The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	245555	307314	1999618	protease,tRNA,transposase	Pseudomonas_phage(15.0%)	59	NA	NA
WP_003667184.1|245555_247583_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.6	1.1e-91
WP_003667185.1|247575_248394_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003667186.1|248390_248957_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_003667187.1|248949_249843_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003665581.1|249933_250176_+	Veg family protein	NA	NA	NA	NA	NA
WP_003667188.1|250361_251213_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003667189.1|251352_252264_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003667190.1|252271_252943_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.3e-13
WP_003667191.1|252942_253740_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003667193.1|253971_254817_+	pur operon repressor	NA	NA	NA	NA	NA
WP_003667195.1|254820_256188_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	5.4e-31
WP_003667197.1|256262_257252_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	6.5e-42
WP_003667199.1|257427_258165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667200.1|258243_259065_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003667202.1|259064_260432_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.4	4.3e-28
WP_003667203.1|260433_261258_-	ligase	NA	NA	NA	NA	NA
WP_130125636.1|261455_261866_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.6	5.2e-46
WP_003667207.1|261865_263041_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.2	6.6e-118
WP_003667208.1|263267_263666_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011953385.1|263711_264269_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003667210.1|264444_266049_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	1.3e-148
WP_011953386.1|266561_267944_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	1.0e-29
WP_003667214.1|268227_269505_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003665599.1|269597_269843_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011953387.1|270004_271321_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003667221.1|271304_272195_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003667224.1|272244_272949_+	class A sortase	NA	NA	NA	NA	NA
WP_003667227.1|273349_274129_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003667230.1|274140_275007_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003667231.1|275026_275683_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003667233.1|275721_276186_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003667234.1|276315_276885_+	LemA family protein	NA	NA	NA	NA	NA
WP_003667235.1|276887_277784_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003667237.1|277937_279317_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003667239.1|279388_280885_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	3.4e-71
WP_003667241.1|280965_281802_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	6.5e-27
WP_003667242.1|282267_283209_+	glutaminase	NA	NA	NA	NA	NA
WP_003664118.1|283354_283813_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003667243.1|284468_285851_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	1.7e-27
WP_011953388.1|285934_287224_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003667244.1|287216_287456_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003667245.1|287475_288693_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.3	4.1e-22
WP_003667246.1|288692_290219_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.0	1.2e-39
WP_003665629.1|290240_290381_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003667247.1|290711_291074_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003667248.1|291073_292201_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.0	2.5e-29
WP_003667249.1|292219_292594_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	2.1e-09
WP_003667250.1|292784_294161_+	cytosine permease	NA	NA	NA	NA	NA
WP_003667251.1|294151_295390_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_003667252.1|295774_296566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953389.1|296674_297313_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011953390.1|297518_298079_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003667257.1|298097_301637_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003667258.1|301633_301906_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003667261.1|302006_302363_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003665652.1|302546_303041_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_003673314.1|303042_304437_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.1	2.8e-14
WP_003667265.1|304429_304972_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.8	6.1e-10
WP_003665658.1|305205_307314_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
>prophage 2
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	722463	742730	1999618	head,portal,capsid,protease,terminase,tail	Staphylococcus_phage(27.27%)	23	NA	NA
WP_003666838.1|722463_723714_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	2.3e-137
WP_003668240.1|723731_724322_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003674350.1|724323_724623_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	49.0	5.0e-22
WP_003668237.1|724666_724804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668235.1|724947_726759_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003668233.1|726823_728140_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003668232.1|728172_729102_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_012390529.1|729119_729953_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003668229.1|730092_730560_+	hypothetical protein	NA	A7KV88	Bacillus_phage	43.3	4.1e-15
WP_003668227.1|730573_730894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668226.1|731013_731286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668224.1|731303_731804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668222.1|731829_733221_+	primase	NA	A0A0M4RE09	Enterococcus_phage	31.5	4.7e-30
WP_003668220.1|733650_734010_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_003668217.1|734018_734432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668215.1|734435_734960_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	32.7	1.8e-11
WP_003668211.1|735306_735771_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	33.6	9.2e-15
WP_003668210.1|735770_737480_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	38.5	9.9e-107
WP_003668208.1|737644_738763_+|portal	phage portal protein	portal	A0A1D6Z2A2	Staphylococcus_phage	31.9	8.6e-43
