The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	980219	987533	4827641	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201748.1|980219_981338_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
WP_000125893.1|981334_983281_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|983410_983632_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|983955_984276_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|984306_986583_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|986796_986994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670446.1|987155_987533_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
>prophage 2
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	1037884	1178564	4827641	tRNA,lysis,terminase,capsid,tail,portal,plate,holin,protease,integrase	Salmonella_phage(50.98%)	159	1135821:1135880	1177687:1177764
WP_001154027.1|1037884_1038688_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1038680_1040003_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|1039983_1040688_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|1040687_1045154_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925875.1|1045498_1047346_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1047605_1048154_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1048181_1048829_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1048890_1050081_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|1050265_1051357_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117870.1|1051963_1053364_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762343.1|1053564_1054026_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544853.1|1054342_1055557_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893197.1|1055802_1057236_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191406.1|1057316_1058519_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1058713_1060006_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1060050_1060299_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1060339_1060579_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1060621_1061779_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1061741_1064627_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1064753_1065053_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1065074_1065233_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1065225_1065486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1065535_1065946_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1066065_1066305_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1066270_1066645_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1066729_1067713_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1067715_1068465_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1068475_1068823_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1068819_1069131_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1069208_1069499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1069790_1070024_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1070135_1070357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1070439_1071042_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1071250_1071862_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1071858_1072005_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1071994_1072792_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1072858_1073176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1073349_1073475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1073610_1074060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1074420_1075107_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1075382_1075712_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1075695_1076148_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1076165_1076645_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1076852_1077386_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1077342_1079481_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1079477_1079684_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1079680_1081228_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1081151_1083233_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1083323_1083647_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1083639_1083939_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1083919_1084486_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1084482_1084884_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1084895_1085645_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1085690_1086089_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1086085_1086415_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1086494_1089482_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1089478_1089811_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1089909_1090407_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1090523_1091057_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1091146_1091842_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1091851_1092589_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1092486_1093191_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|1093262_1096613_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1096651_1096894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1096947_1099386_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1099385_1099967_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1100442_1101411_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1102058_1102685_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1102753_1103053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1103037_1103724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1103994_1104186_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193770.1|1104612_1107225_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|1107432_1108443_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001670452.1|1108608_1109151_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224072.1|1109147_1110257_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1110355_1112464_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1112476_1114384_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1114398_1115652_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1115656_1117297_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1117293_1117857_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1118112_1118280_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1118379_1118898_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|1118966_1120727_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1120912_1121365_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|1121436_1122489_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1122845_1123355_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1123571_1124177_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|1124163_1126317_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1126335_1126782_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420513.1|1126905_1128960_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_000424187.1|1128995_1129454_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|1129548_1130211_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1130384_1130798_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1130842_1131160_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140482.1|1131217_1132429_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859429.1|1132643_1133192_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|1133217_1133997_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1134045_1134327_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1134323_1134653_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1134739_1135399_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
1135821:1135880	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_000533596.1|1135986_1137006_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000196402.1|1137006_1137231_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000916251.1|1137443_1137626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205292.1|1137628_1138183_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000158391.1|1138179_1140444_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_001192832.1|1140473_1140719_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000387662.1|1140726_1141050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972394.1|1141734_1142190_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_001643782.1|1142595_1143042_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001195066.1|1143064_1143289_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_000063056.1|1143291_1144272_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_000074839.1|1144268_1145657_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000130738.1|1145694_1146375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918617.1|1146378_1146627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037052.1|1146619_1147222_+	