The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009049	Rhodobacter sphaeroides ATCC 17029 chromosome 1, complete sequence	3147721	297942	306319	3147721	portal,tail,head,capsid,protease,terminase	Stx2-converting_phage(16.67%)	14	NA	NA
WP_011840285.1|297942_299121_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	26.4	3.7e-20
WP_011840286.1|299110_299506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840287.1|299505_300012_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	44.0	1.4e-21
WP_160147954.1|300020_301169_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	31.8	1.4e-40
WP_011840289.1|301181_301559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840290.1|301561_301921_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	52.5	5.8e-17
WP_011840291.1|301917_302391_+	hypothetical protein	NA	A0A2H4JDL7	uncultured_Caudovirales_phage	30.3	1.4e-10
WP_011840292.1|302395_302824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840293.1|302820_303135_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011840294.1|303134_303548_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002720361.1|303544_303958_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_160147955.1|303954_304281_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_011840296.1|304280_304715_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_011840297.1|304711_306319_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	35.0	8.0e-74
>prophage 2
NC_009049	Rhodobacter sphaeroides ATCC 17029 chromosome 1, complete sequence	3147721	454597	463647	3147721	tRNA	uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_011840358.1|454597_456820_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.3	9.8e-115
WP_009563714.1|456943_457465_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	77.6	4.6e-47
WP_011840359.1|457678_458293_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	45.3	3.8e-24
WP_011840360.1|458416_459709_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	9.5e-94
WP_011840361.1|459815_460373_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_002722646.1|460656_460983_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	54.4	4.3e-19
WP_002722648.1|460998_462663_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011840362.1|462672_463647_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.3	1.0e-52
>prophage 3
NC_009049	Rhodobacter sphaeroides ATCC 17029 chromosome 1, complete sequence	3147721	631162	666036	3147721	portal,tail,head,transposase,capsid,protease,integrase,terminase	Paracoccus_phage(33.33%)	45	630769:630785	667927:667943
630769:630785	attL	CCTCGAGCGCCGCGCGC	NA	NA	NA	NA
WP_043827916.1|631162_631681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517258.1|631814_632021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037087394.1|632298_632751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840470.1|633113_633344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840471.1|633616_633934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011840472.1|635013_635415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840473.1|635407_636598_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_160147961.1|637254_638001_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_160147962.1|638215_638527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840476.1|639255_640191_-	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_011840477.1|640204_642115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160147988.1|642107_642539_-	collagen-like protein	NA	NA	NA	NA	NA
WP_011840479.1|642772_643204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043827922.1|643339_643567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043827923.1|643563_643761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840480.1|643762_644392_-	lysozyme	NA	F8TV87	EBPR_siphovirus	51.0	5.7e-36
WP_160147963.1|644453_644732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840482.1|644766_645222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840483.1|645218_645578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049763372.1|646086_649758_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	36.7	5.4e-94
WP_011840486.1|649852_650266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840487.1|650262_650877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840488.1|650873_651479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840489.1|651479_653555_-	hypothetical protein	NA	A0A0U4JEA4	Pseudomonas_phage	52.9	3.0e-49
WP_043827929.1|653876_654215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840492.1|654214_654643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840493.1|654632_655025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043827932.1|655024_655204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840494.1|655207_655672_-	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	42.5	4.1e-23
WP_011840495.1|655668_655992_-|head,tail	head-tail adaptor protein	head,tail	A0A0U2BXJ0	Paracoccus_phage	52.9	1.2e-21
WP_011840496.1|655991_656528_-	hypothetical protein	NA	I3UM02	Rhodobacter_phage	28.9	1.6e-07
WP_160147964.1|656524_656695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011840497.1|656749_657961_-|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	66.7	4.8e-140
WP_011840498.1|657985_658834_-|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	58.2	8.5e-75
WP_011840499.1|658830_660036_-|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	37.3	1.1e-70
WP_043827935.1|660035_661835_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	58.8	4.0e-191
WP_011840501.1|661791_662277_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	45.0	3.2e-26
WP_011840502.1|662364_662586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840503.1|662632_662851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840504.1|662919_663087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840505.1|663083_663275_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011840506.1|663271_663949_+	hypothetical protein	NA	A0A142KC03	Gordonia_phage	37.5	4.6e-23