WP_011953433.1|738740_740261_+|capsid	phage major capsid protein	capsid	A0A1Q1PVX2	Staphylococcus_phage	35.0	9.3e-40
WP_003668206.1|740317_740740_+	transcriptional regulator	NA	E3W8E2	Leuconostoc_phage	32.7	1.2e-08
WP_003668205.1|740755_741034_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003668204.1|742061_742730_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	33.9	1.2e-31
>prophage 3
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	772673	781877	1999618	integrase	Lactobacillus_phage(28.57%)	9	766168:766182	779931:779945
766168:766182	attL	AGAAAAATAAGAAGA	NA	NA	NA	NA
WP_003668169.1|772673_774539_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.1e-135
WP_003665811.1|774667_775819_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.3e-30
WP_003668167.1|775949_777785_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	4.3e-23
WP_003668165.1|777935_779096_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	43.6	8.0e-84
WP_003668163.1|779219_779954_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	38.0	1.1e-38
779931:779945	attR	TCTTCTTATTTTTCT	NA	NA	NA	NA
WP_003668162.1|779958_780195_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	53.4	1.8e-14
WP_003668161.1|780246_780696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668160.1|780794_781253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080502980.1|781715_781877_-	hypothetical protein	NA	A0A2I6PDG6	Staphylococcus_phage	65.9	1.4e-10
>prophage 4
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	838235	846300	1999618	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_003666054.1|838235_838511_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_011953444.1|838646_839912_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003668104.1|840037_841249_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003668103.1|841250_843161_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.4e-56
WP_003668102.1|843179_844142_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.2	2.5e-115
WP_003666061.1|844157_844646_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	4.3e-23
WP_003666062.1|844634_845279_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003668100.1|845457_846300_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	2.3e-16
>prophage 5
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	860951	899634	1999618	head,portal,capsid,terminase,tail,transposase	Lactobacillus_phage(46.67%)	58	NA	NA
WP_003668074.1|860951_861920_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003668071.1|862113_862518_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003668066.1|862994_863174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668064.1|863201_863696_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668062.1|863850_864234_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003666092.1|864251_864443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668061.1|864457_865003_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003668059.1|865182_866712_-	gluconokinase	NA	NA	NA	NA	NA
WP_003668057.1|866762_867782_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080502967.1|867861_869046_-	gluconate permease	NA	NA	NA	NA	NA
WP_080502968.1|869103_870480_-	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	53.3	3.0e-106
WP_003668052.1|870836_871694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011953447.1|871714_872236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668049.1|872249_872654_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	61.3	2.2e-17
WP_003668048.1|872707_873112_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003668047.1|873128_873503_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	49.5	9.9e-20
WP_003668046.1|873624_873840_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	59.3	3.5e-09
WP_003668044.1|873858_874632_+	phage repressor protein/antirepressor Ant	NA	B8R674	Lactobacillus_phage	71.2	6.3e-93
WP_003668042.1|874907_875111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668040.1|875107_875356_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668039.1|875333_875537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668038.1|875551_875728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668037.1|875727_876000_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668036.1|875992_876922_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	52.8	1.2e-74
WP_003668035.1|876905_877730_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	64.5	1.8e-106
WP_003668034.1|877707_878592_+	DnaD domain protein	NA	Q8SDH3	Lactococcus_phage	43.3	5.4e-16
WP_003666901.1|878584_878914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666903.1|878910_879282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666905.1|879357_879636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666907.1|879820_879973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666908.1|880016_880211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666909.1|880210_880471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666911.1|880470_880812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666912.1|880811_881000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666913.1|881007_881268_+	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	37.8	1.3e-05
WP_003666914.1|881267_881579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666915.1|881641_881785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666916.1|881866_882289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668032.1|883236_883443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668031.1|883500_884199_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_003668030.1|884198_884624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668029.1|884637_885417_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	39.5	1.3e-13
WP_003668028.1|885433_885937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668027.1|885911_887207_+|terminase	PBSX family phage terminase large subunit	terminase	H9A0U5	Staphylococcus_phage	54.7	5.9e-128
WP_003668026.1|887206_888868_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	33.2	1.7e-63
WP_003668025.1|888867_889818_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_003668024.1|889828_890074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668023.1|890203_890857_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003668021.1|890871_891948_+	hypothetical protein	NA	D7RWJ0	Brochothrix_phage	30.3	3.1e-37
WP_003668019.1|891960_892326_+|head,tail	phage head-tail connector protein	head,tail	Q77K22	Lactococcus_phage	34.8	8.5e-08