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000180135.1|1147218_1147389_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001129735.1|1147388_1147727_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000474096.1|1147910_1148102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090037.1|1148170_1148767_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000717784.1|1148763_1149057_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000640103.1|1149053_1149632_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000658037.1|1150024_1150213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1150415_1150718_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000951228.1|1150695_1151235_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_086374239.1|1151552_1152008_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_001118126.1|1152508_1153138_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_001130808.1|1153140_1154763_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_000113503.1|1154762_1156232_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_137911068.1|1156116_1156863_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000873181.1|1156866_1158099_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_000128057.1|1158103_1158601_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627463.1|1158612_1159554_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_001040693.1|1159595_1159985_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_001125672.1|1159950_1160358_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_000008738.1|1160354_1160909_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001121925.1|1160895_1161285_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_001670724.1|1161259_1161823_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001135539.1|1161826_1162972_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_000535992.1|1162984_1163428_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_000389049.1|1163431_1163884_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000990866.1|1164061_1166071_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000353826.1|1166070_1166646_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000155111.1|1166645_1166948_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000081749.1|1166950_1168018_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000819157.1|1168014_1168347_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000931859.1|1168430_1168886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000301078.1|1169004_1169757_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_001270641.1|1169756_1170110_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_001197089.1|1170110_1171310_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_000049939.1|1171306_1171987_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001670454.1|1171986_1173519_+	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000421108.1|1173533_1174052_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_071786695.1|1174300_1174486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370530.1|1174548_1175157_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_000033280.1|1175266_1175659_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_127913510.1|1175856_1176102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|1176284_1176482_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_000503667.1|1176524_1177172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938182.1|1177883_1178564_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
1177687:1177764	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
>prophage 3
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	2078582	2085833	4827641		Morganella_phage(33.33%)	8	NA	NA
WP_001157313.1|2078582_2080013_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377036.1|2080086_2080782_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_000107431.1|2080861_2081173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|2081822_2083019_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2083276_2083465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2083475_2083688_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|2084142_2085411_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394197.1|2085413_2085833_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 4
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	2183704	2192871	4827641		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565902.1|2183704_2184784_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2184788_2185562_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|2185577_2186552_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2186557_2187109_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2187109_2187988_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|2188035_2188935_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|2188934_2190020_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|2190396_2191290_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|2191467_2192871_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 5
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	2260962	2270133	4827641	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2260962_2262996_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2263236_2263695_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2263866_2264397_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2264453_2264921_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2264967_2265687_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2265683_2267369_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2267591_2268323_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2268382_2268490_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2268470_2269202_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2269185_2270133_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 6
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	2683634	2879519	4827641	tRNA,lysis,terminase,capsid,tail,portal,plate,holin,protease,head,transposase,integrase	Cronobacter_phage(27.36%)	189	2708179:2708195	2883629:2883644
WP_000940030.1|2683634_2684366_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553474.1|2684484_2685288_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174939.1|2685432_2686311_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
WP_000985200.1|2686492_2687536_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2687539_2688358_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2688368_2689382_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111025.1|2689382_2690369_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2690359_2690998_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982964.1|2691123_2692401_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2692395_2693535_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2693730_2694984_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2695308_2696499_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2696680_2698225_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2698585_2699917_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2699999_2702144_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2702199_2703660_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2703708_2704047_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2704123_2705461_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|2705457_2706222_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2706223_2707654_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2708179:2708195	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970062.1|2708303_2712191_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
2708179:2708195	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_001667158.1|2712215_2712446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2712446_2713991_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134572.1|2714041_2714593_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2714617_2715253_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2715256_2716618_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2716628_2717522_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995694.1|2717637_2718486_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684023.1|2718524_2719442_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276364.1|2719463_2720660_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022472.1|2720775_2721702_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001196291.1|2721739_2722000_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986042.1|2722111_2722492_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2722491_2723223_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2723234_2723963_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2723974_2724880_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2724876_2725557_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2725830_2726805_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2726821_2728621_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2729025_2730519_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2731003_2731141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526383.1|2731853_2731973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|2732725_2732938_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2733044_2733272_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000143154.1|2733368_2733947_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2733936_2734761_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2734757_2737130_