WP_160147989.1|663945_664137_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	57.6	2.2e-07
WP_080517330.1|664136_665513_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	48.4	3.4e-105
WP_080517260.1|665673_666036_-	HNH endonuclease	NA	A0A0U2C119	Paracoccus_phage	58.2	3.5e-22
667927:667943	attR	GCGCGCGGCGCTCGAGG	NA	NA	NA	NA
>prophage 4
NC_009049	Rhodobacter sphaeroides ATCC 17029 chromosome 1, complete sequence	3147721	1116608	1187240	3147721	portal,tail,head,protease,capsid	Paracoccus_phage(23.53%)	62	NA	NA
WP_002719573.1|1116608_1117334_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_011840790.1|1117323_1118277_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002719575.1|1118273_1118558_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_037086838.1|1118666_1119206_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002719578.1|1122110_1122407_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002719579.1|1122461_1122800_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_002719580.1|1123079_1123589_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_011840793.1|1123777_1124527_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011840794.1|1124608_1125625_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002719583.1|1125680_1127549_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011840795.1|1127723_1130600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002719585.1|1130763_1131456_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011840796.1|1131501_1132794_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011840797.1|1133039_1133387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002719588.1|1133383_1133770_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.1	2.6e-07
WP_011840799.1|1133747_1134665_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_011337487.1|1134661_1135120_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011840800.1|1135121_1137182_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002719592.1|1137189_1137558_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	35.3	1.7e-11
WP_011337490.1|1137548_1137833_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_160476486.1|1137829_1138252_-	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_011840802.1|1138486_1140865_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.7	6.0e-09
WP_011840803.1|1140971_1142759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337494.1|1142862_1144545_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.4	3.9e-07
WP_002719598.1|1144633_1145002_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	38.5	1.5e-12
WP_011337495.1|1144998_1145328_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_049763387.1|1145660_1147613_+	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_011840806.1|1147609_1150918_+	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011840807.1|1150914_1153101_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011840808.1|1153097_1155164_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011840809.1|1155160_1156939_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011840810.1|1156935_1158753_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011840811.1|1158749_1161365_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011840812.1|1161423_1162089_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011840813.1|1162209_1163673_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.0	8.9e-48
WP_002719609.1|1163757_1164372_-	CvpA family protein	NA	NA	NA	NA	NA
WP_011840814.1|1164390_1165749_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011840815.1|1165921_1166347_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_002719612.1|1166347_1167094_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	8.7e-07
WP_002719613.1|1167090_1167873_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009564494.1|1167869_1168919_-	alanine racemase	NA	NA	NA	NA	NA
WP_011840816.1|1169147_1169885_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_002719616.1|1170063_1170297_+	acyl carrier protein	NA	I1TR04	Pseudomonas_phage	43.9	7.3e-05
WP_011840817.1|1170793_1172056_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011840818.1|1172055_1173234_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011840819.1|1173305_1173749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043828264.1|1173741_1175040_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.7	1.3e-71
WP_011840820.1|1175112_1176285_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.4	1.5e-58
WP_002719622.1|1176286_1176520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002719623.1|1176530_1177088_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	49.3	1.1e-30
WP_043828013.1|1177153_1178350_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.9	3.0e-62
WP_011840823.1|1178444_1179044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011840824.1|1179043_1179379_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011840825.1|1179375_1179774_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011840826.1|1179811_1180225_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002719629.1|1180224_1180542_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_011840827.1|1180543_1180744_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_011840828.1|1180736_1181387_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	29.3	6.0e-12
WP_011840829.1|1181396_1182029_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	51.9	6.1e-62
WP_011840830.1|1182028_1182913_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	43.3	1.2e-60
WP_011840831.1|1182909_1183350_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.0e-27
WP_011840832.1|1183349_1187240_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	39.4	1.1e-222
