The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	107950	143483	4929566	tRNA,bacteriocin,transposase	Leptospira_phage(25.0%)	38	NA	NA
WP_011971242.1|107950_108718_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011971243.1|108710_109550_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	9.0e-61
WP_011971244.1|109661_109901_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.7	2.4e-19
WP_011971245.1|110288_111707_+	HD domain-containing protein	NA	A0A0F6YPT7	Sinorhizobium_phage	25.1	5.3e-21
WP_011971246.1|111824_113273_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	52.7	3.5e-137
WP_011971247.1|113528_114104_+	spore maturation protein	NA	NA	NA	NA	NA
WP_157047119.1|114100_114640_+	spore maturation protein	NA	NA	NA	NA	NA
WP_011971249.1|114704_115664_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_157047120.1|115800_115941_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_011971250.1|115940_116507_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_083760767.1|116850_117228_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011971252.1|117323_119636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971253.1|119635_120268_+|bacteriocin	putative bacteriocin export ABC transporter	bacteriocin	G9BWD6	Planktothrix_phage	39.3	2.1e-30
WP_011971254.1|120430_121693_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_041721275.1|121715_122444_-	response regulator	NA	NA	NA	NA	NA
WP_083760768.1|122821_122980_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_011971256.1|123521_123989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971257.1|124353_124602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047121.1|124878_125034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971258.1|125265_126558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971259.1|126550_127066_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011971260.1|127233_127812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971261.1|128719_130687_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.7	2.5e-98
WP_011971262.1|130701_131469_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011971263.1|131923_132112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971264.1|132214_132970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011971265.1|133050_133362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760770.1|133463_133754_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.1	1.5e-15
WP_157047349.1|133862_135434_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.3	4.6e-66
WP_011971268.1|135704_137579_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011971269.1|137649_138087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971270.1|138304_138898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971271.1|139280_140108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971272.1|140127_140961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047122.1|141076_141217_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_041720175.1|141198_141813_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_083760774.1|141938_142397_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011971275.1|142709_143483_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	432400	453157	4929566	terminase,tail,head	Deep-sea_thermophilic_phage(21.05%)	30	NA	NA
WP_083760799.1|432400_433174_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JU23	Anoxybacillus_phage	37.8	7.1e-28
WP_011971545.1|433227_433542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971547.1|434193_434487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047353.1|434503_434782_+	hypothetical protein	NA	A0A2K9VH10	Faecalibacterium_phage	37.2	5.3e-10
WP_011971549.1|434781_435348_+	DUF3486 family protein	NA	A0A2H4JAV3	uncultured_Caudovirales_phage	34.4	4.4e-27
WP_011971550.1|435361_435850_+	antiterminator LoaP	NA	NA	NA	NA	NA
WP_011971551.1|436106_437564_+|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	46.6	1.4e-109
WP_011971552.1|437581_438931_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	34.4	5.7e-65
WP_011971553.1|438923_439706_+|head	head morphogenesis protein	head	A0A2I7RZ42	Vibrio_phage	31.8	5.1e-18
WP_041720248.1|439686_440823_+	DUF2213 domain-containing protein	NA	H2BCR3	Synechococcus_phage	28.0	1.2e-15
WP_011971555.1|440838_441339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971556.1|441361_442276_+	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	43.5	5.4e-59
WP_011971557.1|442291_442624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971558.1|442626_442959_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_011971559.1|442971_443574_+	hypothetical protein	NA	A8ATG9	Listeria_phage	48.0	9.7e-41
WP_011971560.1|443570_443933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971561.1|443929_444436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971562.1|444447_445452_+	DUF3383 family protein	NA	E5DV56	Deep-sea_thermophilic_phage	37.2	1.5e-57
WP_011971563.1|445463_445868_+	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	36.2	2.3e-14
WP_011971564.1|445923_446178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971565.1|446238_446562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971566.1|446670_448428_+|tail	tail tape measure protein	tail	A0A1C9M1I4	Mycobacterium_phage	35.1	1.8e-10
WP_011971567.1|448440_449031_+	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	30.5	4.7e-08
WP_157047354.1|449030_449357_+	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	50.5	3.3e-19
WP_011971569.1|449343_450120_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	34.7	1.7e-42
WP_011971570.1|450116_450413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047130.1|450409_450775_+	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	41.4	3.7e-11
WP_011971572.1|450767_451955_+	hypothetical protein	NA	A0A1L2JY69	Aeribacillus_phage	45.2	2.9e-89
WP_011971573.1|451947_452577_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	47.9	1.5e-44
WP_011971574.1|452587_453157_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	49.1	1.3e-10
>prophage 3
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	872332	879253	4929566	integrase	Clostridium_phage(37.5%)	10	869556:869572	883364:883380
869556:869572	attL	TAATGACTTTATAGATT	NA	NA	NA	NA
WP_012062101.1|872332_872617_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	44.7	2.3e-16
WP_012062102.1|872699_874343_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.9	2.7e-154
WP_012062103.1|874444_875593_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	44.4	5.0e-78
WP_012062104.1|875597_875756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062105.1|875814_876273_-	membrane protein	NA	A0A0A7RTX7	Clostridium_phage	50.8	3.9e-34
WP_041720332.1|876293_876623_-	helix-turn-helix domain-containing protein	NA	R9TNF4	Paenibacillus_phage	52.3	1.7e-23
WP_012062107.1|876842_877055_+	phage protein	NA	R9TME1	Paenibacillus_phage	55.7	5.1e-13
WP_012062108.1|877088_877334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012062109.1|877351_878182_+	phage antirepressor	NA	A0A0A8WIE3	Clostridium_phage	62.2	1.0e-85
WP_012062110.1|878332_879253_+	hypothetical protein	NA	A0A2I7S3S2	Vibrio_phage	37.3	3.0e-33
883364:883380	attR	AATCTATAAAGTCATTA	NA	NA	NA	NA
>prophage 4
