The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	302271	380377	3843301	protease,coat,transposase	Bacillus_phage(23.08%)	58	NA	NA
WP_003512006.1|302271_303219_-|transposase	IS982-like element ISCth1 family transposase	transposase	NA	NA	NA	NA
WP_003518160.1|303360_305769_+	peptidase C11	NA	NA	NA	NA	NA
WP_003512380.1|305802_306993_+	RNA-splicing ligase RtcB	NA	A0A0S2MUF8	Bacillus_phage	60.4	5.2e-139
WP_003512382.1|307067_309608_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_003512384.1|309625_310777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003512386.1|310733_311723_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_003512387.1|311723_313064_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_003512389.1|313067_313691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003518163.1|313875_316014_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_165480303.1|316133_317189_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_003512395.1|317318_318728_+	LytTR family transcriptional regulator	NA	E5ERA2	Bathycoccus_sp._RCC1105_virus	37.0	1.8e-08
WP_003512397.1|318751_319336_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011837788.1|319558_321682_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_003512401.1|321845_322499_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003512405.1|322557_323853_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	42.2	2.9e-82
WP_003512407.1|324118_324490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003512409.1|324590_325016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003512411.1|325266_326388_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003512414.1|326613_328101_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.5	8.0e-12
WP_003512416.1|328213_330250_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003512418.1|330230_331028_-	RNA polymerase sigma-I factor	NA	NA	NA	NA	NA
WP_003512420.1|331570_333004_+	endoglucanase	NA	NA	NA	NA	NA
WP_003518171.1|333150_334605_+	glycoside hydrolase	NA	A0A1X9VNM7	Mimivirus	33.8	1.3e-59
WP_003512422.1|334820_335747_+	type 3a, cellulose-binding protein	NA	NA	NA	NA	NA
WP_003518173.1|335876_337031_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_011837790.1|337172_338777_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.2e-09
WP_003518175.1|339018_340710_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_003518177.1|341279_343715_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_003512427.1|343979_344939_+	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	29.8	2.0e-24
WP_041734449.1|345501_346374_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003512434.1|346370_347066_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003512436.1|347153_347372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003512438.1|347374_347683_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003512440.1|347989_349432_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003512442.1|349656_350604_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
WP_003518182.1|350816_352175_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003512448.1|352375_353584_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003512454.1|353825_355100_+	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	30.6	2.8e-29
WP_011837794.1|355144_358627_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.4	1.3e-28
WP_003512457.1|358783_359893_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_011837795.1|359966_362324_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_011837796.1|362394_363681_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003512463.1|363972_366015_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003512473.1|366399_367620_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_003512474.1|367691_368135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037295399.1|368349_368598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734217.1|368545_368734_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003512475.1|368997_370116_-	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_003519284.1|370826_372302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003512478.1|372381_372765_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_011837797.1|372820_374623_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	1.5e-07
WP_003512482.1|374725_376096_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011837798.1|376195_376813_-|coat	SafA/ExsA family spore coat assembly protein	coat	A0A0E3T7R5	Bacillus_phage	55.0	3.7e-56
WP_011837799.1|376993_377749_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003512488.1|377768_378209_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003512490.1|378254_378449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003512492.1|378535_378982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003511744.1|379306_380377_+|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
>prophage 2
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	720605	793682	3843301	coat,transposase	Enterobacteria_phage(16.67%)	57	NA	NA
WP_011838186.1|720605_721758_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_003512473.1|721918_723139_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_003511744.1|723749_724820_+|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_011837877.1|726132_727284_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_003516481.1|727659_728325_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003516485.1|729767_729968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003512473.1|730555_731776_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_003516489.1|731946_733014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516491.1|733086_733710_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003516493.1|733974_734175_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003516495.1|734177_734945_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003516497.1|735073_736183_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003516498.1|736259_736904_+	sulfur carrier protein ThiS adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003520957.1|736903_737974_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003516504.1|737975_739274_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_003516505.1|739754_740279_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003516507.1|740303_740561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004463247.1|740564_741677_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	43.5	2.2e-22
WP_003516511.1|741756_744093_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	34.8	4.3e-36
WP_004463251.1|744283_745333_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003516515.1|745326_746376_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_003516517.1|746422_747400_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_004463254.1|747662_748730_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011837879.1|748840_750466_+	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	32.2	4.6e-21
WP_004463257.1|750622_752134_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_004463260.1|752449_754186_+	indolepyruvate ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_003516525.1|754188_754764_+	indolepyruvate oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_004463266.1|754873_756175_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_003516528.1|756229_756661_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003516530.1|756694_757993_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	53.3	1.4e-116