>prophage 5
NC_009049	Rhodobacter sphaeroides ATCC 17029 chromosome 1, complete sequence	3147721	2117281	2152241	3147721	transposase,protease,integrase	Burkholderia_phage(25.0%)	37	2132997:2133013	2162626:2162642
WP_043828108.1|2117281_2118763_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	1.1e-26
WP_011841371.1|2118915_2119938_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_009565600.1|2119937_2121119_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011841372.1|2121174_2122533_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_011841373.1|2122537_2123326_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011841375.1|2123970_2125350_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011841376.1|2125718_2126642_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011841377.1|2126583_2127282_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_043828110.1|2127423_2128311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011841379.1|2128317_2128560_-	DUF2842 domain-containing protein	NA	NA	NA	NA	NA
WP_011841380.1|2128639_2129932_-	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	31.6	2.1e-53
WP_015920909.1|2129947_2130178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011841381.1|2130242_2130854_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002720532.1|2131016_2132660_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.6	7.4e-152
WP_011841382.1|2132838_2133621_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
2132997:2133013	attL	CGAGGCGGTGAAGACCG	NA	NA	NA	NA
WP_011841383.1|2133698_2134136_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_011338188.1|2134299_2135097_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.1e-28
WP_002720536.1|2135139_2135865_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002720537.1|2135904_2136786_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011841384.1|2136782_2137610_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002720539.1|2137614_2138952_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011841385.1|2139011_2139689_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011841386.1|2139804_2140068_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	52.9	1.1e-17
WP_080517306.1|2140137_2140290_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_080517338.1|2140291_2140618_-	HNH endonuclease	NA	A0A291AY26	Shigella_phage	51.6	3.3e-19
WP_011841388.1|2140599_2141421_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011841389.1|2141417_2141735_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160147979.1|2141619_2141847_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_162470176.1|2141768_2141981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160147980.1|2142048_2142933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011841390.1|2144900_2145833_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_160147981.1|2146198_2146657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160147982.1|2146680_2146887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011841391.1|2147150_2147708_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.2	7.8e-29
WP_160147983.1|2148026_2148893_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_011841393.1|2148889_2151025_+	helicase domain-containing protein	NA	NA	NA	NA	NA
WP_011841394.1|2151143_2152241_-|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	43.8	3.5e-81
2162626:2162642	attR	CGAGGCGGTGAAGACCG	NA	NA	NA	NA
>prophage 1
NC_009050	Rhodobacter sphaeroides ATCC 17029 chromosome 2, complete sequence	1219053	223158	278189	1219053	integrase,transposase	Mannheimia_phage(25.0%)	36	232651:232668	283611:283628
WP_011841288.1|223158_224205_+|transposase	IS481-like element ISRhsp3 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	38.7	6.8e-58
WP_011842159.1|224188_224383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011842160.1|224762_225797_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_160147995.1|225789_226335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842162.1|226415_228542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002720344.1|228666_229713_-|transposase	IS481-like element ISRhsp3 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	38.7	6.8e-58
WP_043828431.1|229954_232825_-	DUF3427 domain-containing protein	NA	A0A2I5ARD8	Synechococcus_phage	34.8	9.3e-41
232651:232668	attL	CGTGCTCGATCGCGAGGT	NA	NA	NA	NA
WP_043828595.1|233479_233866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842165.1|233972_235844_+	TniQ family protein	NA	NA	NA	NA	NA
WP_011842166.1|237742_238093_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.3	2.7e-27
WP_011842167.1|238089_238497_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_043828597.1|238715_240041_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_011842169.1|240037_242017_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011842170.1|242520_244353_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011842171.1|244613_245642_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011842172.1|246233_252605_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_043828433.1|253004_253340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043828435.1|253792_254581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842175.1|255004_256669_-	ATP-binding domain-containing protein	NA	A0A068EQC7	Bacillus_phage	23.3	8.7e-07
WP_043828437.1|256782_258030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842177.1|258039_259779_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_011842178.1|261365_262058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842179.1|262054_264403_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011842180.1|264579_265005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002724415.1|265077_265458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842182.1|265994_266948_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011842183.1|266944_269287_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_011842185.1|270596_271697_-	AAA family ATPase	NA	A0A0N9R2V4	Chrysochromulina_ericina_virus	27.5	8.3e-06