WP_003668018.1|892325_892640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668016.1|892629_893190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668015.1|893198_893609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668014.1|893611_894259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668013.1|894278_894824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668011.1|894916_895096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668009.1|895099_898750_+	hypothetical protein	NA	A0A2I6QQX2	Streptococcus_phage	28.9	2.4e-49
WP_003668007.1|898746_899634_+|tail	phage tail family protein	tail	NA	NA	NA	NA
>prophage 6
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	1030769	1062301	1999618	integrase,transposase	Lactococcus_phage(25.0%)	30	1022983:1023000	1066303:1066320
1022983:1023000	attL	TGAAGATGGTAATGATAT	NA	NA	NA	NA
WP_080502969.1|1030769_1031120_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	68.1	8.4e-37
WP_003667773.1|1032871_1033330_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.3	1.9e-17
WP_173030300.1|1033557_1034418_-	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	28.1	8.4e-14
WP_003667771.1|1034720_1035368_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_003667770.1|1035500_1035854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667768.1|1037038_1037803_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003667767.1|1037813_1038590_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_169471569.1|1038582_1039431_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003667763.1|1039427_1040798_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003667761.1|1040806_1041241_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667760.1|1041233_1041686_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003667758.1|1041692_1042925_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003667757.1|1042935_1043670_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_003667755.1|1043653_1044604_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003674025.1|1044603_1044846_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003667751.1|1044865_1045840_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003663667.1|1045859_1046306_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003667749.1|1046392_1046839_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667748.1|1047163_1048243_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	6.9e-05
WP_003667747.1|1048315_1048474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953475.1|1050398_1051253_+	patatin family protein	NA	NA	NA	NA	NA
WP_003663651.1|1051269_1051917_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	2.5e-18
WP_003667741.1|1052025_1052916_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003667418.1|1053099_1054710_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.0e-97
WP_003664118.1|1056289_1056748_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003667700.1|1057000_1057960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667698.1|1057975_1058407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667696.1|1060151_1060340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667694.1|1060329_1060686_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003667693.1|1060756_1062301_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	24.2	1.4e-22
1066303:1066320	attR	TGAAGATGGTAATGATAT	NA	NA	NA	NA
>prophage 7
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	1105269	1204263	1999618	head,portal,tRNA,capsid,protease,plate,integrase,terminase,tail,transposase	Lactobacillus_phage(47.73%)	108	1196962:1196977	1206972:1206987
WP_003667057.1|1105269_1106238_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003667055.1|1106239_1107157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667054.1|1107245_1108004_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	8.7e-63
WP_011953482.1|1108008_1109220_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.7	2.1e-90
WP_003667051.1|1109396_1110488_-	ATP-dependent helicase	NA	A0A1V0SG90	Hokovirus	21.7	2.4e-05
WP_003667049.1|1110472_1112086_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003667043.1|1113327_1115346_-	NTPase KAP	NA	NA	NA	NA	NA
WP_003667042.1|1116756_1118415_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_003667041.1|1118439_1119285_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.7	4.2e-34
WP_003667039.1|1120616_1121618_-	LCP family protein	NA	NA	NA	NA	NA
WP_003667038.1|1122014_1122413_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003667037.1|1122518_1123043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035167525.1|1124351_1124750_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	4.3e-45
WP_003667034.1|1124865_1125108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667032.1|1125300_1125876_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003667031.1|1125885_1126122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667030.1|1126163_1126676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667028.1|1126722_1128225_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003663508.1|1128359_1128545_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003676754.1|1128627_1130457_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003667025.1|1130595_1131999_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003667023.1|1132150_1132864_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.6	1.5e-27
WP_003667021.1|1132860_1133712_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	24.5	3.4e-15
WP_003667018.1|1134249_1135917_-	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	41.7	8.0e-53
WP_003667015.1|1135930_1136494_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003673283.1|1136594_1137476_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003667012.1|1137487_1138150_-	serine dehydratase	NA	NA	NA	NA	NA
WP_003667009.1|1138221_1138449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667008.1|1138448_1138913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667006.1|1139281_1139551_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003667005.1|1139696_1140575_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003667003.1|1140693_1141929_+	MFS transporter	NA	NA	NA	NA	NA
WP_003667001.1|1141949_1142651_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_003666999.1|1143075_1144215_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	3.2e-85
WP_011953487.1|1144232_1144976_+	cyclase family protein	NA	NA	NA	NA	NA
WP_003666995.1|1145037_1145937_-	prenyltransferase	NA	NA	NA	NA	NA