WP_003516532.1|758152_758317_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_003516534.1|758313_760479_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003520966.1|760552_760774_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_003516540.1|761094_761487_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003516545.1|761563_762592_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_003516547.1|762636_763443_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_003516549.1|763712_764351_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_003516552.1|765031_769837_+	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_003520969.1|770400_772533_+	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_003516556.1|772746_774159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516558.1|774346_775222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516560.1|775191_776028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516561.1|776049_777495_+	CpaF family protein	NA	NA	NA	NA	NA
WP_003516564.1|777484_778462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516566.1|778455_779340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516568.1|779401_779617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516570.1|779674_780277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516571.1|780295_780781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516573.1|780811_782899_-	DUF5050 domain-containing protein	NA	A0A1V0SBL0	Catovirus	27.2	6.6e-12
WP_004463275.1|783021_783852_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_003516577.1|783987_784236_-	EsaB/YukD family protein	NA	NA	NA	NA	NA
WP_003516579.1|784387_784690_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_003516581.1|784826_789506_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.1	3.6e-50
WP_003516583.1|789711_790914_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_003516585.1|791132_792881_+	dockerin	NA	A0A1X9VNR6	Mimivirus	26.7	6.5e-13
WP_003516586.1|793146_793332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516587.1|793439_793682_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	1289869	1342918	3843301	protease,transposase,integrase,coat	Bacillus_phage(22.22%)	48	1340314:1340331	1347689:1347706
WP_003515715.1|1289869_1290919_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003515717.1|1290924_1291962_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_011837962.1|1291978_1293271_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003515721.1|1293342_1294329_+	GDP-mannose 4,6-dehydratase	NA	M1HHF3	Acanthocystis_turfacea_Chlorella_virus	36.7	1.6e-48
WP_003515723.1|1294406_1294670_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_003515725.1|1294738_1295479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003515727.1|1295750_1296017_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	43.8	2.5e-09
WP_003515729.1|1296182_1296965_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_004463536.1|1297089_1298664_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_003515733.1|1298781_1299459_-	hypothetical protein	NA	A7KV15	Bacillus_phage	40.3	4.6e-31
WP_003515736.1|1299553_1300411_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.7	9.2e-37
WP_003515738.1|1300519_1302439_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	39.5	1.2e-44
WP_003521254.1|1302530_1304957_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	1.8e-90
WP_003515744.1|1305130_1305355_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_003515746.1|1305351_1306125_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_003521255.1|1306275_1307565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837963.1|1307592_1310142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837964.1|1310218_1310740_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_004463543.1|1310785_1312078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003515756.1|1312077_1312629_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011837965.1|1312654_1313221_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_011837966.1|1313330_1313861_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_004463551.1|1314017_1315232_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011837967.1|1315690_1316746_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_003515767.1|1316761_1319125_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_157881697.1|1319450_1319612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837968.1|1320464_1321319_-	permease	NA	NA	NA	NA	NA
WP_003519126.1|1321427_1321829_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	40.0	1.1e-19
WP_041734232.1|1321853_1322909_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_003519130.1|1323044_1323443_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	54.4	1.6e-12
WP_011837971.1|1327371_1329258_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011837972.1|1329263_1330919_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011837973.1|1330911_1333077_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011837974.1|1333073_1333919_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_020458088.1|1334224_1334416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011837975.1|1334483_1335353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837976.1|1335349_1336144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837977.1|1336157_1336532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011837978.1|1336696_1336978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734234.1|1336978_1337158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458076.1|1337352_1337574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837980.1|1337686_1338523_-	DUF1848 domain-containing protein	NA	NA	NA	NA	NA
WP_011837981.1|1338775_1339555_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_020458077.1|1339691_1339949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837982.1|1340012_1340231_-	hypothetical protein	NA	NA	NA	NA	NA
1340314:1340331	attL	ATTTTACAGTTATATTTT	NA	NA	NA	NA
WP_020458078.1|1340387_1340606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837983.1|1340799_1341273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011837984.1|1342012_1342918_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB04	uncultured_Caudovirales_phage	23.9	8.6e-09
1347689:1347706	attR	AAAATATAACTGTAAAAT	NA	NA	NA	NA
>prophage 4
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	1507661	1517084	3843301		Prochlorococcus_phage(28.57%)	8	NA	NA
WP_004463623.1|1507661_1508834_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	43.5	3.2e-16
WP_003517447.1|1508880_1510140_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_004463626.1|1510164_1511709_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.8	2.3e-46
WP_004463628.1|1511772_1512402_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.2	6.8e-21
WP_003517454.1|1512395_1513418_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.1	2.6e-70
WP_004463634.1|1513510_1514977_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.2	7.8e-60
WP_003517457.1|1515027_1515549_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	52.1	5.8e-26
WP_003517459.1|1515686_1517084_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.5	6.5e-48
>prophage 5
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	1938475	2016575	3843301	portal,tail,head,holin,transposase,protease,capsid,terminase,integrase	Erysipelothrix_phage(56.0%)	80	2000661:2000720	2016575:2018022