WP_049763404.1|271781_271967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049763405.1|272044_272233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043828439.1|272524_272704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080517353.1|272920_273907_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011842189.1|273862_275152_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	28.3	6.3e-21
WP_011842190.1|275148_275676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080517354.1|275901_276525_+	RNA ligase family protein	NA	A0A292GKV8	Xanthomonas_phage	45.8	1.3e-45
WP_011842192.1|276806_278189_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
283611:283628	attR	CGTGCTCGATCGCGAGGT	NA	NA	NA	NA
>prophage 2
NC_009050	Rhodobacter sphaeroides ATCC 17029 chromosome 2, complete sequence	1219053	340289	433903	1219053	tail,portal,head,capsid,terminase,protease,tRNA,integrase	Paracoccus_phage(10.42%)	110	336602:336621	408594:408613
336602:336621	attL	GGTGTCGTCGCCGAGCGCCT	NA	NA	NA	NA
WP_011842230.1|340289_341015_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002724556.1|341280_341817_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_002724558.1|341946_343113_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	50.4	5.2e-99
WP_011842231.1|343201_344689_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_011842232.1|344856_345804_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011339443.1|345843_346347_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011339444.1|346330_347371_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	7.3e-44
WP_011842233.1|347513_348824_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_043828454.1|348995_349682_-	arylesterase	NA	NA	NA	NA	NA
WP_009564266.1|349680_350370_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.1	1.1e-29
WP_011842235.1|350366_352874_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002724575.1|352938_353292_+	hypothetical protein	NA	H2BCR0	Synechococcus_phage	46.3	1.5e-12
WP_011842236.1|353613_354666_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_011842237.1|354666_355767_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011842238.1|355854_357153_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011842239.1|357252_359280_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_049763407.1|359388_360510_-|integrase	tyrosine-type recombinase/integrase	integrase	F8TUV0	EBPR_podovirus	53.8	2.4e-101
WP_011842241.1|360651_360906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842242.1|360902_361664_-	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	52.5	8.1e-61
WP_011842243.1|361660_362320_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	70.0	3.2e-90
WP_043828455.1|362312_362495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043828456.1|362494_362749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842245.1|362741_363002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043828459.1|363232_363496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842247.1|363763_364027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160147998.1|364266_365118_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_011842249.1|365137_365464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842250.1|365576_365909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160147999.1|365905_366064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160148000.1|366319_366688_-	helix-turn-helix domain-containing protein	NA	G8DH86	Emiliania_huxleyi_virus	46.1	5.7e-20
WP_011842251.1|367131_367392_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	52.2	1.0e-07
WP_011842252.1|367388_367640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842253.1|367782_368301_+	DUF1937 family protein	NA	I3UM60	Rhodobacter_phage	41.8	4.6e-23
WP_011842254.1|368297_368765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842255.1|368761_369055_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011842256.1|369044_369689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842257.1|369897_370482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842258.1|370478_371141_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	41.2	9.0e-40
WP_011842259.1|371247_372147_+	AAA family ATPase	NA	I3ULZ4	Rhodobacter_phage	56.1	7.9e-31
WP_011842260.1|372189_372666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842261.1|372667_374377_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	45.2	3.3e-134
WP_011842262.1|374376_375627_+|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.3	7.5e-80
WP_011842263.1|375623_376463_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	58.1	2.4e-69
WP_011842264.1|376475_377777_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	42.9	7.9e-80
WP_011842265.1|377847_378258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337205.1|378254_378596_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011842266.1|378592_378928_+|head	phage head closure protein	head	A0A0U2BXJ0	Paracoccus_phage	53.2	2.3e-23
WP_011842267.1|379042_379603_+	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	37.5	5.9e-16
WP_160148001.1|379754_379931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842269.1|379934_380315_+	DUF3168 domain-containing protein	NA	A0A0U2BX31	Paracoccus_phage	54.8	2.4e-29
WP_011842270.1|380324_380768_+	hypothetical protein	NA	A0A2P1N076	Streptomyces_phage	33.0	4.3e-06
WP_011842271.1|380764_381145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842272.1|381219_381465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043828462.1|381461_381773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842273.1|381826_386725_+	hypothetical protein	NA	A0A0H4ADF4	Pseudoalteromonas_phage	39.1	1.9e-46
