The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	221610	267469	2887297	portal,protease,head,integrase,capsid,terminase,tail	Brucella_phage(51.28%)	66	210193:210208	260022:260037
210193:210208	attL	GTCGGCCATATCGGCA	NA	NA	NA	NA
WP_011982392.1|221610_223545_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	24.6	8.8e-27
WP_010658035.1|223548_224394_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_011982393.1|224744_225806_-|integrase	site-specific integrase	integrase	A0A291AUQ3	Sinorhizobium_phage	59.4	1.6e-123
WP_041544881.1|226079_226343_-	hypothetical protein	NA	X2CXH8	Brucella_phage	95.4	1.8e-44
WP_041544882.1|226345_226540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041544884.1|226536_226728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982394.1|226724_227006_-	hypothetical protein	NA	X2CY09	Brucella_phage	47.1	5.4e-10
WP_011982395.1|226995_227415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982396.1|227411_227555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982397.1|227551_228244_-	hypothetical protein	NA	X2CYA0	Brucella_phage	31.6	2.1e-07
WP_011982398.1|228243_228792_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	41.0	9.4e-27
WP_011982399.1|228781_229150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982400.1|229142_229478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982401.1|229477_230479_-	hypothetical protein	NA	A0A223W084	Agrobacterium_phage	45.9	9.5e-09
WP_011982402.1|230475_230871_-	DUF968 domain-containing protein	NA	NA	NA	NA	NA
WP_011982403.1|230870_232199_-	AAA family ATPase	NA	A0A141GF08	Brucella_phage	84.2	7.0e-209
WP_115179291.1|232201_233044_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A141GF09	Brucella_phage	98.2	5.0e-160
WP_011982405.1|233117_233393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158304315.1|233612_233789_-	hypothetical protein	NA	A0A141GF12	Brucella_phage	94.8	5.3e-24
WP_041544888.1|234390_234696_-	hypothetical protein	NA	A0A2I7RI23	Vibrio_phage	38.0	7.4e-05
WP_011982406.1|234692_234956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982407.1|234955_235294_-	hypothetical protein	NA	A0A141GF16	Brucella_phage	51.3	6.0e-24
WP_157796386.1|235350_235512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982408.1|236089_236443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982409.1|236505_237213_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041545249.1|237299_237494_+	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	56.9	1.2e-08
WP_041544891.1|237490_238366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147284749.1|238346_238865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982413.1|239209_239608_+	hypothetical protein	NA	A0A141GF30	Brucella_phage	96.9	7.2e-61
WP_011982414.1|239683_240187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982415.1|240186_240432_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.0	5.3e-06
WP_086000479.1|240440_240755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982417.1|240754_241210_+	Myb-like DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011982418.1|241308_241998_+	hypothetical protein	NA	A0A141GF33	Brucella_phage	96.1	2.1e-124
WP_011982419.1|241994_243497_+	AAA family ATPase	NA	A0A141GF34	Brucella_phage	98.6	9.1e-282
WP_011982420.1|243798_244650_+	DNA cytosine methyltransferase	NA	A0A1B1IRA0	uncultured_Mediterranean_phage	37.1	8.8e-48
WP_041544895.1|244646_244871_+	DUF3310 domain-containing protein	NA	A0A221J776	Mycobacterium_phage	82.1	5.0e-27
WP_011982421.1|244863_245307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041544897.1|245303_245579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982422.1|245575_246148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043062358.1|246250_246478_+	hypothetical protein	NA	A0A240F4R3	Ochrobactrum_phage	68.4	5.8e-15
WP_036586392.1|247114_247360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041544901.1|247565_247781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982426.1|248114_248381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982427.1|248486_248903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982428.1|248903_250625_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	53.4	3.8e-175
WP_011982429.1|250658_251279_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	50.0	2.1e-35
WP_172488788.1|251278_252700_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	52.3	1.1e-114
WP_158304316.1|252754_252922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982431.1|252918_253137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982433.1|253452_254778_+|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	59.4	3.4e-139
WP_011982434.1|254774_255578_+	hypothetical protein	NA	F8TVA1	EBPR_siphovirus	39.7	2.6e-25