WP_003666994.1|1146017_1146998_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003666991.1|1147044_1149063_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_003666989.1|1149072_1150995_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_011953488.1|1151155_1152175_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011953489.1|1152343_1152823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666987.1|1152906_1154289_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	1.0e-29
WP_003666986.1|1154784_1155612_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.0	1.4e-98
WP_003666985.1|1155614_1155947_-	MazG-like family protein	NA	M5AWB2	Nitratiruptor_phage	40.2	3.2e-14
WP_003666984.1|1156096_1156321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664118.1|1156783_1157242_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003666953.1|1158478_1159678_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	63.3	2.4e-51
WP_003666952.1|1159667_1160039_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	47.3	1.6e-09
WP_003666951.1|1160035_1160362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666949.1|1160376_1161465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666948.1|1161503_1162055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666947.1|1162093_1162213_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003666945.1|1162205_1162610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666944.1|1162621_1163737_-|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	37.2	5.2e-56
WP_003666943.1|1163733_1164879_-	SGNH/GDSL hydrolase family protein	NA	E9LUJ8	Lactobacillus_phage	42.4	7.4e-82
WP_003666942.1|1164891_1165161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666941.1|1165203_1165446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666940.1|1165438_1169518_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	26.6	6.8e-29
WP_003666939.1|1169465_1171217_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003666938.1|1171224_1172070_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	35.6	2.0e-36
WP_003666937.1|1172084_1175924_-	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	34.5	3.8e-114
WP_003666935.1|1176140_1176539_-	hypothetical protein	NA	A0A2P0ZL35	Lactobacillus_phage	34.7	5.1e-06
WP_003666934.1|1176588_1177299_-|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	52.1	1.3e-55
WP_003666933.1|1177303_1177687_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	37.7	8.9e-16
WP_003666932.1|1177683_1178109_-	HK97 gp10 family phage protein	NA	A0A0M7RDL2	Lactobacillus_phage	49.0	6.6e-28
WP_003666931.1|1178101_1178452_-|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	35.4	4.1e-07
WP_003666930.1|1178420_1178789_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8HGT2	Streptococcus_phage	48.4	5.9e-17
WP_011953496.1|1178808_1179984_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	57.5	1.4e-120
WP_003666928.1|1179973_1180708_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	54.5	8.1e-58
WP_003666926.1|1180691_1181882_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	58.2	1.4e-131
WP_080502972.1|1181899_1182079_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_003666925.1|1182068_1183958_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	63.5	1.9e-244
WP_003666924.1|1183981_1184197_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	52.8	9.4e-07
WP_003666923.1|1184193_1184631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953499.1|1184653_1185127_-|terminase	phage terminase small subunit P27 family	terminase	A0A2P0VIH5	Streptococcus_phage	50.0	3.2e-39
WP_003666921.1|1185271_1185808_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	53.7	3.7e-44
WP_003666920.1|1185875_1186055_-	hypothetical protein	NA	F8J1H1	Lactobacillus_phage	50.0	2.7e-07
WP_003664118.1|1186714_1187173_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003666918.1|1187445_1188288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666916.1|1189193_1189616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666915.1|1189697_1189841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666914.1|1189903_1190215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666913.1|1190214_1190475_-	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	37.8	1.3e-05
WP_003666912.1|1190482_1190671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666911.1|1190670_1191012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666909.1|1191011_1191272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666908.1|1191271_1191466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666907.1|1191509_1191662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666905.1|1191846_1192125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666903.1|1192200_1192572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666901.1|1192568_1192898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668034.1|1192890_1193775_-	DnaD domain protein	NA	Q8SDH3	Lactococcus_phage	43.3	5.4e-16
WP_003668359.1|1193752_1194577_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	64.5	1.1e-106
WP_003668360.1|1194560_1195550_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	46.4	7.3e-62
WP_003666975.1|1195542_1195773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666974.1|1195808_1195994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666973.1|1196046_1196553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666969.1|1196832_1197111_-	hypothetical protein	NA	NA	NA	NA	NA
1196962:1196977	attL	ATCTGGATAGTTTTCT	NA	NA	NA	NA
WP_003666968.1|1197122_1197926_-	phage repressor protein/antirepressor Ant	NA	Q6SEF4	Lactobacillus_prophage	61.0	1.3e-77
WP_003666967.1|1197944_1198148_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011953501.1|1198326_1198764_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	44.1	1.9e-22
WP_003666963.1|1198776_1199217_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	37.6	1.6e-16
WP_003666961.1|1199345_1199855_+	Ltp family lipoprotein	NA	Q6SEA6	Lactobacillus_prophage	70.3	7.7e-15
WP_003666960.1|1200017_1200335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666958.1|1200337_1201468_+|integrase	site-specific integrase	integrase	A0A1S5SA77	Streptococcus_phage	34.7	2.1e-49
WP_003675625.1|1201581_1201941_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003668364.1|1202063_1203494_-	amino acid permease	NA	NA	NA	NA	NA
WP_003663813.1|1203504_1204263_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
1206972:1206987	attR	ATCTGGATAGTTTTCT	NA	NA	NA	NA
>prophage 8
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	1330291	1395975	1999618	integrase,protease,tRNA,transposase	Enterococcus_phage(26.67%)	57	1391253:1391272	1401160:1401179
