The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	1551804	1634499	7659055	transposase,integrase,tRNA	Staphylococcus_phage(22.22%)	60	1572058:1572074	1641582:1641598
WP_012331344.1|1551804_1553118_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_012331345.1|1553318_1555193_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_012331346.1|1555311_1555776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331347.1|1556089_1557250_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_012331348.1|1557331_1557844_+	tryptophan-rich sensory protein	NA	A0A1V0S976	Catovirus	25.2	6.6e-06
WP_012331349.1|1558000_1558918_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_012331350.1|1559035_1561309_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_012331351.1|1561320_1561767_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012331352.1|1562064_1562331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331353.1|1562397_1563222_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.5	4.8e-59
WP_012331354.1|1563302_1564514_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043702119.1|1564659_1565994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331356.1|1566055_1567171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331357.1|1567236_1568403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331358.1|1569003_1569417_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_012331359.1|1569486_1570647_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_012331360.1|1570855_1571734_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012331361.1|1571832_1572270_-	hypothetical protein	NA	NA	NA	NA	NA
1572058:1572074	attL	CTGCTCCAGCTTCAGGA	NA	NA	NA	NA
WP_012331362.1|1572454_1573303_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_012331363.1|1573432_1573954_+	DedA family protein	NA	NA	NA	NA	NA
WP_012331364.1|1574167_1575166_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012331365.1|1575384_1576167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012331366.1|1576243_1577122_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.4e-10
WP_012331367.1|1577188_1577374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331368.1|1577370_1578501_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_050777552.1|1578512_1580711_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012331370.1|1581080_1581557_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_012331371.1|1581678_1582428_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012331372.1|1582424_1583201_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012331373.1|1583351_1584266_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_012331374.1|1584262_1584973_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012331375.1|1585038_1585326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331376.1|1585439_1585763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331377.1|1586209_1587769_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.7	9.0e-06
WP_012330561.1|1588542_1589943_+|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_083784641.1|1590775_1591201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169138.1|1591344_1592145_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012331379.1|1593085_1594006_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.9	1.2e-93
WP_168169139.1|1594045_1594540_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.9	6.8e-08
WP_012331380.1|1595021_1596020_-|transposase	IS110-like element ISMtsp7 family transposase	transposase	NA	NA	NA	NA
WP_168169121.1|1596164_1596305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012331381.1|1596948_1599399_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_012331382.1|1599419_1600535_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_150108597.1|1600531_1602292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012331384.1|1602288_1603581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108598.1|1603742_1605377_+	formyl transferase	NA	NA	NA	NA	NA
WP_012331386.1|1605532_1606696_+	ATP-grasp enzyme-like protein	NA	NA	NA	NA	NA
WP_085984485.1|1607014_1607401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012290057.1|1608536_1609412_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.6	2.1e-52
WP_012290058.1|1609408_1610692_-|transposase	IS21-like element ISMtsp8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.9	1.6e-45
WP_043700930.1|1611138_1611651_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_012331388.1|1612067_1613024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108599.1|1614134_1622417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012331391.1|1622413_1628305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169140.1|1628810_1628966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108600.1|1629225_1629639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012331393.1|1629635_1629992_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012331395.1|1631683_1632202_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012331396.1|1632249_1632780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012331397.1|1632909_1634499_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1641582:1641598	attR	TCCTGAAGCTGGAGCAG	NA	NA	NA	NA
>prophage 2
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	3067002	3124768	7659055	transposase,integrase,tRNA	Bacillus_phage(20.0%)	50	3119243:3119302	3137680:3137763
WP_012332602.1|3067002_3067944_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012332603.1|3068035_3070150_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012332604.1|3070514_3072278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332607.1|3073218_3073527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332608.1|3073810_3074005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043701194.1|3074613_3075408_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012332610.1|3075488_3075644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332611.1|3075906_3076092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332612.1|3076100_3076319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332613.1|3076569_3076725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332614.1|3076801_3077047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332615.1|3077384_3078092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332616.1|3078143_3078731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108830.1|3079702_3080500_-	FkbM family methyltransferase	NA	A0A2N9QVW1	Dishui_lake_phycodnavirus	36.5	3.9e-13
