAGAGACGCCGCCTGATGCTCATACACCAGATTTGACAATAACTCAATGGGTGCCGGCAAAGGATGAGGCCGAAATCAAAAGGGTATTCGCCGATGTGCGCCAAGTCCGCGGGCAAAGCGAAACTGCGAAAAACATTGCCGATCAGCATCTGTTCTCGACGCTCGTTGAGGTTCATCGTGCCTCCGAAGGCGCACCCTTTACCGGCATCAAGCCTTCCGGACAGATTGATCCGGGTTTAATGGCGGCGGATGCGGCGTTGGAAAACGGGCAAATTGATCGCCTCGTGGCAAATATAACCCGCAAGATCGAGAACGGTATTCGTGAGCGTTATCATGAGGCTCAGCGTGCAAGGGCCATGGCTGATCAAAGCAGCGATAAGGGGCGTGCCTTTGTCGCTGACTACGTCAATTACATTCACTATATAGAGGGCGTGCATGGCGCTGCTGGAGGGCAGGGGCACTAATTCCTATCTTCACGCAGACGCAAAGCAGGCTGACGGCCTGCTTTGCCGTTGTATTCATTTCCAGTTTCGCCTTCGGCTGAATTGGTACCATCATTCTATTAAGGCGCATCAAAAAACATAAATGAAGCCAACACCAATCTCCGCTTCATAATCATTCCGGGATATCGGGCAGCCATATTACTAACTGAGGGGCGTGCTGTGTTTTATCTAATTTCGGTATTTCCGCAATTAGAGAAAAAAATTCCAAGCGCCAGGTATGGAAGGCGTATCAG	NA	NA	NA	NA
>prophage 2
NC_008739	Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence	213290	113910	148983	213290	transposase,integrase	Leptospira_phage(20.0%)	33	121205:121224	149003:149022
WP_011783476.1|113910_115140_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.1	3.2e-06
WP_011783475.1|115136_116105_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011783472.1|118279_118615_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011783471.1|118611_118989_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041657507.1|119056_119431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085987417.1|120098_121185_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	6.9e-45
121205:121224	attL	GTTAAAAATGGGGGGATTAC	NA	NA	NA	NA
WP_157680779.1|121448_122099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157680780.1|122425_122659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041657592.1|122893_123838_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	56.8	1.1e-94
WP_011783466.1|124114_125185_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_011783465.1|125886_127266_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011783464.1|127255_131077_+|integrase	tyrosine-type recombinase/integrase	integrase	F8J2B4	Monodon_slow_growth-associated_virus	32.0	8.1e-16
WP_011783463.1|131069_131705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041656076.1|132282_133011_+	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_011783460.1|133063_134011_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041656601.1|134084_134885_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	2.1e-22
WP_011783458.1|134884_135910_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011783457.1|135974_136466_+	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_049756840.1|136455_137037_+	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_011783455.1|137036_138176_+	carbon-phosphorus lyase complex subunit PhnI	NA	NA	NA	NA	NA
WP_011783454.1|138165_139065_+	alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ	NA	NA	NA	NA	NA
WP_011783453.1|139061_139892_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	22.8	2.1e-09
WP_011783452.1|139903_140665_+	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	27.4	2.0e-11
WP_011783451.1|140661_141810_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_011783450.1|141794_142364_+	phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN	NA	K4JYM5	Abalone_herpesvirus	29.3	6.6e-07
WP_011783449.1|142354_143140_+	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_011783448.1|143136_143985_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011783447.1|144421_144934_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	39.8	1.3e-25
WP_041657514.1|145523_145769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680781.1|145807_146041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157680791.1|146140_146458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011783443.1|146932_147706_+	DsbA family protein	NA	NA	NA	NA	NA
WP_085987419.1|147899_148983_+|transposase	IS3-like element ISMaq1 family transposase	transposase	S5WIU1	Leptospira_phage	39.7	8.9e-45
149003:149022	attR	GTTAAAAATGGGGGGATTAC	NA	NA	NA	NA