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	953355	960827	4929566		Synechococcus_phage(33.33%)	8	NA	NA
WP_012062179.1|953355_953868_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	3.1e-24
WP_041721388.1|953889_954591_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3ELR0	Synechococcus_phage	40.7	2.7e-42
WP_041720353.1|954601_954847_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012062182.1|954860_955541_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012062183.1|955533_957750_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.9	3.2e-158
WP_012062184.1|957719_959153_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	7.9e-65
WP_041721389.1|959145_960183_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	41.6	1.2e-67
WP_012062186.1|960170_960827_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	32.8	7.1e-21
>prophage 5
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	1060945	1068929	4929566		Staphylococcus_phage(66.67%)	9	NA	NA
WP_012062272.1|1060945_1062574_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.5	3.2e-38
WP_012062273.1|1062590_1063286_-	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	30.3	1.9e-08
WP_012062274.1|1063608_1063785_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_041721401.1|1064045_1064465_+	nucleoside recognition protein	NA	NA	NA	NA	NA
WP_041720370.1|1064461_1064941_+	nucleoside recognition protein	NA	NA	NA	NA	NA
WP_041721402.1|1065422_1066508_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.2	1.2e-49
WP_012062278.1|1066512_1067169_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.2	3.5e-36
WP_012062279.1|1067254_1068466_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.6	1.4e-110
WP_012062280.1|1068467_1068929_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.8	1.1e-41
>prophage 6
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	1082767	1119856	4929566	protease,transposase	Enterobacteria_phage(50.0%)	33	NA	NA
WP_012062294.1|1082767_1083592_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012062295.1|1084047_1084917_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_083760838.1|1085102_1085471_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012062296.1|1085724_1085967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062297.1|1086318_1087860_+	radical SAM protein	NA	NA	NA	NA	NA
WP_083760839.1|1087952_1088324_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012062299.1|1088661_1088859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062300.1|1088950_1089766_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_157047160.1|1090103_1090298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062302.1|1090316_1091060_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	40.7	1.6e-48
WP_157047161.1|1091047_1092622_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.5	2.5e-19
WP_012062305.1|1095114_1095351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062307.1|1096092_1096596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041720383.1|1096867_1097536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083761089.1|1097669_1097864_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012062308.1|1098204_1098423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047162.1|1099104_1099266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062309.1|1099622_1100165_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012062310.1|1101170_1101614_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_012062311.1|1101571_1103629_-	serine recombinase	NA	NA	NA	NA	NA
WP_049765188.1|1104189_1104564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062312.1|1104727_1104967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062313.1|1105571_1108877_+	peptidase M16	NA	NA	NA	NA	NA
WP_012062314.1|1109337_1110114_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012062315.1|1110153_1110312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062316.1|1110495_1110903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041720385.1|1111150_1111360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062317.1|1111457_1113227_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_012062318.1|1113298_1114840_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012062319.1|1115205_1116195_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_012062320.1|1116650_1117937_+	trigger factor	NA	NA	NA	NA	NA
WP_012062321.1|1117984_1118569_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	3.3e-54
WP_012062322.1|1118593_1119856_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.3	8.3e-151
>prophage 7
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	1530167	1559972	4929566	protease,transposase	Enterobacteria_phage(40.0%)	31	NA	NA
WP_157047161.1|1530167_1531742_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.5	2.5e-19
WP_012062302.1|1531729_1532473_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	40.7	1.6e-48
WP_157047160.1|1532491_1532686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041720473.1|1532738_1533287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047183.1|1533388_1533976_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_157047185.1|1534332_1535145_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083760884.1|1535105_1535558_-	DUF4277 domain-containing protein	NA	NA	NA	NA	NA
WP_041720479.1|1535863_1536091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062712.1|1536160_1537111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047187.1|1537286_1537622_+	DUF4277 domain-containing protein	NA	NA	NA	NA	NA
WP_041720482.1|1537618_1538473_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_041720484.1|1538496_1538943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047375.1|1539377_1539755_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012062714.1|1539852_1541028_+	ArsA family ATPase	NA	NA	NA	NA	NA
WP_157047376.1|1541011_1541875_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.6	5.9e-15
WP_012062716.1|1541871_1542564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012062717.1|1542567_1543284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760886.1|1543382_1544279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062719.1|1544536_1544929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085938821.1|1544921_1545701_-	glucosaminidase domain-containing protein	NA	J9PUD3	Bacillus_phage	39.5	2.0e-22
WP_012062721.1|1546177_1546630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062722.1|1546791_1547298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049765233.1|1547467_1548634_+|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
WP_012062724.1|1548804_1549284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062725.1|1549582_1550818_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_012062726.1|1551115_1553455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062727.1|1554283_1554475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062728.1|1554644_1555280_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_012062729.1|1555575_1556043_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012062730.1|1556343_1557951_+|protease	protease complex subunit PrcB family protein	protease	NA	NA	NA	NA
WP_157047377.1|1558433_1559972_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	26.1	3.8e-25
>prophage 9