WP_011982435.1|255577_255892_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	38.1	1.2e-13
WP_011982436.1|255895_256246_+|head	phage head closure protein	head	A0A141GEW5	Brucella_phage	91.5	5.8e-54
WP_011982437.1|256250_256691_+	HK97 gp10 family phage protein	NA	A0A141GEW6	Brucella_phage	57.4	2.3e-39
WP_011982438.1|256687_257089_+	DUF3168 domain-containing protein	NA	A0A141GEW7	Brucella_phage	88.6	3.5e-63
WP_041544904.1|257088_257292_+	hypothetical protein	NA	A0A141GEW8	Brucella_phage	95.5	3.0e-31
WP_011982439.1|257370_257826_+|tail	phage tail protein	tail	A0A141GEW9	Brucella_phage	87.8	1.2e-72
WP_011982440.1|257825_258221_+	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	63.2	6.8e-35
WP_167874485.1|258217_258385_+	hypothetical protein	NA	B4UTQ5	Rhizobium_phage	56.0	2.7e-09
WP_011982441.1|258405_260757_+|tail	phage tail length tape measure family protein	tail	B4UTQ6	Rhizobium_phage	33.4	1.8e-90
260022:260037	attR	GTCGGCCATATCGGCA	NA	NA	NA	NA
WP_011982442.1|261101_261779_+	hypothetical protein	NA	A0A141GEX3	Brucella_phage	96.4	1.1e-114
WP_011982443.1|261778_262444_+	hypothetical protein	NA	A0A141GEX4	Brucella_phage	97.2	2.8e-118
WP_115179292.1|263172_263562_+	hypothetical protein	NA	A0A141GEY4	Brucella_phage	80.5	1.4e-61
WP_011982446.1|263552_265325_+	fibronectin type III domain-containing protein	NA	A0A141GEY5	Brucella_phage	95.3	0.0e+00
WP_011982447.1|265390_267469_+	hypothetical protein	NA	A0A141GEY6	Brucella_phage	88.0	7.4e-64
>prophage 2
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	918906	964633	2887297	protease,integrase,tRNA,transposase,tail	Streptococcus_phage(14.29%)	49	918803:918848	935321:935366
918803:918848	attL	TGGTGATCCCGACAGGAATCGAACCTGTGACCTACAGATTAGGAAT	NA	NA	NA	NA
WP_012091094.1|918906_920151_-|integrase	site-specific integrase	integrase	A0A1L6BZH2	Pasteurella_phage	24.7	1.2e-16
WP_012091095.1|920153_920585_-	hypothetical protein	NA	A0A141GEX7	Brucella_phage	45.5	7.4e-19
WP_040129069.1|920702_920897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040129070.1|920976_921741_+	YdaU family protein	NA	NA	NA	NA	NA
WP_012091097.1|921730_922045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091098.1|922479_923508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049768417.1|924113_924389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091100.1|924399_926673_+|tail	phage tail tape measure protein	tail	Q0SPL2	Clostridium_phage	29.3	7.7e-22
WP_049768391.1|926672_926873_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012091101.1|926893_927520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091102.1|927750_928575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091103.1|928576_929080_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_040129072.1|929220_929448_+	hypothetical protein	NA	A0A291AUJ1	Sinorhizobium_phage	55.4	2.4e-13
WP_040130042.1|929457_929829_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040129073.1|929888_930107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091106.1|930107_930359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115179309.1|930815_931727_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.7	3.0e-33
WP_012091108.1|931716_932310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041545003.1|932582_934205_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.2	1.1e-104
WP_011982990.1|934268_934616_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.6	1.5e-14
WP_011982989.1|934612_934987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012091109.1|935511_936675_-	amidohydrolase	NA	NA	NA	NA	NA
935321:935366	attR	TGGTGATCCCGACAGGAATCGAACCTGTGACCTACAGATTAGGAAT	NA	NA	NA	NA
WP_012091110.1|936859_937975_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_012091111.1|937976_939125_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_012091112.1|939128_939365_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010657620.1|939364_940603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010657619.1|940989_941943_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_012091113.1|942078_943002_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	5.6e-32
WP_012091114.1|943004_943241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010657616.1|943415_944006_+	shikimate kinase	NA	NA	NA	NA	NA
WP_012091116.1|944061_945198_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_010657614.1|945315_946623_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_010657613.1|947221_947536_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010657612.1|947722_948352_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_010657611.1|948580_949567_+	cobaltochelatase subunit CobS	NA	L7TKP0	Rhizobium_phage	32.2	8.4e-42
WP_012091117.1|949670_951584_+	cobaltochelatase subunit CobT	NA	J9Q7G6	Salmonella_phage	27.7	8.2e-17