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2737183_2737426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2737464_2740827_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2740888_2741536_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2741433_2742171_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2742177_2742876_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2742885_2743215_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2743217_2746313_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2746284_2746623_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2746619_2747015_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2747065_2747812_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2747819_2748221_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2748329_2749460_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2749508_2750087_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2750114_2750498_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2750508_2750868_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2750925_2751954_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2752008_2752356_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2752368_2753865_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2753854_2755435_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2755431_2755635_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2755618_2757550_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2757521_2758067_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2758353_2758755_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001533543.1|2758990_2759443_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2759460_2759913_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2759896_2760226_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2760501_2761188_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2761402_2761591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2762097_2762661_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2762933_2763611_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2763607_2763748_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096562.1|2763744_2764356_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000929791.1|2764564_2765167_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2765201_2765450_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2765566_2765800_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2766042_2766675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2766782_2767481_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2767494_2768190_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2768186_2769071_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2769162_2769537_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2769496_2769739_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2769838_2770234_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2770292_2771132_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2771124_2771511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2771510_2772173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2772629_2772788_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2772809_2773160_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017128.1|2773286_2776214_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_077248255.1|2776176_2777334_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2777376_2777616_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2777656_2777941_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007934.1|2777918_2779148_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_000589050.1|2779645_2780125_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2780121_2781078_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2781077_2781728_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2781759_2782335_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2782331_2782496_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989165.1|2782759_2784382_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083342.1|2784366_2785104_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2785233_2786568_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001670786.1|2786585_2787485_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2787587_2788175_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2788236_2788620_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2788938_2789628_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997365.1|2789743_2790781_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2790984_2791404_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183641.1|2791476_2792157_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082646.1|2792210_2794871_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2794985_2796341_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264478.1|2796385_2796709_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807818.1|2796705_2798007_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_000985653.1|2798110_2798566_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2804640_2807214_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
2798685:2798701	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000992639.1|2807343_2808075_-	polyphenol oxidase	NA	NA	NA	NA	NA
2798685:2798701	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000079130.1|2808071_2809052_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2809183_2809921_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2810192_2810531_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2810634_2810682_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200080.1|2810781_2811942_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000632386.1|2811902_2812811_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225194.1|2812868_2813990_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2813999_2815070_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212380.1|2815509_2816028_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2816020_2817241_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2817397_2817745_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2817785_2818553_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2818597_2819146_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2819164_2819413_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2819665_2821027_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2821192_2821984_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2822003_2823290_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001294020.1|2823410_2824016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2824050_2824641_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2824763_2825642_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2825727_2827389_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2827537_2827876_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2828041_2828332_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2828321_2828798_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2828947_2829430_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237676.1|2830043_2841209_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533874.1|2841273_2842683_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196147.1|2842679_2844860_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000342601.1|2844867_2846031_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001177838.1|2846546_2846795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|2848420_2849539_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000977536.1|2850219_2851923_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
WP_000200789.1|2851922_2852468_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267955.1|2852439_2853165_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
WP_000861354.1|2853154_2853709_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.5	9.4e-91
WP_000084299.1|2853721_2855827_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
WP_001001823.1|2855836_2856424_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000136921.1|2856416_2857601_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|2857597_2857927_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811087.1|2857923_2859894_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
WP_000411339.1|2860081_2860339_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376370.1|2860485_2860818_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|2860817_2861159_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|2861155_2861449_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|2861458_2861914_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|2861910_2863038_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560083.1|2863034_2863742_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000084220.1|2863738_2864245_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001628758.1|2864241_2864694_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	3.6e-64
WP_001218537.1|2864790_2865492_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|2865495_2866518_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018802.1|2866579_2867383_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_001151940.1|2867543_2869319_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038205.1|2869315_2870377_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