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	1657084	1710782	4929566	integrase,protease,transposase	Bacillus_virus(22.22%)	46	1668170:1668186	1714494:1714510
WP_012062799.1|1657084_1658434_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012062800.1|1658537_1659122_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_012062801.1|1659417_1660056_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.4	3.9e-08
WP_012062802.1|1660325_1661390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062803.1|1661544_1662330_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_012062804.1|1662333_1662969_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	2.0e-20
WP_012062805.1|1662984_1663293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012062806.1|1663471_1664671_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_012062807.1|1664903_1665854_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_012062808.1|1665834_1666362_-	DUF4364 family protein	NA	NA	NA	NA	NA
WP_012062809.1|1666491_1666698_-	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	43.1	1.5e-09
WP_157047198.1|1667113_1668175_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1668170:1668186	attL	TGTTGAAGGGAGAAAAA	NA	NA	NA	NA
WP_012062811.1|1668187_1669645_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157047200.1|1669652_1671212_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012062813.1|1671198_1671663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049765237.1|1671807_1672044_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V2T3	Faecalibacterium_phage	40.8	2.6e-05
WP_012062815.1|1672173_1673805_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041720509.1|1674232_1674580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012062816.1|1674606_1675683_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	47.7	1.3e-80
WP_157047201.1|1675685_1676003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062817.1|1676261_1678319_+	recombinase family protein	NA	NA	NA	NA	NA
WP_012062818.1|1678327_1678777_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_083760902.1|1679302_1679932_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157047202.1|1679877_1680156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062821.1|1680407_1680632_+	TIGR04540 family protein	NA	NA	NA	NA	NA
WP_012062822.1|1680695_1683272_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.1	9.4e-109
WP_083761093.1|1683877_1684498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062824.1|1684516_1687600_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012062825.1|1688018_1693046_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012062826.1|1693791_1695792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062827.1|1696256_1697477_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.0	2.3e-49
WP_041720511.1|1697521_1697704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760904.1|1697908_1698148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062828.1|1698867_1699563_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
WP_041720513.1|1699579_1699768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062829.1|1699968_1701069_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_157047380.1|1701096_1702014_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_012062831.1|1702177_1703410_-	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_012062832.1|1703562_1704327_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_157047381.1|1704500_1705985_+	UDP-N-acetylmuramyl-tripeptide synthetase	NA	NA	NA	NA	NA
WP_012062834.1|1706111_1706771_+	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	47.8	3.3e-50
WP_157047203.1|1706832_1706973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062835.1|1707248_1707716_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012062836.1|1707894_1708434_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.1	2.1e-10
WP_012062837.1|1708593_1709757_+	amidohydrolase	NA	NA	NA	NA	NA
WP_012062838.1|1709777_1710782_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1714494:1714510	attR	TGTTGAAGGGAGAAAAA	NA	NA	NA	NA
>prophage 10
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	2032265	2057050	4929566	terminase,tail,head	Deep-sea_thermophilic_phage(20.0%)	34	NA	NA
WP_083760799.1|2032265_2033039_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JU23	Anoxybacillus_phage	37.8	7.1e-28
WP_011971545.1|2033092_2033407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971547.1|2034058_2034352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047353.1|2034368_2034647_+	hypothetical protein	NA	A0A2K9VH10	Faecalibacterium_phage	37.2	5.3e-10
WP_011971549.1|2034646_2035213_+	DUF3486 family protein	NA	A0A2H4JAV3	uncultured_Caudovirales_phage	34.4	4.4e-27
WP_011971550.1|2035226_2035715_+	antiterminator LoaP	NA	NA	NA	NA	NA
WP_011971551.1|2035971_2037429_+|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	46.6	1.4e-109
WP_011971552.1|2037446_2038796_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	34.4	5.7e-65
WP_011971553.1|2038788_2039571_+|head	head morphogenesis protein	head	A0A2I7RZ42	Vibrio_phage	31.8	5.1e-18
WP_041720248.1|2039551_2040688_+	DUF2213 domain-containing protein	NA	H2BCR3	Synechococcus_phage	28.0	1.2e-15
WP_011971555.1|2040703_2041204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971556.1|2041226_2042141_+	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	43.5	5.4e-59
WP_011971557.1|2042156_2042489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971558.1|2042491_2042824_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_011971559.1|2042836_2043439_+	hypothetical protein	NA	A8ATG9	Listeria_phage	48.0	9.7e-41
WP_011971560.1|2043435_2043798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971561.1|2043794_2044301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971562.1|2044312_2045317_+	DUF3383 family protein	NA	E5DV56	Deep-sea_thermophilic_phage	37.2	1.5e-57
WP_011971563.1|2045328_2045733_+	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	36.2	2.3e-14
WP_011971564.1|2045788_2046043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971565.1|2046103_2046427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011971566.1|2046535_2048293_+|tail	tail tape measure protein	tail	A0A1C9M1I4	Mycobacterium_phage	35.1	1.8e-10
WP_011971567.1|2048305_2048896_+	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	30.5	4.7e-08
WP_157047354.1|2048895_2049222_+	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	50.5	3.3e-19
WP_011971569.1|2049208_2049985_+	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	34.7	1.7e-42
WP_011971570.1|2049981_2050278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047130.1|2050274_2050640_+	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	41.4	3.7e-11
WP_011971572.1|2050632_2051820_+	hypothetical protein	NA	A0A1L2JY69	Aeribacillus_phage	45.2	2.9e-89
WP_011971573.1|2051812_2052442_+	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	47.9	1.5e-44
WP_011971574.1|2052452_2053022_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	49.1	1.3e-10
WP_011971575.1|2053023_2053272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047131.1|2053255_2053399_+	XkdX family protein	NA	NA	NA	NA	NA
WP_012063122.1|2055024_2055630_+	lipase	NA	NA	NA	NA	NA