WP_012091118.1|951622_952363_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012091119.1|952591_953242_-	queuosine precursor transporter	NA	A0A2P1CKM9	Pantoea_phage	30.7	4.4e-15
WP_010657607.1|953321_953621_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_012091120.1|954072_954903_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_029375811.1|954920_955343_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012091122.1|955426_957961_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.2	1.2e-129
WP_012091123.1|958012_958519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091124.1|958574_959357_-	hydroxyacylglutathione hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.1	1.1e-07
WP_012091125.1|959373_960036_-	septation protein A	NA	NA	NA	NA	NA
WP_012091126.1|960035_961520_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	32.3	1.0e-14
WP_012091127.1|961541_962825_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_012091128.1|962824_963727_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_010657597.1|964093_964633_+|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
>prophage 3
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	1577006	1604854	2887297	portal,protease,head,plate,terminase,tail	Ochrobactrum_phage(38.89%)	31	NA	NA
WP_012091541.1|1577006_1577246_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_012091542.1|1577242_1577665_-|tail	phage tail protein	tail	A0A1X9SH66	Bradyrhizobium_phage	34.5	3.3e-11
WP_012091543.1|1577686_1580032_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_012091544.1|1580206_1580539_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012091545.1|1580545_1581082_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_012091546.1|1581135_1582641_-	hypothetical protein	NA	A0A193GYC3	Enterobacter_phage	38.4	9.2e-40
WP_041545307.1|1582750_1583575_-	hypothetical protein	NA	A0A240F4S4	Ochrobactrum_phage	62.3	2.8e-91
WP_012091548.1|1583669_1584296_-	hypothetical protein	NA	A0A240F4S3	Ochrobactrum_phage	54.1	3.5e-41
WP_012091549.1|1584295_1585438_-	hypothetical protein	NA	A0A219VH97	Ochrobactrum_phage	35.3	2.6e-47
WP_012091550.1|1585441_1588765_-	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	71.6	0.0e+00
WP_012091551.1|1588773_1589292_-	hypothetical protein	NA	A0A219VHA4	Ochrobactrum_phage	41.9	2.3e-35
WP_012091552.1|1589292_1590099_-|tail	phage tail protein	tail	A0A219VHA2	Ochrobactrum_phage	62.3	7.3e-84
WP_012091553.1|1590098_1590971_-|plate	baseplate J/gp47 family protein	plate	A0A219VH98	Ochrobactrum_phage	51.9	1.6e-76
WP_012091554.1|1591055_1591469_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_041545042.1|1591715_1591979_-	PAAR domain-containing protein	NA	F8SJL9	Pseudomonas_phage	48.1	1.3e-13
WP_041545043.1|1591966_1592194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091555.1|1592193_1592667_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	40.6	2.9e-08
WP_012091556.1|1592663_1593515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091557.1|1593517_1593922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041545045.1|1593922_1594105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091558.1|1594163_1594502_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_012091559.1|1594574_1596665_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7S8L6	Vibrio_phage	31.9	1.3e-81
WP_012091560.1|1596670_1598221_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	37.3	1.8e-70
WP_041545047.1|1598220_1598424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115179306.1|1598432_1600478_-|terminase	phage terminase large subunit family protein	terminase	B0ZSF0	Halomonas_phage	34.0	5.0e-89
WP_041545053.1|1600401_1600974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091562.1|1600973_1601660_-	methyltransferase domain-containing protein	NA	A0A0R6PHT7	Moraxella_phage	45.2	4.5e-50
WP_012091563.1|1601726_1602287_+	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_012091564.1|1602296_1603541_-	DNA cytosine methyltransferase	NA	A0A0R6PHJ5	Moraxella_phage	47.6	1.1e-78
WP_012091565.1|1603542_1604079_-	ParB N-terminal domain-containing protein	NA	K4I3Y2	Acidithiobacillus_phage	53.2	4.7e-31
WP_012091566.1|1604614_1604854_-	hypothetical protein	NA	M4MB75	Vibrio_phage	63.2	1.6e-10
>prophage 4
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	1609896	1620832	2887297		Brucella_phage(33.33%)	20	NA	NA
WP_012091577.1|1609896_1610568_+	hypothetical protein	NA	V5KSW1	Escherichia_phage	51.8	6.8e-11
WP_012091578.1|1610570_1611932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091579.1|1611921_1612335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091580.1|1612324_1612819_+	hypothetical protein	NA	A0A223W0M6	Agrobacterium_phage	40.0	7.7e-28