WP_004400096.1|1938475_1938967_-	hypothetical protein	NA	A0A2K5B2B3	Erysipelothrix_phage	42.3	1.8e-21
WP_004400095.1|1938930_1940499_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	51.7	4.3e-149
WP_004400094.1|1940560_1940779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004400093.1|1940836_1941841_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BV89	unidentified_phage	71.4	5.4e-12
WP_004400092.1|1941837_1942257_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.1	4.6e-50
WP_041734274.1|1942343_1944812_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	68.6	0.0e+00
WP_011838142.1|1944808_1945384_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	52.9	6.2e-53
WP_011838143.1|1945393_1945588_-	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	64.6	6.3e-18
WP_011838144.1|1945598_1948121_-|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	63.1	0.0e+00
WP_011838145.1|1948125_1948899_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	51.6	6.5e-74
WP_011838146.1|1948912_1951201_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	38.5	2.5e-12
WP_004463997.1|1951334_1951607_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004463999.1|1951603_1952008_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_011838147.1|1952056_1952248_-	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	75.6	5.1e-12
WP_011838148.1|1952244_1952628_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	69.6	1.8e-40
WP_011838149.1|1952630_1953227_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	74.2	3.0e-79
WP_004400082.1|1953232_1953577_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	55.9	2.6e-30
WP_004400081.1|1953573_1954005_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	62.9	5.5e-46
WP_004400080.1|1954021_1954357_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	56.0	2.3e-28
WP_004400079.1|1954359_1954668_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	75.5	3.0e-38
WP_004400078.1|1954689_1955892_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	77.9	2.1e-175
WP_004400077.1|1955942_1956671_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.4	8.6e-76
WP_004400076.1|1956609_1957932_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.8	2.0e-187
WP_011838151.1|1958008_1959793_-	AIPR family protein	NA	NA	NA	NA	NA
WP_011838152.1|1961572_1961767_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_011838153.1|1961770_1962238_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_011838154.1|1962299_1963199_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	40.1	5.3e-51
WP_041734278.1|1963340_1963571_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_011838156.1|1963596_1964289_-	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	36.1	1.2e-29
WP_011838157.1|1964405_1965659_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	46.9	2.7e-101
WP_011838158.1|1965664_1966963_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	40.3	8.1e-77
WP_004400063.1|1966937_1967120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838159.1|1967119_1967671_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	67.6	6.9e-70
WP_011838160.1|1967791_1968151_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	62.2	4.9e-40
WP_011838161.1|1968272_1968515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838162.1|1968658_1969657_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	37.1	4.7e-16
WP_034844757.1|1969696_1970107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838164.1|1970345_1970801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838165.1|1970892_1971195_-	VRR-NUC domain-containing protein	NA	I3VYX6	Thermoanaerobacterium_phage	64.0	4.4e-26
WP_011838166.1|1971495_1974051_-	DNA primase	NA	D6R422	Bacillus_phage	39.0	2.2e-49
WP_011838167.1|1974047_1974473_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	61.0	2.9e-47
WP_011838168.1|1974488_1975286_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	50.2	2.2e-69
WP_011838169.1|1975290_1977213_-	bifunctional 3'-5' exonuclease/DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	29.2	5.1e-51
WP_011838170.1|1977270_1978023_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	43.6	1.0e-47
WP_041734282.1|1978144_1978585_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	53.9	1.2e-32
WP_011838173.1|1980281_1982201_-	hypothetical protein	NA	E4ZFJ9	Streptococcus_phage	34.8	3.0e-104
WP_011838174.1|1982359_1982566_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	75.0	1.1e-20
WP_011838186.1|1983045_1984198_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_011838175.1|1984292_1985645_+	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_011838176.1|1985655_1986309_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_003512006.1|1987730_1988678_-|transposase	IS982-like element ISCth1 family transposase	transposase	NA	NA	NA	NA
WP_011838186.1|1988982_1990135_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_011838177.1|1990390_1990819_-	RidA family protein	NA	NA	NA	NA	NA
WP_034839221.1|1990972_1991686_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011838179.1|1991678_1992521_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003512006.1|1992712_1993660_+|transposase	IS982-like element ISCth1 family transposase	transposase	NA	NA	NA	NA
WP_011838180.1|1993827_1994544_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011838181.1|1994545_1995250_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	3.2e-27
WP_148206048.1|1995390_1995627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080514912.1|1995512_1996121_+	recombinase zinc beta ribbon domain-containing protein	NA	A0A2K5B2B2	Erysipelothrix_phage	37.6	2.5e-36
WP_011838183.1|1996121_1996553_+	recombinase	NA	NA	NA	NA	NA
WP_011838184.1|1996539_1998108_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	56.9	4.9e-161
WP_011838185.1|1998189_1998786_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011838186.1|1999177_2000329_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
2000661:2000720	attL	GTATAATGATACCAAAAATTAAGACAGACAAAACAGCCCAAATAAGTTAGAATGGAACTA	NA	NA	NA	NA
WP_011838186.1|2000719_2001871_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_141695943.1|2002396_2002882_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041734284.1|2003275_2003461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838188.1|2003457_2004093_-	Vat family streptogramin A O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	31.4	2.4e-13
WP_011838189.1|2004151_2004883_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	50.8	7.1e-70
WP_011838190.1|2004914_2005760_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	50.4	7.9e-81
WP_080514913.1|2006329_2006545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080514935.1|2006581_2006881_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011838186.1|2007000_2008152_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_011838191.1|2008355_2008961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011838192.1|2009035_2010760_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.7e-45
WP_011838186.1|2010945_2012097_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_011838193.1|2012329_2013310_-	radical SAM protein	NA	NA	NA	NA	NA
WP_011838194.1|2013319_2014165_-	PqqD family protein	NA	NA	NA	NA	NA
WP_011838195.1|2014167_2015160_-	radical SAM protein	NA	NA	NA	NA	NA
WP_011838186.1|2015422_2016575_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