WP_012063123.1|2055643_2057050_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	35.6	1.3e-64
>prophage 11
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	2426714	2490791	4929566	terminase,holin,head,tRNA,capsid,tail,integrase,protease,plate,portal	Clostridium_phage(35.71%)	82	2447077:2447097	2493031:2493051
WP_012063487.1|2426714_2427974_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041720720.1|2427981_2429760_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	26.6	6.4e-16
WP_012063489.1|2429912_2430221_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_041720722.1|2430545_2431298_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_012063491.1|2431366_2431792_+	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_157047398.1|2431833_2432280_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_012063493.1|2432279_2433065_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012063494.1|2433263_2434496_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	50.0	3.4e-93
WP_012063495.1|2434681_2436109_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012063496.1|2436411_2437458_+	dihydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_157047399.1|2437587_2437692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063498.1|2437772_2439200_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
WP_012063499.1|2439219_2439585_+	ornithine aminomutase	NA	NA	NA	NA	NA
WP_012063500.1|2439584_2441795_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012063501.1|2441784_2443149_+	methylaspartate mutase	NA	NA	NA	NA	NA
WP_041720726.1|2443153_2444233_+	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012063503.1|2444299_2445310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063504.1|2445410_2445833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063505.1|2445807_2446863_-	hypothetical protein	NA	NA	NA	NA	NA
2447077:2447097	attL	CTATATGTACGAAACTACTGA	NA	NA	NA	NA
WP_012063506.1|2447090_2448680_-	resolvase	NA	A0A1L2BY67	Clostridium_phage	43.0	4.0e-110
WP_012063507.1|2449332_2449704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063508.1|2450044_2450680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063509.1|2451494_2452295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047238.1|2452928_2454239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063511.1|2454772_2455861_+	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	30.4	5.8e-20
WP_012063512.1|2455872_2458221_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_012063513.1|2458283_2458736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047239.1|2458728_2459202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063515.1|2459438_2459993_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012063516.1|2460004_2460688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041720729.1|2460850_2461072_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012063518.1|2461107_2461374_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049765250.1|2461436_2461814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063520.1|2461857_2462037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063521.1|2462300_2462570_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083760975.1|2462506_2462965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063524.1|2463165_2463492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063525.1|2463554_2464295_+	DUF2303 family protein	NA	I3VYY2	Thermoanaerobacterium_phage	46.8	7.9e-53
WP_012063526.1|2464432_2464912_+	hypothetical protein	NA	A6M985	Geobacillus_virus	56.8	1.7e-43
WP_157047240.1|2464916_2465357_+	hypothetical protein	NA	A0A0A7RTS3	Clostridium_phage	35.1	1.3e-07
WP_157047241.1|2465367_2465517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085938823.1|2465655_2465931_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_012063530.1|2465950_2466172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063531.1|2466183_2466375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041720734.1|2466450_2466891_-	hypothetical protein	NA	A0A2H4J9F0	uncultured_Caudovirales_phage	58.2	2.5e-46
WP_012063533.1|2467041_2467227_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_012063534.1|2467762_2468236_+	sigma factor	NA	NA	NA	NA	NA
WP_041720736.1|2468334_2468544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041720738.1|2468787_2469198_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_012063536.1|2469285_2469894_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L2BY87	Clostridium_phage	59.2	2.6e-62
WP_012063537.1|2470252_2470903_+	YqaS	NA	A0A0A8WFS6	Clostridium_phage	47.1	1.9e-34
WP_012063538.1|2470904_2471585_+	hypothetical protein	NA	A0A023J2U4	Lactococcus_phage	34.7	8.7e-06
WP_157047242.1|2471619_2472015_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	37.8	4.4e-10
WP_157047400.1|2472119_2473757_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	34.2	2.4e-78
WP_157047243.1|2473768_2473933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049765340.1|2473981_2475181_+|portal	phage portal protein	portal	A0A059PAW6	Leuconostoc_phage	25.9	4.5e-05
WP_012063542.1|2475173_2475824_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_012063543.1|2475834_2477124_+|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	47.2	5.1e-63
WP_157047244.1|2477174_2477369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063545.1|2477368_2477650_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	39.3	5.2e-13
WP_012063546.1|2477646_2477976_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012063547.1|2477975_2478407_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012063548.1|2478411_2478831_+	hypothetical protein	NA	J9QE32	Clostridium_phage	32.6	3.5e-05
WP_012063549.1|2478837_2479893_+|terminase	terminase	terminase	A0A0A8WJL8	Clostridium_phage	46.2	4.1e-79
WP_012063550.1|2479908_2480352_+|tail	phage tail tube protein	tail	A0A1V0DZX1	Clostridioides_phage	38.0	6.9e-20
WP_012063551.1|2480354_2480762_+	hypothetical protein	NA	A0A0A8WIB2	Clostridium_phage	33.9	3.2e-11
WP_012063552.1|2480948_2481446_+	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	38.7	2.3e-11
WP_012063553.1|2481541_2482465_+	HNH endonuclease	NA	U5Q199	Bacillus_phage	35.2	1.1e-30
WP_012063554.1|2482692_2484132_+	hypothetical protein	NA	A0A290GHN6	Caldibacillus_phage	37.7	2.0e-15
WP_012063555.1|2484142_2484559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047245.1|2484593_2485547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063557.1|2485547_2485937_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_083760977.1|2485930_2486377_+	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	34.8	3.8e-10
WP_012063559.1|2486369_2487437_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	36.9	4.1e-50
WP_012063560.1|2487429_2487963_+	YmfQ family protein	NA	A0A0A7RUW8	Clostridium_phage	35.4	2.3e-17
WP_012063561.1|2487962_2488235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063562.1|2488234_2488864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063563.1|2488876_2489272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012063564.1|2489264_2489444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157047246.1|2489456_2489582_+	XkdX family protein	NA	NA	NA	NA	NA
WP_012063566.1|2489628_2490072_+|holin	phage holin family protein	holin	A0A1B1P7S2	Bacillus_phage	36.9	1.0e-18