WP_012091581.1|1612815_1613076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041545065.1|1613068_1613272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091582.1|1613268_1613508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091583.1|1613519_1613978_+	deoxycytidine triphosphate deaminase	NA	W6AQU3	Erwinia_phage	44.9	1.1e-28
WP_049768397.1|1614363_1614609_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_041545071.1|1614687_1614903_-	hypothetical protein	NA	A0A141GEZ2	Brucella_phage	44.4	1.3e-08
WP_012091585.1|1614946_1615624_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_041545073.1|1615630_1615864_-	hypothetical protein	NA	A0A141GF22	Brucella_phage	59.7	1.2e-15
WP_041545074.1|1615865_1616093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091586.1|1616299_1616605_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	47.8	5.1e-06
WP_012091587.1|1616591_1616852_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_012091588.1|1616954_1617473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091589.1|1617501_1619772_-	AAA family ATPase	NA	A0A0F7L738	uncultured_marine_virus	32.3	5.6e-57
WP_012091590.1|1619773_1620085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012091591.1|1620098_1620554_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	71.3	1.0e-42
WP_012091592.1|1620565_1620832_-	hypothetical protein	NA	A0A141GEZ5	Brucella_phage	51.1	9.9e-14
>prophage 6
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	1871415	1885355	2887297	portal,protease,head,integrase,terminase,transposase	Synechococcus_phage(16.67%)	18	1864560:1864577	1891692:1891709
1864560:1864577	attL	CGGCATTGCCTGCAATGA	NA	NA	NA	NA
WP_012091779.1|1871415_1873197_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	34.5	2.2e-96
WP_012091780.1|1873309_1873549_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012091781.1|1873541_1874084_-	hypothetical protein	NA	A0A088FAX8	Idiomarinaceae_phage	33.0	1.5e-16
WP_012091782.1|1874122_1874371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158304326.1|1874456_1874612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040129194.1|1874608_1874845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041545116.1|1874972_1875434_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012091784.1|1875451_1876747_+|portal	phage portal protein	portal	Q9JMM5	Wolbachia_phage	26.8	1.9e-33
WP_012091785.1|1876743_1878519_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_012091786.1|1878521_1878731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012091787.1|1878732_1879059_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_012091788.1|1879069_1879342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982578.1|1879473_1880420_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.2	7.1e-14
WP_040129198.1|1881046_1881754_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010659760.1|1882343_1882655_+	DUF2853 family protein	NA	NA	NA	NA	NA
WP_012091790.1|1882749_1883544_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	66.3	1.2e-102
WP_010659762.1|1883552_1884077_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	45.2	5.3e-27
WP_012091791.1|1884203_1885355_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
1891692:1891709	attR	CGGCATTGCCTGCAATGA	NA	NA	NA	NA
>prophage 7
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	2359407	2476817	2887297	portal,integrase,plate,tRNA,terminase,tail	uncultured_Mediterranean_phage(17.54%)	118	2357375:2357394	2484366:2484385
2357375:2357394	attL	TCAACCAGATCTGCATTGCC	NA	NA	NA	NA
WP_012092120.1|2359407_2362140_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	4.7e-143
WP_012092121.1|2362305_2363085_-	PopZ family protein	NA	NA	NA	NA	NA
WP_010661296.1|2363313_2364693_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_012092123.1|2364836_2365505_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_010661294.1|2365838_2366039_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_012092125.1|2366280_2366925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092126.1|2367115_2367496_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	32.1	1.2e-09
WP_012092127.1|2367519_2367876_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_040129327.1|2367913_2369368_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	8.6e-51
WP_012092129.1|2369667_2370441_-	NAD kinase	NA	NA	NA	NA	NA
WP_010661287.1|2371656_2372076_-	SUF system Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012092130.1|2372072_2373317_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.9	9.1e-102
WP_012092131.1|2373384_2374662_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012092132.1|2374675_2375431_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	26.2	2.8e-05