WP_001669965.1|2870373_2870697_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960961.1|2870670_2870889_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
WP_000171003.1|2871001_2873023_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
WP_000279398.1|2873019_2873853_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
WP_000985848.1|2873842_2874172_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
WP_000057335.1|2874162_2874393_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|2874460_2874862_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996734.1|2874861_2875287_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|2875276_2875504_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460879.1|2875513_2876017_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
WP_000204908.1|2876054_2876258_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
WP_001047672.1|2876403_2876970_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
WP_000290918.1|2876969_2877980_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
WP_000124716.1|2878325_2879519_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.6e-106
2883629:2883644	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 7
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	2882608	2888421	4827641		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210079.1|2882608_2883175_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
WP_000984206.1|2883191_2883437_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000194694.1|2883433_2884171_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000556587.1|2884711_2884978_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000980251.1|2884974_2885532_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_001216598.1|2885528_2885756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743153.1|2885752_2886073_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783706.1|2886087_2888421_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
>prophage 8
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	4198538	4292636	4827641	tRNA,lysis,terminase,capsid,tail,portal,plate,protease,head,integrase	Salmonella_phage(40.0%)	106	4231756:4231802	4262735:4262781
WP_000560969.1|4198538_4198976_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4199020_4199962_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4199976_4200423_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4200419_4200731_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127704.1|4200816_4201746_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|4201963_4202275_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4202275_4202566_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4202612_4203542_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4203538_4204174_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331364.1|4204170_4205073_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4205085_4208136_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059744.1|4208330_4209167_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710967.1|4209434_4210466_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828039.1|4210648_4211749_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|4212091_4212415_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4212414_4213074_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_001517951.1|4213174_4213723_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619474.1|4213811_4214126_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4214122_4215271_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4215397_4216225_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211454.1|4216367_4217627_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143957.1|4217623_4219093_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4219380_4220217_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4220369_4221218_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4221214_4222249_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4222867_4223551_+	oligogalacturonate-specific porin KdgM family protein	NA	NA	NA	NA	NA
WP_000566800.1|4223709_4225017_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4225009_4225525_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|4225543_4226527_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|4226855_4227476_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559230.1|4227545_4228235_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|4228246_4228642_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338672.1|4228762_4228966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|4229013_4230387_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4230383_4231082_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4231232_4231733_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4231756:4231802	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985251.1|4231917_4232898_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001099751.1|4232967_4233261_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_001583792.1|4233397_4233670_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001670778.1|4233839_4234340_+	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_000557712.1|4234403_4234628_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001113578.1|4234929_4235154_+	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000027647.1|4235150_4235426_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_000257582.1|4235415_4237692_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000037667.1|4237870_4238068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680929.1|4238064_4239105_-	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000042036.1|4239238_4239670_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000551923.1|4239668_4239860_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000039235.1|4240380_4241418_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000214048.1|4241417_4243187_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_001074705.1|4243351_4244215_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_001224307.1|4244246_4245407_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_000224816.1|4245410_4246169_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_000177982.1|4246266_4246767_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|4246766_4246970_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|4246960_4247182_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_000534554.1|4247165_4247675_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000849743.1|4247671_4248085_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000277800.1|4248192_4248660_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000997680.1|4248652_4249120_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000273577.1|4249124_4250501_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_001093789.1|4250577_4251219_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000127150.1|4251215_4251563_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_000246674.1|4251569_4252478_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_001000070.1|4252470_4253001_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000104695.1|4253011_4254754_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_000874698.1|4254753_4255323_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_001279030.1|4255457_4256645_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_001207676.1|4256660_4257179_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001029727.1|4257241_4257577_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|4257573_4257729_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069524.1|4257721_4260163_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_000978869.1|4260174_4260660_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000627818.1|4260656_4261826_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000468311.1|4261903_4262122_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000933379.1|4262156_4262573_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_001077320.1|4262859_4263762_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4262735:4262781	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4263946_4264909_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4265112_4266102_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750762.1|4266202_4266958_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777320.1|4267220_4268555_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646510.1|4268565_4269525_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4269534_4270575_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|4270637_4271360_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001173080.1|4271858_4272209_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4272222_4273815_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|4273901_4274861_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167248.1|4275116_4276652_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911133.1|4276645_4277689_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4277685_4278687_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4278715_4279738_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4279766_4280642_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|4280724_4281015_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4281024_4281789_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4281880_4282648_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|4282760_4283357_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155229.1|4283457_4283886_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796293.1|4283991_4284738_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250617.1|4284834_4285845_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4285956_4287465_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4287485_4288331_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4288729_4288969_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4289190_4289676_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139637.1|4289768_4290698_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4290764_4292096_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4292105_4292636_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 9