WP_012063567.1|2490068_2490791_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM8	uncultured_phage	42.2	4.0e-33
2493031:2493051	attR	TCAGTAGTTTCGTACATATAG	NA	NA	NA	NA
>prophage 12
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	2571399	2618712	4929566	terminase,transposase,tRNA,tail,integrase,protease,plate,portal	uncultured_Caudovirales_phage(31.58%)	55	2572052:2572067	2601346:2601361
WP_041721626.1|2571399_2571990_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_012063659.1|2572000_2572747_+	chromosome segregation and condensation protein ScpA	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.1	1.6e-05
2572052:2572067	attL	TTCCATCTTTTAGAGA	NA	NA	NA	NA
WP_012063660.1|2572763_2573336_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.0	4.6e-16
WP_012063661.1|2573341_2574187_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_157047252.1|2574265_2574424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063662.1|2575153_2576272_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	23.2	3.3e-10
WP_012063663.1|2576368_2576989_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	2.7e-14
WP_041721570.1|2577207_2578662_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_012063664.1|2578807_2580088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041720773.1|2580132_2580369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063665.1|2580379_2580934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063666.1|2580914_2581520_-	HSR1-like GTP-binding protein	NA	NA	NA	NA	NA
WP_157047403.1|2581520_2582417_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.7	6.0e-55
WP_041721629.1|2582669_2582915_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012063669.1|2582948_2583887_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_012063670.1|2583902_2585816_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.9	2.5e-66
WP_012063671.1|2585855_2588498_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.9	3.4e-45
WP_012063672.1|2588598_2590029_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_083760991.1|2590108_2590435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047404.1|2590415_2590604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063675.1|2590701_2591670_-	sporulation domain-containing protein	NA	A0A2K9V338	Faecalibacterium_phage	69.1	2.8e-66
WP_012063676.1|2591684_2591930_-	membrane protein	NA	A0A0A7RTX0	Clostridium_phage	46.7	3.6e-10
WP_012063677.1|2591999_2593082_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	59.2	9.0e-122
WP_012063678.1|2593404_2593746_-	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	59.3	1.3e-29
WP_041720776.1|2593819_2594881_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	H7BVP1	unidentified_phage	50.0	6.8e-90
WP_012063680.1|2594877_2595231_-	hypothetical protein	NA	A0A0N7ACI4	Bacillus_phage	53.2	3.3e-25
WP_012063682.1|2595394_2595838_-	hypothetical protein	NA	A0A0N7ACL0	Bacillus_phage	39.6	5.3e-20
WP_012063683.1|2595839_2596139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063684.1|2596138_2597035_-	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	39.6	2.6e-26
WP_012063685.1|2597031_2598168_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	46.3	1.4e-77
WP_012063686.1|2598172_2598637_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	49.7	4.7e-35
WP_012063687.1|2598636_2599047_-	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	36.5	4.6e-10
WP_012063688.1|2599033_2599987_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	45.0	7.8e-61
WP_012063689.1|2599992_2600643_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	40.8	3.4e-31
WP_083761099.1|2600653_2602786_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	33.4	1.3e-52
2601346:2601361	attR	TTCCATCTTTTAGAGA	NA	NA	NA	NA
WP_012063692.1|2603241_2603691_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	66.2	3.5e-43
WP_012063693.1|2603707_2604118_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.7	1.5e-45
WP_012063694.1|2604135_2605548_-|portal	phage portal protein	portal	A0A2H4J1N7	uncultured_Caudovirales_phage	53.8	5.6e-148
WP_012063695.1|2605550_2605781_-	hypothetical protein	NA	A0A2H4J7J8	uncultured_Caudovirales_phage	47.7	9.1e-08
WP_012063696.1|2605792_2606611_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	48.5	3.8e-72
WP_012063697.1|2606621_2607032_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	54.7	9.8e-37
WP_012063698.1|2607031_2607409_-	hypothetical protein	NA	B6SBT3	Clostridium_virus	40.3	2.4e-21
WP_012063699.1|2607408_2607729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063700.1|2607769_2608804_-	hypothetical protein	NA	A0A0A8WEW9	Clostridium_phage	61.5	9.8e-126
WP_012063701.1|2608815_2609226_-	DUF2190 family protein	NA	A0A0A8WJN5	Clostridium_phage	55.6	2.3e-30
WP_012063702.1|2609244_2610621_-	hypothetical protein	NA	A0A0A8WFF1	Clostridium_phage	54.5	1.4e-127
WP_012063703.1|2610638_2611655_-	hypothetical protein	NA	A0A1J1GF13	Clostridium_phage	47.2	4.7e-88
WP_012063704.1|2611647_2613144_-|portal	phage portal protein	portal	A0A0A8WI73	Clostridium_phage	68.9	3.3e-199
WP_012063705.1|2613136_2614546_-	DEAD/DEAH box helicase family protein	NA	A0A0A8WEW2	Clostridium_phage	76.3	8.8e-210
WP_157047253.1|2614538_2615444_-|terminase	terminase	terminase	A0A0A8WJN3	Clostridium_phage	51.1	7.0e-43
WP_041720779.1|2615436_2615715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063708.1|2615671_2616946_-	lactate dehydrogenase	NA	A0A2I4R670	Erysipelothrix_phage	55.9	1.6e-130
WP_012063709.1|2617035_2617530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047254.1|2617540_2618242_-	hypothetical protein	NA	D7RWH3	Brochothrix_phage	38.1	8.9e-38
WP_012063711.1|2618295_2618712_-	single-stranded DNA-binding protein	NA	A0A0A8WIG9	Clostridium_phage	45.5	9.7e-24
>prophage 13
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	2622383	2632307	4929566		Clostridium_phage(20.0%)	18	NA	NA
WP_049765342.1|2622383_2622680_-	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	60.0	1.5e-18
WP_012063723.1|2622898_2623117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063724.1|2623128_2623506_-	DUF1064 domain-containing protein	NA	A0A0A8WFH8	Clostridium_phage	51.4	2.0e-23
WP_083761100.1|2623658_2624330_-	HNH endonuclease	NA	A0A1S5SEZ9	Streptococcus_phage	42.9	5.5e-37
WP_012063726.1|2624449_2624683_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	62.2	2.0e-18
WP_012063727.1|2624682_2625435_-	cell division protein ZapE	NA	A0A1B1P7U2	Bacillus_phage	33.5	2.5e-22
WP_049765259.1|2625556_2626360_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_012063729.1|2626359_2627100_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	47.8	3.6e-61
WP_012063730.1|2627100_2627895_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	55.7	6.7e-66
WP_012063731.1|2627916_2628117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063732.1|2628131_2630084_-	AAA family ATPase	NA	A0A0A0RNI0	Bacillus_phage	32.3	6.7e-67
WP_012063733.1|2630080_2630407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063735.1|2630544_2630697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041720785.1|2630715_2630922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047256.1|2630896_2631058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012063738.1|2631092_2631317_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012063739.1|2631516_2631879_+	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	40.6	2.1e-11