WP_011842274.1|386724_387615_+	hypothetical protein	NA	A0A2H4J8C7	uncultured_Caudovirales_phage	32.5	4.0e-27
WP_011842275.1|387631_389116_+	hypothetical protein	NA	A0A1S5R1J5	Pseudomonas_phage	28.9	7.7e-15
WP_011842276.1|389122_389440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842277.1|389443_389782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160148010.1|389784_390147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842279.1|390149_390602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842280.1|390605_390959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842281.1|391025_391826_+	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	51.3	2.3e-66
WP_011842282.1|391838_392336_+	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	56.0	4.6e-12
WP_011842283.1|392480_392825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842285.1|393295_395206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842286.1|395219_396110_+	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_011842287.1|396171_396567_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_080517396.1|396618_396801_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_043828464.1|397064_398159_-|integrase	tyrosine-type recombinase/integrase	integrase	F8TUV0	EBPR_podovirus	55.2	3.1e-106
WP_012641281.1|398130_398331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043828466.1|398327_398705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842290.1|398701_400513_-	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	38.6	2.8e-91
WP_011842291.1|400637_401033_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	60.6	5.4e-24
WP_011842292.1|401032_401365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842293.1|401361_401559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002719229.1|401897_402245_-	helix-turn-helix transcriptional regulator	NA	A0A0U4B0B5	Bacillus_phage	50.9	6.9e-07
WP_080517362.1|402339_402576_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002719227.1|402656_402914_+	hypothetical protein	NA	A0A1X9HW32	Ruegeria_phage	44.0	1.7e-07
WP_043828467.1|402910_403159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043828469.1|403155_403707_+	DUF1937 family protein	NA	H6WBR3	Rhodobacter_phage	40.3	2.3e-20
WP_043828470.1|403746_404403_+	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	39.2	1.1e-05
WP_043828472.1|404595_405180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842297.1|405176_405839_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	41.5	1.2e-36
WP_011842298.1|405930_406647_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	30.9	8.0e-18
WP_043828474.1|406775_407432_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_011842300.1|407431_409594_+|terminase	phage terminase large subunit family protein	terminase	A0A291AUS9	Sinorhizobium_phage	35.4	1.6e-101
408594:408613	attR	AGGCGCTCGGCGACGACACC	NA	NA	NA	NA
WP_002723266.1|409590_409800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842301.1|409799_411290_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	68.3	1.4e-178
WP_011842302.1|411286_412642_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	47.3	2.0e-57
WP_011842303.1|412774_413164_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	45.7	2.1e-20
WP_002723262.1|413244_414267_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	55.7	9.5e-105
WP_011842304.1|414277_414604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842305.1|414600_415023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842306.1|415133_415604_+	hypothetical protein	NA	M4QQ74	Salicola_phage	39.5	9.0e-18
WP_011842307.1|415705_416146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842308.1|416208_416571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842309.1|416619_421794_+	hypothetical protein	NA	F1C5E9	Cronobacter_phage	25.4	2.2e-08
WP_011842310.1|421793_422684_+	hypothetical protein	NA	A0A2H4J8C7	uncultured_Caudovirales_phage	30.3	9.0e-27
WP_011842311.1|422699_424184_+	hypothetical protein	NA	A0A1S5R1J5	Pseudomonas_phage	28.9	8.5e-14
WP_011842312.1|424190_424508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842313.1|424511_424847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011842314.1|425079_425397_+	hypothetical protein	NA	I3UM16	Rhodobacter_phage	58.9	4.8e-23
WP_011842315.1|425595_425973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160148002.1|426230_426710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842317.1|427064_427871_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	57.8	2.1e-83
WP_011842318.1|427925_428735_+	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	50.6	1.3e-64
WP_011842319.1|428747_429230_+	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	52.4	2.9e-11
WP_011842320.1|429479_430289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011842321.1|430291_433903_-	DEAD/DEAH box helicase	NA	A0A0N9R1K5	Chrysochromulina_ericina_virus	29.9	5.5e-06
>prophage 1
NC_009040	Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence	122606	11117	21511	122606		Enterobacteria_phage(42.86%)	10	NA	NA
WP_002724637.1|11117_11954_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.1	6.0e-49
WP_011836184.1|12155_12881_+	sulfotransferase	NA	NA	NA	NA	NA
WP_011840030.1|13247_14030_+	sulfotransferase	NA	NA	NA	NA	NA
WP_002724812.1|14004_14895_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	54.9	7.7e-87
WP_011840031.1|14891_15743_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.1	9.8e-31
WP_002724808.1|15739_16780_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.8	2.7e-91
WP_011840032.1|16783_17347_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	43.5	1.0e-31
WP_002724804.1|17410_18349_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002724803.1|18400_19363_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.1	1.3e-58
WP_011840033.1|20056_21511_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	26.6	2.2e-06