NC_011080	Salmonella enterica subsp. enterica serovar Newport str. SL254, complete sequence	4827641	4411351	4456127	4827641	tRNA,plate,holin,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001177098.1|4411351_4411867_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
WP_000368212.1|4411876_4413358_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_000359503.1|4413360_4413993_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951728.1|4413985_4415101_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_001093501.1|4415091_4415451_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632052.1|4415614_4417162_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_000703634.1|4417161_4418091_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|4418087_4418450_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000679396.1|4418773_4419496_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000818152.1|4419505_4420549_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_001269716.1|4420536_4420746_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271429.1|4420745_4421699_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262484.1|4421698_4424053_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_001185656.1|4424149_4424278_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|4424237_4424555_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907495.1|4424606_4425131_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729849.1|4425130_4426558_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000875314.1|4426547_4426745_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4426741_4427197_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4427356_4427671_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4427683_4428289_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4428291_4428579_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4429156_4429504_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136394.1|4429634_4430984_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790036.1|4431328_4432978_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4433421_4433664_+	outer membrane protein	NA	NA	NA	NA	NA
WP_122821798.1|4433697_4434366_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977959.1|4434362_4435100_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750806.1|4435099_4437196_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4437338_4437749_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252081.1|4437914_4438805_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382575.1|4438819_4440364_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4440495_4441686_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4442047_4443157_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973678.1|4443245_4444604_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4444767_4445685_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4445865_4446363_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4446376_4447249_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4447347_4449768_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4449938_4450307_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4450415_4451024_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128103.1|4451202_4452528_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4452524_4452638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4452659_4452869_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416272.1|4452968_4453484_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039337.1|4453730_4455041_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182228.1|4455128_4456127_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NC_009140	Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence	176473	70780	133402	176473	integrase,transposase	Salmonella_phage(20.0%)	60	122780:122795	141264:141279
WP_000608644.1|70780_72043_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|72366_73512_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|73605_74139_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|74135_74453_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000606835.1|75180_80667_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|80815_81523_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000637384.1|81519_83967_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000351984.1|83981_84299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010740.1|84295_84826_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_001447719.1|84788_86054_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_000575345.1|86050_86722_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000983282.1|86718_87726_+	TraU family protein	NA	NA	NA	NA	NA
WP_001447718.1|87829_90637_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000709517.1|90675_91536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|91658_92300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|92594_92915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186917.1|93218_93404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|93623_94592_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|94602_95511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|95571_96102_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|96196_97186_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|97248_98259_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_000170087.1|98458_99736_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000039319.1|99820_101617_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001447572.1|101678_102014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018872.1|102278_102818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793769.1|102908_103409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477209.1|103482_104367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102700.1|104432_104657_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|104718_105108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|105097_105550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|105887_106079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|106123_106501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|106692_107037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410925.1|107114_107417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|107494_109120_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000687894.1|109180_109612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093867.1|109685_110240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042274.1|110472_110859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001187969.1|110946_113400_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050847.1|113601_113805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|113876_114482_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|114474_114744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|114757_114976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064432.1|115049_115607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|115681_116533_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077336.1|116991_117378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|117555_119283_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|119269_119548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714163.1|119620_119842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|120023_121028_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|121106_124079_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
122780:122795	attL	GCGCATCGGCGGGCAC	NA	NA	NA	NA
WP_001162012.1|124081_124639_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|124944_125958_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_024131607.1|126103_126895_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA25	NA	NA	NA	NA	NA
WP_000131886.1|127061_127961_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|128167_128488_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_000719078.1|128543_130181_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.6	1.8e-174
WP_001137772.1|130369_131899_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001137513.1|132166_133402_+|transposase	IS256-like element ISEc58 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
141264:141279	attR	GCGCATCGGCGGGCAC	NA	NA	NA	NA