WP_012063740.1|2631956_2632307_+	hypothetical protein	NA	S6B1J4	Thermus_phage	59.5	5.4e-28
>prophage 14
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	3388306	3455733	4929566	tRNA,coat,protease,transposase	Streptococcus_phage(21.05%)	60	NA	NA
WP_012064428.1|3388306_3389170_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	30.7	6.7e-27
WP_012064429.1|3389391_3390948_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	9.8e-53
WP_157047277.1|3391040_3391331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064431.1|3391509_3392586_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012064433.1|3393009_3393372_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_012064435.1|3393547_3393748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064436.1|3393734_3394676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041721783.1|3394942_3397264_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_012064438.1|3397260_3398103_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
WP_012064439.1|3398095_3398560_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012064440.1|3398638_3398911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064441.1|3399304_3401485_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.7	2.2e-50
WP_012064442.1|3401616_3402294_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012064443.1|3402450_3404100_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	3.2e-62
WP_083761026.1|3404561_3405233_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012064445.1|3405439_3406138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064446.1|3406319_3406817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064447.1|3407036_3407267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064448.1|3407831_3408038_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_012064449.1|3408037_3408265_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012064450.1|3408472_3409363_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	38.3	3.3e-53
WP_012064451.1|3409665_3410181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047278.1|3410347_3411313_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-17
WP_157047279.1|3411285_3411654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012062311.1|3411911_3413969_+	serine recombinase	NA	NA	NA	NA	NA
WP_012062310.1|3413926_3414370_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_012064453.1|3415637_3416369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064454.1|3416814_3417999_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012064455.1|3418351_3418576_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012064456.1|3418572_3418965_+	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	34.8	1.5e-13
WP_012064457.1|3419160_3419724_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012064458.1|3420096_3420615_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	35.1	2.4e-24
WP_012064459.1|3420834_3421851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041720955.1|3422052_3422400_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012064461.1|3422402_3422672_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	39.1	1.6e-08
WP_012064462.1|3423178_3424765_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.4	8.2e-55
WP_012064463.1|3424916_3426851_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	29.4	4.5e-47
WP_083761027.1|3426920_3429326_-	homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_012064465.1|3429267_3429948_-	methionine synthase	NA	NA	NA	NA	NA
WP_012064466.1|3429971_3430856_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_157047422.1|3430869_3432150_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	24.1	3.7e-13
WP_157047423.1|3433156_3433804_+	hypothetical protein	NA	A0A0E3JT82	Bacillus_phage	50.4	3.5e-28
WP_012064469.1|3433913_3437141_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012064470.1|3437185_3438268_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	1.1e-53
WP_012064471.1|3438267_3439467_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.5e-29
WP_012064472.1|3439381_3440332_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_012064473.1|3440344_3441565_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_012064474.1|3441593_3442634_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_012064475.1|3442911_3443367_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_012064476.1|3443515_3444088_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_012064477.1|3444191_3445517_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_041720958.1|3445760_3447194_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_012064479.1|3447193_3448669_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_012064480.1|3448708_3448993_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_041721788.1|3449008_3450301_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2K9L424	Tupanvirus	34.5	1.8e-68
WP_012064482.1|3450796_3451159_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012064483.1|3451228_3452485_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	41.7	8.7e-76
WP_041720960.1|3452878_3454084_+|tRNA	alanyl-tRNA editing protein AlaX-L	tRNA	NA	NA	NA	NA
WP_012064485.1|3454213_3455335_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	42.7	3.3e-74
WP_041720962.1|3455331_3455733_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	66.7	2.3e-46
>prophage 15
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	3906737	3952364	4929566	holin,transposase	Bacillus_phage(28.57%)	41	NA	NA
WP_012064872.1|3906737_3907499_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012064873.1|3907812_3909300_-	xylulokinase	NA	NA	NA	NA	NA
WP_012064874.1|3909333_3910512_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_012064875.1|3910667_3911981_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012064876.1|3911955_3913182_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012064877.1|3913197_3914760_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	1.2e-10
WP_012064878.1|3914862_3915960_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012064879.1|3916246_3917296_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_049765303.1|3917442_3918000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064881.1|3918355_3921295_-	copper amine oxidase	NA	A0A142KBU8	Gordonia_phage	30.6	1.3e-05
WP_012064882.1|3921710_3922817_-	response regulator	NA	NA	NA	NA	NA
WP_012064883.1|3922852_3924571_-	histidine kinase	NA	NA	NA	NA	NA
WP_041721863.1|3924799_3926176_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012064885.1|3926239_3927991_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.1e-39
WP_012064886.1|3927983_3929813_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.1e-34
WP_012064887.1|3930065_3931061_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041721865.1|3931671_3931995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064890.1|3932060_3932543_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012064892.1|3933132_3933879_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012064893.1|3933940_3934207_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012064894.1|3934392_3935514_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	42.7	3.3e-74
