The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009655	Actinobacillus succinogenes 130Z, complete genome	2319663	888142	895999	2319663		Enterobacteria_phage(42.86%)	10	NA	NA
WP_012072574.1|888142_889204_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.2	3.4e-105
WP_012072575.1|889222_889669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012072576.1|889661_889955_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012072577.1|889969_890845_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.9	5.4e-109
WP_012072578.1|890927_891803_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	6.7e-43
WP_012072579.1|891814_892381_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_012072580.1|892382_892925_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	6.9e-54
WP_041834734.1|893004_894297_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	31.6	1.0e-31
WP_012072582.1|894298_894724_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	2.5e-19
WP_012072583.1|894847_895999_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.0	4.0e-128
>prophage 2
NC_009655	Actinobacillus succinogenes 130Z, complete genome	2319663	1360850	1444643	2319663	protease,holin,head,capsid,portal,integrase,tRNA,terminase,tail	Mannheimia_phage(21.43%)	92	1361612:1361633	1402661:1402682
WP_012072945.1|1360850_1361567_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
1361612:1361633	attL	TGGTGGAGCTGGCGGGAGTTGA	NA	NA	NA	NA
WP_012072946.1|1361709_1361895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041834629.1|1362236_1362473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012072947.1|1362485_1362980_-	methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	63.3	2.5e-58
WP_012072948.1|1363211_1363880_-	DUF1071 domain-containing protein	NA	O48509	Lactococcus_phage	33.3	6.8e-19
WP_041834766.1|1363876_1364527_-	ribonuclease H	NA	NA	NA	NA	NA
WP_041834631.1|1365626_1366094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012072950.1|1366600_1366918_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012072951.1|1366910_1367201_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	48.8	2.2e-14
WP_041834632.1|1367283_1368363_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012072953.1|1368375_1368717_-	killer suppression protein	NA	NA	NA	NA	NA
WP_012072954.1|1368949_1369636_-	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	35.8	1.0e-30
WP_012072955.1|1369761_1369965_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	51.6	1.5e-09
WP_012072956.1|1370013_1370457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041834633.1|1370533_1370791_+	hypothetical protein	NA	A0A088FAW9	Sulfitobacter_phage	47.7	2.7e-08
WP_049752184.1|1370787_1371309_+	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	36.4	1.1e-11
WP_083757689.1|1371305_1371632_+	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	56.6	1.1e-25
WP_012072958.1|1371631_1372288_+	replication P family protein	NA	A0A0M3LS65	Mannheimia_phage	41.0	2.0e-31
WP_012072959.1|1372297_1372813_+	DNA N-6-adenine-methyltransferase	NA	D0UIL3	Aggregatibacter_phage	73.9	4.2e-69
WP_012072960.1|1372779_1373415_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.1	7.1e-18
WP_012072961.1|1373539_1373830_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	84.8	8.5e-43
WP_012072962.1|1373826_1374192_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	54.1	2.2e-32
WP_012072963.1|1374206_1374557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041834634.1|1374720_1375089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041834635.1|1375103_1376603_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	43.7	2.0e-42
WP_012072965.1|1376898_1377819_+	antirepressor protein	NA	A0A2H4FRZ6	Salmonella_phage	45.2	1.2e-61
WP_012072966.1|1377974_1378553_-	hypothetical protein	NA	A0A0M3LS77	Mannheimia_phage	55.2	3.5e-56
WP_012072967.1|1378790_1379180_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	43.0	2.3e-11
WP_143228885.1|1379142_1379748_+	peptidoglycan-binding protein LysM	NA	A0A223VZY5	Agrobacterium_phage	32.4	1.2e-14
WP_041834636.1|1379842_1380190_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_012072970.1|1380386_1380635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012072971.1|1380615_1380966_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	62.6	8.9e-39
WP_012072972.1|1381081_1381576_+|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	40.6	4.1e-21
WP_012072973.1|1381563_1383267_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	71.7	3.0e-244
WP_012072975.1|1383412_1384633_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	61.5	6.1e-143
WP_012072976.1|1384625_1385228_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	70.3	2.9e-77
WP_012072977.1|1385292_1386519_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.0	2.2e-148
WP_012072978.1|1386567_1386888_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	34.9	1.5e-11
WP_012072979.1|1386884_1387202_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	45.7	4.8e-15
WP_012072980.1|1387201_1387684_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	33.3	1.1e-13
WP_012072981.1|1387685_1388030_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012072982.1|1388033_1388690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012072983.1|1388750_1389158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083757704.1|1389232_1389433_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_012072985.1|1389477_1389735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012072986.1|1389791_1393088_+	tape measure protein	NA	A0A0E3JQ03	Enterobacteria_phage	27.9	1.6e-65
WP_012072987.1|1393097_1393433_+|tail	phage tail protein	tail	D6PGG4	uncultured_phage	27.6	2.1e-05
WP_012072988.1|1393432_1394170_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	50.8	6.9e-65
WP_012072989.1|1394171_1394951_+	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	50.6	6.2e-64
WP_041834638.1|1394968_1395493_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	48.5	1.6e-31
WP_012072991.1|1395563_1399535_+|tail	phage tail protein	tail	A0A0M3LR06	Mannheimia_phage	56.5	1.1e-10
WP_012072992.1|1399531_1399813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041834639.1|1399814_1400810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012072994.1|1400822_1401161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041834640.1|1401198_1402518_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	30.6	1.7e-42
WP_012072996.1|1403088_1403412_-	YciU family protein	NA	NA	NA	NA	NA
1402661:1402682	attR	TGGTGGAGCTGGCGGGAGTTGA	NA	NA	NA	NA
WP_012072997.1|1403421_1404237_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_012072998.1|1404351_1405251_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_012072999.1|1405481_1406168_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_012073000.1|1406160_1407105_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_083757690.1|1407104_1410167_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_012073003.1|1410470_1411289_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012073004.1|1411389_1412439_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012073005.1|1412697_1414893_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.1e-118
WP_012073006.1|1414962_1416405_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	3.6e-33
WP_012073007.1|1416427_1417429_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	2.4e-52
WP_012073008.1|1417479_1418067_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	39.6	2.0e-35
WP_012073009.1|1418077_1419619_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_012073010.1|1419850_1420777_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	3.5e-13
WP_012073011.1|1420773_1421541_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012073012.1|1421619_1422681_+|protease	protease SohB	protease	A0A219YA27	Aeromonas_phage	25.2	9.4e-07
WP_012073013.1|1422812_1423661_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012073014.1|1423899_1425045_+	hydrogenase 2 small subunit	NA	NA	NA	NA	NA
WP_012073015.1|1425064_1426057_+	hydrogenase 2 operon protein HybA	NA	NA	NA	NA	NA
WP_012073016.1|1426049_1427261_+	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_012073017.1|1427276_1428986_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_012073018.1|1428985_1429474_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_012073019.1|1429482_1429989_+	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_012073020.1|1430014_1430287_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_012073021.1|1430488_1432924_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_012073022.1|1432938_1433682_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012073023.1|1433678_1435742_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_012073024.1|1435763_1436603_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_012073025.1|1436603_1437278_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_083757705.1|1437318_1437726_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_049752185.1|1437882_1438266_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_012073028.1|1438454_1439357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012073029.1|1439370_1440384_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_012073030.1|1440423_1440717_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_012073031.1|1441745_1443149_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	38.3	7.4e-84
WP_012073032.1|1443395_1444049_+	GTP cyclohydrolase I FolE	NA	I6XC45	Vibriophage	50.2	3.5e-52
WP_012073033.1|1444151_1444643_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