2016575:2018022	attR	TAGTTCCATTCTAACTTATTTGGGCTGTTTTGTCTGTCTTAATTTTTGGTATCATTATACTATTATGTGTACAAACTTTATTTTCCATAATGCCTCCATACTATATTATTATTTCATCTTTATTATCATTGTTGTTAATGCTACTCCGTTACCAACTTCGTTTTCCCTTGTAACTTCATGAGAGAAACCAGCTTCCATAAGTTTATTTTTCCAGTACTCAGTAAATATGCCGTTCTCTCTTATATACGTTCTTATCTTTGTCGGTTCTACAATGGAGTATTCCGGTAATATTTCTGTAGCGAAAATAAACATGTCCCTTAGCCTACTCATTTCACCCTCTTCACATATTATCAAGTTCAGATTGAGTACCTTTGATAAATTATTTCTGTTTATGTCTAGTGCTATCAAAGCAGCAATTTTGCCTTCCTTCTCCATAACTATGTATTCTTCATAAAAATTATATATACTGCTTCTTATGTTTATGTCATTATAACATTCTTGATTTAATATTTGATCGCTCAAAAATATTCTTTTCGACATTTCAAATTCATGCTTGCTATTCATATATTTATTCATAAATTTTATAAGTCTTTTTGTATCTGCCTCTTCGATTAGCTTAATACTGTAAAGTTCATTTATACTTTTATTTTCCAGCATCATATAGGAGTACCTCCGAATTAATTCGATTTTTTAATGAATATTAAAATGATTAAGTTCTTGTAAATACAAGAACTTAACCATTTTCCTATTTTACCAGTATGGATCACACCAAACCCATGCTGCTCCATAAACTACAGCTGCTACTGCACCTGCAATTAGCGCAGCACCTGCAACAGCTAAAACTGCATAGCCCATTTTTATTAAGCTAACAGCATTTGCTGAGCTGCCTGATCCCCCAACTAGTTGAATTGATGGTGATTGATAATTCTGCATTATGTATCCCCCCTTTCCTATTGCTTTAATCAAAAGCTAATGCATAACCTTTGATTAACCCTTAAACTTTGATAATTTCTATAGATAATCTGCATTCCTGAAGATTAAGTTTTCTTTATTTGAATAGTCAAAAGACAACTTAAAAAAAGCAAAATATCATCATAATTAGTGATTATCGGCATAAATAGCCCCTATTAATTACATGAATACTCAAGAACTTGTCCCTTATTTACTGCTTTGATTAATTTTCTATCGGCGGAATTTGAATACAATAGGAATTGCTTTTCTGTACAGTCAATAACCTTGGATAGTGATAATCTGGAACAAGAGTATACCTTATCTCCTAGCCTTACTTCTTCTAAACAACAATATGAAATTTCGTATTCCTCCACAATAGAAGTTTTAATATTTAAAATATTTATCTTATGTCTTTGTTCATTTGTAAAATCCAATTTACTAACTAAGTCGTAAACCTGTAGATTATCATAGATGTTATCTCTATTTTTTAATTTCTT	NA	NA	NA	NA
>prophage 6
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	2025971	2062706	3843301	portal,tail,head,holin,transposase,protease,capsid,terminase	Streptococcus_phage(18.52%)	39	NA	NA
WP_011838206.1|2025971_2026382_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	61.9	1.6e-42
WP_011838207.1|2026398_2028087_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	36.6	1.7e-13
WP_011838208.1|2028098_2029256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838209.1|2029268_2031173_-|tail	phage tail protein	tail	A0A0A7RUI9	Clostridium_phage	40.8	5.8e-47
WP_011838210.1|2031172_2031877_-|tail	phage tail family protein	tail	A0A141E160	Streptococcus_phage	29.0	2.9e-12
WP_011838211.1|2031876_2034156_-|tail	phage tail tape measure protein	tail	M4QNS0	Tetraselmis_viridis_virus	33.3	1.4e-31
WP_011838212.1|2034365_2034689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035381367.1|2034817_2035258_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_080514936.1|2035317_2035566_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011837761.1|2035655_2036768_-|transposase	IS30-like element ISCth2 family transposase	transposase	H7BWC8	unidentified_phage	53.1	2.1e-89
WP_011838214.1|2037022_2037595_-|tail	tail protein	tail	A0A1L2BYA0	Clostridium_phage	57.9	6.1e-53
WP_011838215.1|2037597_2037927_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	46.7	1.5e-16
WP_011838216.1|2037923_2038316_-	HK97 gp10 family phage protein	NA	A0A2H4J368	uncultured_Caudovirales_phage	34.8	3.8e-14
WP_011838217.1|2038308_2038635_-|head	phage head closure protein	head	A0A2H4J220	uncultured_Caudovirales_phage	42.4	1.5e-11
WP_011838218.1|2038631_2039204_-|head,tail	phage head-tail connector protein	head,tail	C7BGH1	Burkholderia_phage	25.9	2.7e-08
WP_127837226.1|2039245_2039689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838220.1|2039698_2040988_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_011838221.1|2041015_2041759_-|protease	Clp protease ClpP	protease	A6M950	Geobacillus_virus	54.3	2.0e-64
WP_011838222.1|2041763_2043023_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	40.2	1.9e-70
WP_167524728.1|2043034_2045632_-|terminase	terminase	terminase	A0A2K5B285	Erysipelothrix_phage	66.7	5.7e-21
WP_011838224.1|2045576_2046059_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	74.3	4.7e-62
WP_041734294.1|2046117_2046333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838225.1|2046325_2047078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838226.1|2047191_2047503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838227.1|2047573_2048053_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_011838228.1|2048197_2049121_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	41.2	1.4e-46
WP_080514914.1|2049220_2050681_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6A7	Streptococcus_phage	53.8	9.6e-143
WP_011838230.1|2050673_2051909_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	66.2	7.8e-162
WP_011838231.1|2051913_2052339_-	hypothetical protein	NA	A0A1B0RXC6	Streptococcus_phage	46.5	4.6e-29
WP_011838232.1|2052751_2053132_-	HNH endonuclease	NA	Q38456	Bacillus_phage	51.3	1.6e-28
WP_020458081.1|2053312_2053558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838233.1|2053626_2054031_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	34.3	1.2e-13
WP_011838234.1|2054032_2054335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838235.1|2054532_2056407_-	DNA primase family protein	NA	H7BVJ4	unidentified_phage	51.6	5.8e-185
WP_041734476.1|2056607_2058296_-	DNA polymerase	NA	A0A2H4J041	uncultured_Caudovirales_phage	55.5	4.7e-186
WP_011838237.1|2058301_2058760_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	51.3	6.9e-39
WP_011838238.1|2058778_2060371_-	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	50.8	1.3e-137
WP_011838239.1|2060292_2060658_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	50.5	1.6e-22
WP_011838241.1|2061941_2062706_-	hypothetical protein	NA	Q4ZCB0	Staphylococcus_virus	42.1	2.7e-48
>prophage 7
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	2224042	2239013	3843301	integrase,transposase	uncultured_virus(33.33%)	14	2216974:2216988	2241928:2241942
2216974:2216988	attL	AAGCATTAAAAATAG	NA	NA	NA	NA
WP_080514916.1|2224042_2225527_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003512622.1|2225682_2226906_-|transposase	IS256-like element ISCth4 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.3e-47
WP_011838280.1|2226952_2227729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838281.1|2227715_2228570_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_014253649.1|2228928_2229120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011838282.1|2229187_2230057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838283.1|2230053_2230848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838284.1|2230861_2231236_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011838186.1|2231418_2232570_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_041734481.1|2232850_2233132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458084.1|2233484_2233712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838286.1|2234191_2236258_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_011838287.1|2236697_2237987_-|transposase	IS110-like element ISCth8 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.9	2.0e-35
WP_041734304.1|2238440_2239013_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
2241928:2241942	attR	CTATTTTTAATGCTT	NA	NA	NA	NA
>prophage 8
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	2356640	2460095	3843301	tRNA,holin,transposase	Enterobacteria_phage(26.67%)	75	NA	NA
WP_011838186.1|2356640_2357792_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_020457675.1|2357995_2358322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003518419.1|2358380_2358626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734319.1|2360354_2361161_-	bifunctional DNA primase/polymerase	NA	A0A2H4UW41	Bodo_saltans_virus	33.9	1.1e-10