WP_041720962.1|3935510_3935912_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	66.7	2.3e-46
WP_157047295.1|3936003_3936357_-	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	37.8	7.7e-06
WP_011971585.1|3936630_3938505_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157047296.1|3938913_3939123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064896.1|3939124_3939868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064897.1|3940077_3940377_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_012064898.1|3940400_3941057_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_012064899.1|3941057_3942584_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_012064900.1|3942620_3943220_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_012064901.1|3943236_3943917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064902.1|3943962_3944511_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_012064903.1|3944503_3945841_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_012064904.1|3945856_3946120_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_012064905.1|3946097_3946418_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_012064906.1|3946431_3947277_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_012064907.1|3947258_3947897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064908.1|3947907_3948357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012064909.1|3948353_3948707_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_012064910.1|3948748_3949696_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_012064911.1|3949826_3952364_-|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
>prophage 16
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	4066800	4178486	4929566	terminase,holin,head,capsid,transposase,tail,protease,portal	Erysipelothrix_phage(67.24%)	107	NA	NA
WP_157047161.1|4066800_4068375_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.5	2.5e-19
WP_012062302.1|4068362_4069106_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	40.7	1.6e-48
WP_157047160.1|4069124_4069319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012065011.1|4070749_4073707_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012065012.1|4073703_4074288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065013.1|4074284_4076171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065014.1|4076456_4077236_-	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_012065015.1|4077228_4077468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065016.1|4077497_4078811_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	42.5	2.1e-16
WP_012065017.1|4078892_4079423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065018.1|4081842_4082256_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	46.0	5.3e-22
WP_012065019.1|4082268_4083138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065020.1|4083529_4084306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065021.1|4084308_4085145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065022.1|4085343_4086234_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_157047313.1|4086485_4086740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065024.1|4089065_4089563_-	PcfB family protein	NA	NA	NA	NA	NA
WP_012065025.1|4089619_4090579_-	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	35.3	5.0e-15
WP_012065026.1|4090585_4091545_-	nuclease	NA	NA	NA	NA	NA
WP_012065027.1|4091531_4092320_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.0	8.8e-18
WP_012065029.1|4092842_4093907_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012065030.1|4094015_4095926_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.6	6.7e-120
WP_012065031.1|4096054_4096213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065032.1|4096289_4096628_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	42.6	3.5e-08
WP_012065033.1|4096842_4097322_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_157047314.1|4097535_4099137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065036.1|4099150_4099828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065037.1|4099843_4100068_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012065038.1|4100211_4101774_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.3	3.1e-240
WP_012065039.1|4101775_4102192_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	81.8	3.8e-60
WP_012065040.1|4102192_4103758_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	79.3	4.2e-237
WP_026478190.1|4103819_4104035_-	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	78.6	2.9e-24
WP_041721902.1|4104090_4106031_-	XRE family transcriptional regulator	NA	A0A2K5B2B0	Erysipelothrix_phage	77.9	1.7e-304
WP_012065043.1|4106027_4106537_-	NUMOD4 domain-containing protein	NA	W5RV07	Staphylococcus_phage	34.5	2.6e-18
WP_012065044.1|4106610_4107162_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	87.4	9.3e-91
WP_012065045.1|4107167_4108304_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	85.7	1.7e-192
WP_041721141.1|4108296_4108614_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	79.0	2.9e-36
WP_012065048.1|4108949_4109639_-	amidase	NA	H7BVK7	unidentified_phage	39.6	5.9e-42
WP_012065049.1|4109667_4110084_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	63.7	1.5e-45
WP_012065050.1|4110167_4111241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065051.1|4111252_4112380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065052.1|4112398_4114669_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	60.9	1.4e-20
WP_012065054.1|4114921_4115332_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.0	2.8e-39
WP_012065055.1|4115346_4116228_-|tail	phi13 family phage major tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.5	9.4e-77
WP_012065056.1|4116228_4116573_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	47.3	2.0e-22
WP_012065057.1|4116569_4117001_-	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	60.8	4.3e-43
WP_012065058.1|4116993_4117326_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	64.2	2.2e-31
WP_012065059.1|4117328_4117637_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	79.4	6.4e-41
WP_012065060.1|4117655_4117868_-	hypothetical protein	NA	A0A2K5B289	Erysipelothrix_phage	68.9	4.0e-18
WP_012065061.1|4117880_4119089_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	98.8	1.3e-222
WP_012065062.1|4119108_4119807_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	97.0	6.4e-113
WP_041721144.1|4119806_4121060_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	98.1	8.5e-241
WP_012065064.1|4121136_4121547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065065.1|4121597_4121996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041721147.1|4122081_4123683_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	98.1	1.2e-311
WP_012065067.1|4123789_4124014_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	93.2	3.8e-35
WP_012065068.1|4124028_4124385_-	hypothetical protein	NA	A0A2K5B283	Erysipelothrix_phage	94.9	7.2e-60
WP_012065069.1|4124495_4124807_-	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	95.1	2.4e-51
WP_012065070.1|4124809_4125052_-	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	93.8	3.1e-38
WP_012065071.1|4125035_4125710_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	89.4	7.6e-111