WP_012092133.1|2375499_2377023_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012092134.1|2377365_2377599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092135.1|2377606_2378767_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.3	1.6e-23
WP_010661280.1|2378962_2379637_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010661279.1|2379771_2380104_+	multidrug transporter	NA	E5E3Y9	Acinetobacter_phage	35.0	2.7e-08
WP_012092136.1|2380358_2381612_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	36.3	1.5e-64
WP_012092137.1|2381665_2385064_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_012092138.1|2385351_2385816_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_012092139.1|2385819_2386647_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012092140.1|2386776_2388129_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	46.6	5.4e-23
WP_105529024.1|2388195_2389324_-	peptide chain release factor 2	NA	G0YKC3	Acinetobacter_phage	52.9	9.4e-05
WP_010661272.1|2389478_2391938_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_036586814.1|2392202_2393441_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	24.9	4.0e-09
WP_010661270.1|2393977_2394163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092143.1|2394165_2396946_+	ribonuclease E/G	NA	NA	NA	NA	NA
WP_040129331.1|2397041_2398205_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012092145.1|2398395_2399811_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012092146.1|2399858_2400665_+	DsbA family protein	NA	NA	NA	NA	NA
WP_010661265.1|2400909_2401383_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_012092148.1|2401384_2401849_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010661263.1|2401893_2403252_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_012092150.1|2403257_2403872_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_010661261.1|2403882_2404353_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_010661260.1|2404550_2404961_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_012092151.1|2405158_2405662_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012092152.1|2405661_2407164_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_012092153.1|2407323_2408781_-	trigger factor	NA	NA	NA	NA	NA
WP_012092154.1|2409171_2410437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092155.1|2410979_2412254_+	type VI secretion protein ImpB	NA	NA	NA	NA	NA
WP_012092156.1|2412258_2412513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092157.1|2412586_2412868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092158.1|2412972_2413398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092159.1|2413635_2414019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092160.1|2414018_2414525_-	lysozyme	NA	A0A0K1Y6F2	Rhodobacter_phage	41.8	2.7e-28
WP_041545154.1|2414514_2414736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092161.1|2414744_2415287_-	hypothetical protein	NA	A0A0F6R516	Sinorhizobium_phage	41.9	1.1e-30
WP_012092162.1|2415314_2416469_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	36.1	1.7e-33
WP_041545155.1|2416500_2417199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092163.1|2417200_2417413_-|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	49.2	3.1e-10
WP_012092164.1|2417417_2417843_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	33.9	3.9e-12
WP_012092165.1|2417842_2420224_-|tail	phage tail tape measure protein	tail	A0A088FV68	Escherichia_phage	36.8	5.2e-53
WP_012092166.1|2420342_2420621_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012092167.1|2420648_2421155_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	34.2	1.0e-19
WP_012092168.1|2421212_2422643_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1X9SGY4	Bradyrhizobium_phage	37.2	1.4e-77
WP_012092169.1|2422694_2423252_-	hypothetical protein	NA	R9TP62	Rhizobium_phage	49.1	1.7e-28
WP_012092170.1|2423261_2424839_-|tail	phage tail protein	tail	R9U0V1	Rhizobium_phage	43.7	1.2e-77
WP_012092171.1|2424843_2425503_-|tail	phage tail protein I	tail	A0A219Y8Y4	Aeromonas_phage	39.1	7.9e-20
WP_012092172.1|2425499_2426549_-|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	32.7	2.1e-27
WP_012092173.1|2426545_2426929_-	GPW/gp25 family protein	NA	A0A193GYY8	Enterobacter_phage	49.0	2.3e-19
WP_158304329.1|2426932_2427103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092174.1|2427120_2427384_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	85.1	8.2e-21
WP_012092175.1|2427383_2427821_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	39.5	1.5e-06
WP_012092176.1|2427820_2428597_-	hypothetical protein	NA	A0A0A8IKZ7	Aurantimonas_phage	43.1	1.6e-40
WP_012092177.1|2428596_2428971_-	hypothetical protein	NA	A0A0A8IN54	Aurantimonas_phage	37.7	3.4e-12
WP_012092178.1|2428976_2429300_-	DUF2190 family protein	NA	A0A2I7S8N5	Vibrio_phage	36.4	9.8e-08