WP_003513997.1|2361285_2361423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003513999.1|2361415_2361805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514003.1|2362024_2362267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756136.1|2362282_2362504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457677.1|2362635_2363820_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041734483.1|2364245_2364548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756138.1|2366419_2368579_-	bifunctional DNA primase/polymerase	NA	D6R422	Bacillus_phage	44.2	2.2e-95
WP_003514970.1|2368699_2368837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734321.1|2368829_2369219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514026.1|2369413_2369692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514015.1|2371522_2371870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011838186.1|2373482_2374634_+|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_011837913.1|2375283_2376798_+|transposase	IS21-like element ISCth12 family transposase	transposase	NA	NA	NA	NA
WP_003512270.1|2376791_2377517_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	5.4e-30
WP_003511744.1|2378815_2379886_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_011838186.1|2380862_2382015_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_003515213.1|2382105_2382582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003515210.1|2382627_2382822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457682.1|2383681_2385166_+|transposase	IS21-like element ISCth9 family transposase	transposase	NA	NA	NA	NA
WP_020457683.1|2385165_2385924_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	39.7	2.1e-45
WP_020457684.1|2387413_2387932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514068.1|2388910_2390149_-	DUF1910 domain-containing protein	NA	NA	NA	NA	NA
WP_011838186.1|2391318_2392471_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_003514070.1|2393380_2393764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023062624.1|2394410_2394554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003512473.1|2395007_2396228_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_020457685.1|2396458_2397694_-	DUF1910 domain-containing protein	NA	NA	NA	NA	NA
WP_020457686.1|2397726_2399574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734327.1|2400021_2400828_-	bifunctional DNA primase/polymerase	NA	A0A286QQG9	Streptococcus_phage	26.7	1.6e-14
WP_003519487.1|2400952_2401093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734328.1|2401082_2401472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514026.1|2401666_2401945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158303342.1|2401978_2402119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457688.1|2402348_2403539_-|transposase	IS110-like element ISCth14 family transposase	transposase	NA	NA	NA	NA
WP_003514975.1|2404024_2404582_-	recombinase family protein	NA	NA	NA	NA	NA
WP_003514976.1|2404848_2405199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514061.1|2405947_2406751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457689.1|2406777_2408454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003513861.1|2408633_2409110_-|transposase	IS200/IS605-like element ISCth10 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	38.6	4.1e-18
WP_020457690.1|2409328_2415343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514077.1|2415445_2415760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457691.1|2415756_2417640_-	protein kinase	NA	NA	NA	NA	NA
WP_080514919.1|2418194_2418449_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_037295074.1|2418436_2418715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457693.1|2421510_2423934_-	dockerin	NA	NA	NA	NA	NA
WP_020457694.1|2424457_2428213_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	23.2	9.7e-14
WP_003514090.1|2428241_2431682_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_003514092.1|2431799_2432246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457696.1|2433679_2434282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514095.1|2436336_2436849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457697.1|2436870_2438571_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_003516789.1|2438747_2439275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514921.1|2439316_2440222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003516785.1|2440184_2441024_-	CRISPR-associated RAMP protein	NA	NA	NA	NA	NA
WP_003514102.1|2441016_2441799_-	CRISPR-associated RAMP protein	NA	NA	NA	NA	NA
WP_003514104.1|2441829_2442222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514106.1|2442223_2443471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514108.1|2443455_2444001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514110.1|2444006_2445926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514112.1|2445933_2446875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514114.1|2446981_2448814_-	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_003514117.1|2449202_2449730_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	61.7	1.9e-40
WP_003514120.1|2450390_2451035_-	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_003514124.1|2451336_2452170_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003514126.1|2452320_2452743_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003514128.1|2452929_2454465_+	spore germination protein	NA	NA	NA	NA	NA
WP_020457700.1|2454454_2455576_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_020457701.1|2455559_2456831_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_003514134.1|2456919_2458326_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	7.8e-49
WP_003516780.1|2458312_2459059_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003514136.1|2459687_2460095_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 9
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	2533914	2606886	3843301	protease,transposase	unidentified_phage(25.0%)	57	NA	NA
WP_011838186.1|2533914_2535067_-|transposase	IS3-like element IS120 family transposase	transposase	Q6H9S6	Enterobacteria_phage	30.0	3.1e-19
WP_020457717.1|2535140_2537513_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_003520229.1|2537842_2539585_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_020457718.1|2539644_2542593_+	AbfB domain-containing protein	NA	NA	NA	NA	NA
WP_003516691.1|2542822_2544145_-	DUF4830 domain-containing protein	NA	NA	NA	NA	NA
WP_003514254.1|2544296_2544491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514256.1|2544544_2545732_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003514291.1|2546254_2546854_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003514292.1|2546885_2547227_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_020457719.1|2547343_2548987_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	36.9	4.2e-54
WP_041734346.1|2549982_2550264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734348.1|2550227_2550950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003516880.1|2550951_2551293_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020457720.1|2551538_2553521_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	29.1	8.1e-44
WP_003516878.1|2553635_2554400_-	carbohydrate binding domain-containing protein	NA	NA	NA	NA	NA