WP_012065072.1|4125792_4127028_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	97.6	3.0e-238
WP_012065073.1|4127024_4128206_-	methionine adenosyltransferase	NA	A0A2K5B278	Erysipelothrix_phage	96.2	1.9e-218
WP_012065074.1|4128227_4128779_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	99.5	6.9e-102
WP_012065075.1|4128869_4129244_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	95.0	2.7e-65
WP_012065076.1|4129375_4130014_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_012065077.1|4130000_4130438_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	29.5	1.0e-07
WP_012065078.1|4130434_4130656_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	71.2	1.4e-21
WP_012065080.1|4132006_4132516_-	HNH endonuclease	NA	A0A2I7QIM4	Bacillus_phage	41.4	2.4e-24
WP_012065081.1|4132493_4132778_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	90.0	7.3e-39
WP_012065082.1|4132928_4135277_-	virulence-associated E family protein	NA	A0A2K5B271	Erysipelothrix_phage	94.8	0.0e+00
WP_012065083.1|4135346_4135778_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	77.1	3.5e-61
WP_012065084.1|4135764_4135986_-	hypothetical protein	NA	A0A2K5B269	Erysipelothrix_phage	80.8	5.3e-29
WP_012065085.1|4136000_4136663_-	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	85.9	6.1e-105
WP_012065086.1|4136727_4137255_-	hypothetical protein	NA	A0A2K5B267	Erysipelothrix_phage	38.8	1.2e-23
WP_012065087.1|4137625_4139212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065088.1|4139186_4139939_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012065089.1|4139931_4143057_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	27.3	1.2e-52
WP_012065090.1|4143070_4144222_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012065091.1|4144215_4146909_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.7	1.4e-62
WP_012065092.1|4146940_4147153_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012065093.1|4147471_4148830_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	3.0e-106
WP_012065094.1|4149072_4150359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012065095.1|4150522_4151530_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012065096.1|4151550_4151946_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_041721154.1|4152143_4152572_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012065098.1|4152752_4152989_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012065099.1|4153078_4154251_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012065100.1|4154250_4155960_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012065101.1|4156251_4158012_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	38.0	2.0e-09
WP_012065102.1|4158028_4158988_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012065103.1|4159082_4159274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065104.1|4159661_4163129_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	40.9	5.3e-224
WP_012065105.1|4163134_4166068_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012065106.1|4166227_4167124_-	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_012065107.1|4167152_4169180_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_157047315.1|4169395_4170067_+	AAA family ATPase	NA	A0A2K9VCW4	Lactobacillus_phage	28.6	4.4e-10
WP_049765360.1|4170075_4170750_+	deoxycytidine kinase	NA	A0A0M3UL55	Enterococcus_phage	37.1	4.6e-23
WP_012065110.1|4170836_4171307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047316.1|4171475_4171991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047160.1|4172065_4172260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012062302.1|4172278_4173022_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	40.7	1.6e-48
WP_157047161.1|4173009_4174584_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.5	2.5e-19
WP_012065112.1|4174632_4175313_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041721912.1|4175686_4176262_+	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_157047317.1|4176661_4176826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065114.1|4177198_4178053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049765312.1|4178156_4178486_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NC_009633	Alkaliphilus metalliredigens QYMF, complete genome	4929566	4479273	4500031	4929566	terminase,tail,head	Deep-sea_thermophilic_phage(21.05%)	31	NA	NA
WP_011971574.1|4479273_4479843_-	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	49.1	1.3e-10
WP_011971573.1|4479853_4480483_-	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	47.9	1.5e-44
WP_011971572.1|4480475_4481663_-	hypothetical protein	NA	A0A1L2JY69	Aeribacillus_phage	45.2	2.9e-89
WP_157047130.1|4481655_4482021_-	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	41.4	3.7e-11
WP_011971570.1|4482017_4482314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971569.1|4482310_4483087_-	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	34.7	1.7e-42
WP_157047354.1|4483073_4483400_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	50.5	3.3e-19
WP_011971567.1|4483399_4483990_-	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	30.5	4.7e-08
WP_011971566.1|4484002_4485760_-|tail	tail tape measure protein	tail	A0A1C9M1I4	Mycobacterium_phage	35.1	1.8e-10
WP_011971565.1|4485868_4486192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971564.1|4486252_4486507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971563.1|4486562_4486967_-	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	36.2	2.3e-14
WP_011971562.1|4486978_4487983_-	DUF3383 family protein	NA	E5DV56	Deep-sea_thermophilic_phage	37.2	1.5e-57
WP_011971561.1|4487994_4488501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971560.1|4488497_4488860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971559.1|4488856_4489459_-	hypothetical protein	NA	A8ATG9	Listeria_phage	48.0	9.7e-41
WP_011971558.1|4489471_4489804_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_011971557.1|4489806_4490139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971556.1|4490154_4491069_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	43.5	5.4e-59
WP_011971555.1|4491091_4491592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041720248.1|4491607_4492744_-	DUF2213 domain-containing protein	NA	H2BCR3	Synechococcus_phage	28.0	1.2e-15
WP_011971553.1|4492724_4493507_-|head	head morphogenesis protein	head	A0A2I7RZ42	Vibrio_phage	31.8	5.1e-18
WP_157047330.1|4493499_4494876_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	34.6	1.3e-64
WP_011971551.1|4494866_4496324_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	46.6	1.4e-109
WP_011971550.1|4496580_4497069_-	antiterminator LoaP	NA	NA	NA	NA	NA
WP_012065362.1|4497082_4497256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012065363.1|4497230_4497650_-	DUF3486 family protein	NA	A0A2H4JAV3	uncultured_Caudovirales_phage	40.3	1.7e-23
WP_157047353.1|4497649_4497928_-	hypothetical protein	NA	A0A2K9VH10	Faecalibacterium_phage	37.2	5.3e-10
WP_011971547.1|4497944_4498238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011971545.1|4498889_4499204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083760799.1|4499257_4500031_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JU23	Anoxybacillus_phage	37.8	7.1e-28