WP_049768403.1|2429368_2431009_-	hypothetical protein	NA	B7SYD7	Stenotrophomonas_phage	29.2	2.6e-35
WP_041545157.1|2431107_2431761_-	hypothetical protein	NA	B7SYD7	Stenotrophomonas_phage	42.9	3.4e-31
WP_012092179.1|2431747_2433280_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.5	6.4e-81
WP_041545160.1|2433279_2433474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092180.1|2433476_2435294_-|terminase	phage terminase large subunit family protein	terminase	D6PFE7	uncultured_phage	32.9	2.3e-69
WP_041545162.1|2435208_2435943_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_012092182.1|2436144_2436714_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	44.5	3.4e-27
WP_080514323.1|2437093_2437750_-	hypothetical protein	NA	A0A068C9G5	Rhizobium_phage	27.0	2.1e-09
WP_012092184.1|2437736_2438915_-	helix-turn-helix domain-containing protein	NA	A0A291AUS5	Sinorhizobium_phage	46.7	7.6e-74
WP_012092185.1|2438914_2439574_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	62.6	5.8e-71
WP_012092186.1|2439570_2440086_-	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	48.4	9.8e-18
WP_012092187.1|2440082_2440364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012092188.1|2440360_2441047_-	NERD domain-containing protein	NA	A0A240F4W5	Ochrobactrum_phage	76.5	3.3e-93
WP_012092189.1|2441046_2442354_-	ParB N-terminal domain-containing protein	NA	A0A0M3LPV8	Mannheimia_phage	39.8	1.2e-24
WP_041545164.1|2442465_2442732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049768424.1|2442728_2443145_-	hypothetical protein	NA	A0A291AUS4	Sinorhizobium_phage	48.3	2.3e-25
WP_041545347.1|2443882_2444578_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041545166.1|2445004_2445235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158304330.1|2445641_2445800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092194.1|2445813_2446098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092195.1|2446090_2447197_+	hypothetical protein	NA	A0A0M4REI4	Salmonella_phage	58.7	5.6e-26
WP_012092196.1|2447431_2447833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092197.1|2447829_2448642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080514344.1|2448638_2449403_+	hypothetical protein	NA	A0A219YFC7	Ochrobactrum_phage	40.0	2.4e-36
WP_012092199.1|2449399_2449780_+	DUF4031 domain-containing protein	NA	R9TSA1	Rhizobium_phage	61.9	6.3e-30
WP_158304331.1|2449776_2449950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012092200.1|2449946_2451311_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012092201.1|2451786_2452356_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_012092202.1|2452352_2453483_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_006466676.1|2453757_2453904_+	DUF1127 domain-containing protein	NA	A0A0F6YPC3	Sinorhizobium_phage	54.5	4.1e-06
WP_012092203.1|2454170_2455601_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_012092204.1|2455653_2456487_-	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_012092205.1|2456491_2456881_-	Mth938-like domain-containing protein	NA	NA	NA	NA	NA
WP_086000491.1|2456883_2459184_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	44.7	1.2e-51
WP_010661250.1|2459326_2459668_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.5	2.4e-12
WP_012092207.1|2459827_2460691_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012092208.1|2460759_2462076_-	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	40.2	8.7e-18
WP_012092209.1|2462258_2462927_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	36.9	3.3e-13
WP_012092210.1|2462930_2463707_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.3	3.4e-38
WP_040130146.1|2463740_2465024_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	1.2e-101
WP_012092212.1|2465099_2465924_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	45.3	1.7e-51
WP_012092213.1|2465920_2466541_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_010661242.1|2466660_2466891_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	67.4	9.1e-08
WP_012092214.1|2467036_2467765_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.9	1.6e-42
WP_012092215.1|2467757_2468609_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.2	5.2e-32
WP_012092216.1|2468682_2469702_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	36.4	3.7e-16
WP_011982869.1|2469855_2471259_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	25.0	3.5e-17
WP_012092217.1|2471766_2474748_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012092218.1|2475059_2476817_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
2484366:2484385	attR	GGCAATGCAGATCTGGTTGA	NA	NA	NA	NA
>prophage 8
NC_009667	Ochrobactrum anthropi ATCC 49188 chromosome 1, complete sequence	2887297	2842538	2864298	2887297	holin,transposase	Leptospira_phage(22.22%)	19	NA	NA