WP_003516877.1|2554447_2555737_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003516876.1|2555781_2557128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041734349.1|2557229_2559599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003515176.1|2559647_2560166_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003511744.1|2560521_2561592_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_020457722.1|2561860_2562736_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003516873.1|2562994_2564890_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_003515182.1|2564949_2565228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457723.1|2565281_2565614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457724.1|2567577_2568438_-	carbohydrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020457725.1|2568489_2570883_-	CotH kinase family protein	NA	NA	NA	NA	NA
WP_003515065.1|2571194_2571353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458085.1|2571651_2571774_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_020457726.1|2571865_2572747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457727.1|2572919_2573636_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003515069.1|2573865_2574201_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003515070.1|2574675_2574816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515071.1|2574876_2575035_-	rubredoxin	NA	NA	NA	NA	NA
WP_003516868.1|2575186_2575780_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	45.8	6.0e-19
WP_003516867.1|2576032_2577169_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_003516866.1|2577169_2578312_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_003515075.1|2578457_2580653_-	peptidase M4	NA	NA	NA	NA	NA
WP_003515076.1|2580771_2581593_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003516865.1|2581756_2582866_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_020457728.1|2582902_2585872_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_003516863.1|2586067_2586271_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011837761.1|2586511_2587624_-|transposase	IS30-like element ISCth2 family transposase	transposase	H7BWC8	unidentified_phage	53.1	2.1e-89
WP_020457730.1|2587648_2589610_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003513709.1|2590125_2590794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020457731.1|2591106_2591985_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003513706.1|2592106_2592304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003513703.1|2592429_2592891_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_020457732.1|2593347_2596116_-	pectate lyase	NA	A0A076FFT1	Aureococcus_anophage	33.0	2.2e-18
WP_041734352.1|2596979_2598278_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	43.3	1.1e-73
WP_014522658.1|2598691_2599405_+	hypothetical protein	NA	A0A0U2S5Z2	Escherichia_phage	37.7	6.7e-33
WP_003513693.1|2599445_2602235_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_020457734.1|2602442_2603312_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	4.1e-85
WP_003513688.1|2603533_2604364_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003513685.1|2604433_2604718_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003513683.1|2604783_2605200_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	46.0	1.1e-27
WP_003513680.1|2605209_2605497_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003511744.1|2605815_2606886_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
>prophage 10
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	2931282	2966457	3843301	portal,tail,plate,transposase,capsid,terminase,integrase	Clostridium_phage(21.21%)	53	2931143:2931196	2968318:2968371
2931143:2931196	attL	GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG	NA	NA	NA	NA
WP_020457800.1|2931282_2932395_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.4	2.8e-78
WP_020457801.1|2932452_2932875_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_041734518.1|2932962_2933160_+	hypothetical protein	NA	A0A1J0MFE5	Staphylococcus_phage	61.3	7.8e-16
WP_020457803.1|2933135_2933600_-	DUF4231 domain-containing protein	NA	A0A0S2MYH2	Enterococcus_phage	35.9	2.0e-17
WP_020457804.1|2933629_2934070_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	41.1	4.8e-21
WP_020457805.1|2934085_2934514_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	38.9	3.7e-10
WP_020457806.1|2934641_2934881_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	37.8	1.2e-05
WP_020457807.1|2934899_2935646_+	phage antirepressor KilAC domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	40.8	1.1e-46
WP_041734369.1|2935648_2935867_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020458092.1|2935962_2936175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458093.1|2936161_2936335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458094.1|2936350_2936569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457809.1|2936561_2937113_+	host-nuclease inhibitor Gam family protein	NA	A0A0K2CZ48	Paenibacillus_phage	39.3	1.6e-29
WP_041734523.1|2937128_2938019_+	hypothetical protein	NA	A6M982	Geobacillus_virus	51.5	8.9e-67
WP_148206050.1|2938210_2938396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458096.1|2938385_2938574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457811.1|2938590_2939673_+	hypothetical protein	NA	H7BWC5	unidentified_phage	52.7	2.5e-23
WP_020457812.1|2939669_2940506_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	45.4	2.1e-57
WP_020457813.1|2940507_2940882_+	hypothetical protein	NA	A0A1B1IPD8	uncultured_Mediterranean_phage	44.7	2.4e-13
WP_020457814.1|2940929_2941352_+	DUF1492 domain-containing protein	NA	I3VYX3	Thermoanaerobacterium_phage	31.9	1.9e-11
WP_020457815.1|2941810_2942653_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	51.8	2.9e-75
WP_041734531.1|2942681_2943926_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_020457817.1|2944118_2944964_+	hypothetical protein	NA	A0A0S2MYE5	Enterococcus_phage	43.9	5.7e-47
WP_020458098.1|2945033_2945183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457818.1|2945215_2945665_+|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	60.5	2.2e-37
WP_041734371.1|2945651_2946899_+|terminase	PBSX family phage terminase large subunit	terminase	B6CXD2	Clostridium_phage	52.6	2.1e-122
WP_020457820.1|2946914_2948348_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	46.3	6.8e-117
WP_158303343.1|2948344_2948494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457821.1|2948504_2949914_+|capsid	minor capsid protein	capsid	S6B1L4	Thermus_phage	34.9	3.6e-70
WP_020457822.1|2949910_2950117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037295857.1|2950283_2950847_+	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	32.2	7.5e-11
WP_020457824.1|2950865_2951789_+	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	57.1	7.5e-93
WP_167524727.1|2951801_2951948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734373.1|2951988_2952327_+	bacteriophage QLRG family, DNA packaging	NA	NA	NA	NA	NA
WP_020457826.1|2952323_2952659_+	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	38.1	3.0e-07
WP_020457827.1|2952655_2953066_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_020457828.1|2953055_2953475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011838287.1|2953637_2954927_-|transposase	IS110-like element ISCth8 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.9	2.0e-35
WP_020457829.1|2955378_2956425_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	34.0	1.3e-53
WP_020457830.1|2956445_2956922_+|tail	phage tail tube protein	tail	S5MA61	Brevibacillus_phage	37.3	4.8e-19
WP_020457831.1|2956938_2957352_+|portal	phage portal protein	portal	Q20DC6	Lactobacillus_phage	40.8	5.5e-11