WP_003668531.1|1330291_1330969_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003668533.1|1330952_1331198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668535.1|1331314_1332238_-	ribokinase	NA	NA	NA	NA	NA
WP_003668536.1|1332294_1333311_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003668538.1|1333392_1334001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664204.1|1334216_1334849_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_003668540.1|1334883_1335930_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	32.2	6.9e-10
WP_003668541.1|1336019_1336532_-	universal stress protein	NA	NA	NA	NA	NA
WP_003668542.1|1336557_1337961_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003668543.1|1338049_1338910_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003673339.1|1338973_1340623_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003668545.1|1340737_1341001_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003668546.1|1341065_1343486_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_003668547.1|1343807_1344995_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	3.6e-148
WP_003668549.1|1345155_1345695_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003668551.1|1346117_1347557_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675841.1|1347680_1348136_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003668553.1|1348167_1349514_-	amino acid permease	NA	NA	NA	NA	NA
WP_003668554.1|1349604_1350216_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003664220.1|1350227_1350395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668555.1|1350562_1351087_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003668556.1|1351110_1351554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668557.1|1351553_1353056_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.2	4.4e-34
WP_003664225.1|1353182_1353614_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003668559.1|1353746_1354595_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003668560.1|1354692_1355991_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_003668561.1|1355983_1357225_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003668562.1|1357520_1358282_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	42.0	7.6e-51
WP_003668563.1|1358403_1359111_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	46.4	9.3e-27
WP_003668564.1|1359439_1361140_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_011953516.1|1361294_1362056_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003668566.1|1362440_1363334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664234.1|1363342_1363921_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_003668567.1|1363986_1366221_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	1.8e-249
WP_003668569.1|1366626_1368024_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003668571.1|1368061_1368616_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668573.1|1375410_1375659_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_003668575.1|1375716_1376730_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011953518.1|1376729_1377758_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668578.1|1377760_1378978_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668580.1|1379211_1380942_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.0	1.5e-14
WP_003664342.1|1380941_1381208_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003664345.1|1381329_1381515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668582.1|1381790_1383995_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.1	3.3e-123
WP_003668584.1|1384045_1384654_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003668586.1|1384803_1385529_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003668588.1|1385659_1386346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668591.1|1386345_1387212_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.4e-19
WP_011953520.1|1387189_1387573_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003668595.1|1387736_1388711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668597.1|1388644_1390087_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_003668598.1|1390652_1391207_-	cell wall-binding protein	NA	NA	NA	NA	NA
WP_003668600.1|1391116_1391476_-	hypothetical protein	NA	NA	NA	NA	NA
1391253:1391272	attL	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
WP_003668601.1|1391608_1391827_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	40.8	6.2e-06
WP_003668602.1|1391857_1392232_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-12
WP_003668604.1|1392264_1393116_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	24.8	3.4e-15
WP_003668612.1|1395627_1395975_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1401160:1401179	attR	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
>prophage 9
NC_009513	Lactobacillus reuteri DSM 20016, complete sequence	1999618	1643655	1662882	1999618	integrase,protease,transposase	Streptococcus_phage(40.0%)	19	1646390:1646404	1674046:1674060
WP_003668960.1|1643655_1644342_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011953550.1|1644365_1644980_-	sugar permease	NA	NA	NA	NA	NA
WP_003668962.1|1645285_1646341_-	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	23.0	8.5e-08
1646390:1646404	attL	GAAAAAGCTGATAAC	NA	NA	NA	NA
WP_003668964.1|1647661_1647808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080502982.1|1647808_1647991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003668965.1|1648107_1649502_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	1.8e-29
WP_003668966.1|1649716_1650964_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	5.7e-11
WP_003668967.1|1651031_1651274_-	cytochrome b5	NA	NA	NA	NA	NA
WP_011953551.1|1651365_1651836_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	1.6e-11
WP_003668972.1|1652483_1653071_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003668974.1|1653524_1654736_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_003668975.1|1654809_1655331_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668976.1|1655546_1656011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668977.1|1656023_1657091_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011953553.1|1657183_1658344_-	MFS transporter	NA	NA	NA	NA	NA
WP_035164165.1|1658362_1658899_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003668981.1|1659090_1659963_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003668982.1|1660033_1661272_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003668983.1|1661664_1662882_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.0	2.7e-21
1674046:1674060	attR	GTTATCAGCTTTTTC	NA	NA	NA	NA