WP_012092477.1|2842538_2844188_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.8	1.9e-62
WP_012092478.1|2844303_2845767_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_086000475.1|2846005_2847093_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	8.1e-46
WP_172488798.1|2847413_2847815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012092479.1|2847819_2849199_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_012092480.1|2849212_2849995_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_012092481.1|2850073_2851489_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.5	5.4e-58
WP_012092482.1|2851492_2852917_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_011982578.1|2853152_2854099_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.2	7.1e-14
WP_012092483.1|2854455_2855334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_012092484.1|2855330_2856407_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.3	3.4e-97
WP_012092485.1|2856416_2856968_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.0	3.5e-29
WP_012092486.1|2856967_2857849_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.5	2.9e-94
WP_012092487.1|2857970_2858807_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_086000495.1|2859108_2859944_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012092489.1|2860012_2860402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012092490.1|2860398_2860743_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.4	4.3e-09
WP_012092492.1|2862379_2862676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041545235.1|2862675_2864298_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.3	5.2e-105
>prophage 1
NC_009668	Ochrobactrum anthropi ATCC 49188 chromosome 2, complete sequence	1895911	1846682	1855564	1895911		Tupanvirus(33.33%)	8	NA	NA
WP_010660578.1|1846682_1848119_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.3	4.9e-83
WP_172488820.1|1848138_1849962_-	glycosyltransferase	NA	M1HYN2	Paramecium_bursaria_Chlorella_virus	37.1	1.3e-75
WP_012093688.1|1849985_1850972_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.4	3.6e-45
WP_080514364.1|1850968_1851937_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	49.5	2.8e-90
WP_029928696.1|1852378_1853083_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012093691.1|1853240_1853972_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_010660572.1|1854059_1854782_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.0	4.0e-09
WP_012093692.1|1854784_1855564_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.1	1.8e-15

>prophage 1
NC_009670	Ochrobactrum anthropi ATCC 49188 plasmid pOANT02, complete sequence	101491	46524	92111	101491	transposase	Salmonella_phage(20.0%)	35	NA	NA
WP_011982980.1|46524_49491_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	41.9	1.0e-212
WP_011982982.1|50161_50785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011982983.1|51181_51505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982984.1|51546_52131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011982985.1|52459_53530_-	response regulator	NA	NA	NA	NA	NA
WP_011982986.1|53526_54105_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
WP_011982987.1|54101_54941_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011982988.1|54937_58363_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.3	5.7e-37
WP_011982989.1|59447_59822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011982990.1|59818_60166_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.3	3.9e-26
WP_041545003.1|60229_61852_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.2	1.1e-104
WP_011982993.1|62344_64459_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.5	9.3e-139
WP_011982994.1|64529_65027_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_147284763.1|65593_65797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041545837.1|66582_66864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158304338.1|66918_67374_-	SOS response-associated peptidase family protein	NA	A0A291AUP1	Sinorhizobium_phage	41.5	1.3e-26
WP_011982997.1|67613_70589_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.6	1.1e-190
WP_049768476.1|70678_71596_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172488833.1|71555_72497_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011983000.1|72493_74191_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.6e-19
WP_011983001.1|74330_75869_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	6.1e-47
WP_024899799.1|75867_77607_+	recombinase family protein	NA	NA	NA	NA	NA
WP_011983003.1|78366_79443_+	catalase family protein	NA	NA	NA	NA	NA