WP_020457832.1|2957544_2959380_+	tape measure protein	NA	S6AVU8	Thermus_phage	36.1	9.4e-71
WP_148206056.1|2959517_2960036_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	44.1	2.8e-28
WP_041734533.1|2960038_2960977_+	hypothetical protein	NA	H7BWD8	unidentified_phage	37.3	3.0e-57
WP_020457835.1|2961203_2961599_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	53.6	5.0e-30
WP_020457836.1|2961598_2962657_+|plate	baseplate J/gp47 family protein	plate	X5JAB8	Clostridium_phage	38.5	4.2e-63
WP_020457837.1|2962646_2963249_+	YmfQ family protein	NA	A0A0K2CNM8	Brevibacillus_phage	33.5	4.1e-15
WP_158303344.1|2963345_2963543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457839.1|2963545_2964928_+	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_020457840.1|2964932_2965253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458100.1|2965253_2965406_+	XkdX family protein	NA	NA	NA	NA	NA
WP_007515979.1|2965494_2965785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734377.1|2965791_2966457_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	46.7	2.8e-33
2968318:2968371	attR	GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG	NA	NA	NA	NA
>prophage 11
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	3204695	3273547	3843301	protease,tRNA,transposase	unidentified_phage(10.0%)	55	NA	NA
WP_003511744.1|3204695_3205766_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_011837761.1|3205862_3206975_+|transposase	IS30-like element ISCth2 family transposase	transposase	H7BWC8	unidentified_phage	53.1	2.1e-89
WP_003515024.1|3207217_3207367_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003515023.1|3207455_3207698_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003515022.1|3207753_3208287_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.9	1.2e-10
WP_003515021.1|3208428_3208854_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003515020.1|3208954_3209650_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003515019.1|3209922_3210459_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003515018.1|3210546_3210936_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_020457900.1|3211434_3215187_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	25.8	1.3e-37
WP_020457901.1|3215204_3218702_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.7	2.7e-66
WP_003514302.1|3218843_3219083_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003514304.1|3219170_3219599_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003514305.1|3219778_3220249_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003515361.1|3220321_3222415_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.9	2.5e-59
WP_020457902.1|3222530_3223733_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.3	4.3e-16
WP_003514311.1|3224038_3224593_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003514312.1|3224589_3225192_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_003514313.1|3225302_3225677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515357.1|3225713_3226553_+	VanW family protein	NA	NA	NA	NA	NA
WP_003514315.1|3226728_3226998_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003515355.1|3227001_3228756_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003514317.1|3228761_3230639_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003514320.1|3230645_3231353_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003514322.1|3231570_3232857_+	trigger factor	NA	NA	NA	NA	NA
WP_003514324.1|3232926_3233511_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.2	1.3e-53
WP_003514326.1|3233524_3234820_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.7	1.9e-150
WP_003514329.1|3235054_3236731_+|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	38.0	1.1e-17
WP_003514331.1|3236942_3237962_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	33.6	1.4e-36
WP_003514333.1|3238675_3239362_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	64.7	1.8e-38
WP_003514336.1|3239578_3239902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003514338.1|3240237_3240708_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_003514339.1|3240767_3241616_+	phosphatase	NA	NA	NA	NA	NA
WP_003514341.1|3241795_3242260_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	55.6	2.6e-41
WP_003514372.1|3242780_3242960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457904.1|3243870_3245376_+|transposase	IS21-like element ISCth15 family transposase	transposase	NA	NA	NA	NA
WP_020457905.1|3245368_3246094_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	42.5	1.2e-37
WP_003515349.1|3247109_3247283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457907.1|3247669_3249001_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	43.8	1.5e-86
WP_003514376.1|3249011_3249224_+	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_003514377.1|3249318_3250035_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_020457908.1|3250073_3250895_+	ADP-ribosylglycohydrolase family protein	NA	A0A1J0FA18	Only_Syngen_Nebraska_virus	26.5	6.0e-09
WP_020457909.1|3251705_3253322_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_003514381.1|3253725_3254604_+	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	31.6	1.2e-31
WP_020457910.1|3255100_3257986_+	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_020457911.1|3258150_3260274_+	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_003514384.1|3260723_3262061_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_020457912.1|3262044_3263097_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_020457913.1|3263551_3265015_+	TROVE domain-containing protein	NA	K4JRQ9	Caulobacter_phage	33.3	2.1e-41
WP_003515337.1|3265026_3266607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023062832.1|3266619_3266859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457915.1|3266984_3268382_+	3' terminal RNA ribose 2'-O-methyltransferase Hen1	NA	NA	NA	NA	NA
WP_020457916.1|3268378_3270991_+	polynucleotide kinase-phosphatase	NA	A0A1V0SJW2	Klosneuvirus	22.2	4.1e-35
WP_003515331.1|3271106_3271808_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_003511763.1|3272257_3273547_+|transposase	IS110-like element ISCth8 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.9	2.0e-35
>prophage 12
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	3324050	3389049	3843301	tRNA,capsid,transposase	Bacillus_phage(28.57%)	51	NA	NA
WP_003515275.1|3324050_3325652_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003512473.1|3325991_3327212_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_003514493.1|3328546_3328972_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_003514496.1|3328987_3330796_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003518813.1|3330829_3335254_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.0	1.7e-17
WP_003514500.1|3335366_3336200_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003514503.1|3336178_3337273_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003514505.1|3337477_3338464_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003514509.1|3339489_3339627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734393.1|3339747_3340554_+	bifunctional DNA primase/polymerase	NA	A0A286QQG9	Streptococcus_phage	26.4	3.9e-13
WP_158303345.1|3340629_3340803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457931.1|3340945_3342793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457932.1|3342815_3344054_+	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_020457933.1|3344803_3345274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457683.1|3346044_3346803_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	39.7	2.1e-45
WP_020457682.1|3346802_3348287_-|transposase	IS21-like element ISCth9 family transposase	transposase	NA	NA	NA	NA
WP_003514015.1|3349681_3350029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515094.1|3351869_3352448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457937.1|3352629_3353019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003514012.1|3353011_3353149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457938.1|3354476_3356318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457939.1|3356344_3357583_+	DUF1910 domain-containing protein	NA	NA	NA	NA	NA
WP_041734397.1|3358086_3358431_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_003515117.1|3361684_3361972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515119.1|3362169_3362559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515128.1|3362548_3362689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756143.1|3362815_3364975_+	bifunctional DNA primase/polymerase	NA	D6R422	Bacillus_phage	43.8	4.9e-95
WP_020457942.1|3365246_3366560_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_037296008.1|3366785_3367121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457943.1|3367448_3368705_+|transposase	IS110-like element ISCth6 family transposase	transposase	NA	NA	NA	NA
WP_158303346.1|3368984_3369125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003515136.1|3369137_3369425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003514509.1|3369929_3370067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734399.1|3370187_3370994_+	bifunctional DNA primase/polymerase	NA	A0A2H4UW41	Bodo_saltans_virus	31.0	2.5e-07
WP_020457944.1|3371389_3373237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457945.1|3373260_3374499_+	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_003515088.1|3374707_3375235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003514981.1|3375247_3375718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734401.1|3377699_3378047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167524725.1|3378189_3378969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167524729.1|3379513_3379900_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_020457947.1|3379901_3380144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457948.1|3380248_3380851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158303347.1|3381064_3382069_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_020458101.1|3382075_3382312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457949.1|3382429_3382819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014254768.1|3382811_3382949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049756144.1|3383069_3385229_+	bifunctional DNA primase/polymerase	NA	D6R422	Bacillus_phage	43.8	5.5e-94
WP_020457951.1|3385499_3386813_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_041734402.1|3387104_3387440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020457953.1|3387792_3389049_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_009012	Hungateiclostridium thermocellum ATCC 27405, complete sequence	3843301	3759641	3828682	3843301	tRNA,transposase	unidentified_phage(42.86%)	48	NA	NA
WP_003511744.1|3759641_3760712_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_011837761.1|3760866_3761979_+|transposase	IS30-like element ISCth2 family transposase	transposase	H7BWC8	unidentified_phage	53.1	2.1e-89
WP_020458045.1|3762303_3763701_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_020458046.1|3763747_3765199_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_049756145.1|3765280_3766360_+|tRNA	tRNA-guanine transglycosylase	tRNA	NA	NA	NA	NA
WP_003511751.1|3766431_3768183_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_003511753.1|3768204_3768627_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003516105.1|3768942_3770430_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041734436.1|3770579_3771281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041734578.1|3771314_3773456_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.4	2.7e-69
WP_003511777.1|3773636_3774857_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003511778.1|3775000_3775630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458050.1|3775853_3776564_+	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_003511783.1|3776836_3777487_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_020458051.1|3777694_3778120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458052.1|3778202_3779564_-	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_003511789.1|3779816_3780371_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_003511791.1|3780375_3780561_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_003511793.1|3780748_3781798_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_020458053.1|3782068_3784711_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	36.3	2.6e-66
WP_020458054.1|3791467_3793309_+	TIGR02556 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_003511798.1|3793308_3794226_+	type I-B CRISPR-associated protein Cas7/Csh2	NA	NA	NA	NA	NA
WP_003511800.1|3794240_3794954_+	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003511802.1|3794967_3797370_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_020458055.1|3797383_3798052_+	CRISPR-associated endonuclease Cas6	NA	NA	NA	NA	NA
WP_004464084.1|3798674_3799898_+|transposase	IS256-like element ISCth4 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.3e-47
WP_020458056.1|3800182_3801253_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	2.1e-54
WP_003511809.1|3802517_3803192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511811.1|3803184_3804786_+	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_003511813.1|3804782_3806114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511815.1|3806120_3806486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511818.1|3806500_3808486_+	TIGR03986 family CRISPR-associated RAMP protein	NA	NA	NA	NA	NA
WP_003511822.1|3808629_3809880_+	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_020458057.1|3810125_3811349_+|transposase	IS256-like element ISCth4 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.7e-47
WP_003511830.1|3816439_3817435_+	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_003511834.1|3817428_3817719_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_003511836.1|3817693_3818308_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_003511839.1|3818366_3818585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003519516.1|3818695_3818836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458059.1|3819664_3820312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458060.1|3820448_3821249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511843.1|3821296_3821794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511844.1|3822303_3823164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003511856.1|3823878_3824391_+	DUF5104 domain-containing protein	NA	NA	NA	NA	NA
WP_003511858.1|3824637_3825426_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020458061.1|3825604_3826408_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003511862.1|3826481_3827282_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003519693.1|3827464_3828682_+|transposase	IS701-like element ISCth16 family transposase	transposase	NA	NA	NA	NA