WP_011983004.1|79476_80175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011983005.1|80174_81551_+	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_011983006.1|81602_82457_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_035228312.1|82521_83121_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011983008.1|83187_85167_-	oleate hydratase	NA	NA	NA	NA	NA
WP_011983009.1|85260_86364_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011983010.1|86360_87569_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011983011.1|87571_88564_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_041545839.1|88637_89309_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011983013.1|89410_90610_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_024899803.1|90727_91045_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011983014.1|91019_92111_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	25.5	2.8e-14
>prophage 1
NC_009671	Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence	93589	235	53444	93589	transposase,coat	Salmonella_phage(23.53%)	46	NA	NA
WP_011983025.1|235_1267_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.4	3.2e-07
WP_086000526.1|1379_2140_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	3.1e-12
WP_080514381.1|3265_4420_+	ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_148209300.1|4781_5994_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	48.1	5.6e-64
WP_011983030.1|6082_6781_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011983031.1|7126_8560_+	YfcC family protein	NA	NA	NA	NA	NA
WP_011983032.1|8573_9800_+	arginine deiminase	NA	NA	NA	NA	NA
WP_011983033.1|9810_10812_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011983034.1|10813_11722_+	carbamate kinase	NA	NA	NA	NA	NA
WP_086000527.1|11828_12588_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	3.1e-12
WP_011983025.1|12701_13733_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.4	3.2e-07
WP_011983036.1|14049_14772_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040128197.1|15117_16290_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_011983038.1|16318_18706_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_011983039.1|18743_19736_-|transposase	IS5-like element ISOcan1 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.6	4.3e-46
WP_040128237.1|19877_21722_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.1	1.4e-58
WP_011983041.1|21832_22528_-	VIT family protein	NA	NA	NA	NA	NA
WP_011983042.1|22754_24053_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_011983043.1|24043_24391_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011983044.1|24423_25206_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_080514382.1|26220_26550_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_011983045.1|26585_27179_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.2	9.9e-22
WP_011982975.1|27544_28768_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_011982976.1|28764_29067_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011982977.1|29208_29985_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011982978.1|30161_30665_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_011982979.1|30710_31280_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	48.9	4.1e-33
WP_011983046.1|31423_34390_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	41.9	1.8e-212
WP_011983048.1|35301_36495_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	55.2	2.3e-118
WP_011983049.1|36498_37542_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	36.6	4.9e-56
WP_011983050.1|37696_38920_+	replication initiation protein RepC	NA	NA	NA	NA	NA
WP_011983051.1|39021_39447_+	DUF5086 domain-containing protein	NA	NA	NA	NA	NA
WP_011983052.1|39461_39842_+	DUF2195 family protein	NA	NA	NA	NA	NA
WP_011983053.1|40095_40725_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_011983054.1|40886_41168_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	39.1	2.4e-10
WP_011983055.1|41180_41477_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	41.5	5.1e-11
WP_011983057.1|41855_42368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011983059.1|43739_44378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040128186.1|44472_44790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011983060.1|45874_48841_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.4	2.7e-216
WP_011983061.1|49004_49586_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	52.7	1.4e-44
WP_011983062.1|49744_51319_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	37.1	2.0e-77
WP_011983063.1|51367_51724_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011983064.1|51720_52179_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011983065.1|52207_52924_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011983066.1|52946_53444_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