WP_018260759.1|3080780_3081071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332619.1|3081661_3082501_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_150108646.1|3083097_3083352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332620.1|3083478_3084456_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012332621.1|3084667_3084850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332622.1|3085229_3086750_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_168169153.1|3087418_3088657_+	amidase	NA	NA	NA	NA	NA
WP_168169154.1|3088698_3089628_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012332625.1|3089624_3091025_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_083784805.1|3091216_3091399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332626.1|3092751_3092964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332628.1|3094044_3094611_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_012332629.1|3094667_3095717_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012332630.1|3096829_3097012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332631.1|3097318_3097780_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012332632.1|3097908_3099441_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085984491.1|3099795_3100632_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	3.2e-26
WP_012332633.1|3100704_3101829_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012332634.1|3102143_3102767_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_043702390.1|3102775_3104050_-	response regulator	NA	NA	NA	NA	NA
WP_012290057.1|3104090_3104966_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.6	2.1e-52
WP_012290058.1|3104962_3106246_-|transposase	IS21-like element ISMtsp8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.9	1.6e-45
WP_012332636.1|3106417_3106816_-	response regulator	NA	NA	NA	NA	NA
WP_012330561.1|3107218_3108619_-|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_083784671.1|3108618_3110280_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012332637.1|3110540_3110873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332638.1|3110908_3112504_+	response regulator	NA	W8CYM9	Bacillus_phage	31.3	7.8e-13
WP_012332639.1|3112620_3113007_-	response regulator	NA	W8CYM9	Bacillus_phage	31.6	1.1e-08
WP_012332640.1|3113003_3115787_-	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.6e-37
WP_150108831.1|3115830_3116556_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_050777484.1|3116891_3117212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012332642.1|3117415_3118927_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.0	2.4e-24
3119243:3119302	attL	GCGGTCAGCACCCGTAGCTCAGCTGGATAGAGCGTTGCCCTCCGAAGGCAAAGGTCACAC	NA	NA	NA	NA
WP_012332643.1|3119431_3120448_+|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	42.0	5.4e-60
WP_150108648.1|3120885_3121218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012332644.1|3121238_3122204_-	transporter	NA	NA	NA	NA	NA
WP_012331157.1|3123658_3124768_+|transposase	IS110-like element ISMtsp6 family transposase	transposase	NA	NA	NA	NA
3137680:3137763	attR	GCGGTCAGCACCCGTAGCTCAGCTGGATAGAGCGTTGCCCTCCGAAGGCAAAGGTCACACGTTCGAATCGTGTCGGGTGCGCCA	NA	NA	NA	NA
>prophage 3
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	3659706	3739892	7659055	holin,integrase,transposase	Bacillus_phage(37.5%)	57	3678582:3678598	3735593:3735609
WP_012333109.1|3659706_3661350_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	30.3	1.4e-54
WP_168169196.1|3661697_3662675_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012333111.1|3662962_3663964_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012333112.1|3663974_3665609_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012333113.1|3665931_3667695_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	4.5e-38
WP_150108671.1|3668852_3669233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333114.1|3669722_3670811_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012333115.1|3670826_3671951_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	1.8e-19
WP_012333116.1|3671973_3673302_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
WP_012333117.1|3674177_3675263_+	chemotaxis sensory transducer	NA	NA	NA	NA	NA
WP_012333119.1|3675687_3675918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036270303.1|3676088_3676652_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043701291.1|3677350_3679096_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.3	1.4e-18
3678582:3678598	attL	TCGCCGGCACGATCGCG	NA	NA	NA	NA
WP_012333122.1|3679095_3680439_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012333123.1|3680494_3686974_+	structural toxin protein RtxA	NA	NA	NA	NA	NA
WP_083784688.1|3687462_3687675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333124.1|3689072_3691994_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.5	6.8e-55
WP_150108672.1|3692390_3692585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108842.1|3692652_3692934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333126.1|3693417_3694149_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_043701294.1|3694389_3695610_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_150108673.1|3696031_3696313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333131.1|3696447_3696681_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_168169160.1|3698514_3698982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333133.1|3699775_3710095_+	outer membrane adhesin-like protein	NA	NA	NA	NA	NA
WP_012333134.1|3710449_3710839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333135.1|3711481_3711637_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_150108674.1|3712329_3713541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108675.1|3714017_3714197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333137.1|3714497_3714809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085984467.1|3715229_3716371_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.3	1.7e-30
WP_085984460.1|3717162_3717387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012331757.1|3717730_3718006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333142.1|3718685_3719186_-	DUF2165 domain-containing protein	NA	NA	NA	NA	NA
WP_012333143.1|3719604_3719832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333144.1|3721661_3722153_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012333145.1|3722689_3723394_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012333146.1|3723755_3724520_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_012333148.1|3724808_3725078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108676.1|3725074_3725425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333150.1|3725522_3725837_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_018260331.1|3725881_3726118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333152.1|3726360_3726636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333153.1|3726639_3727275_-	ParA family protein	NA	NA	NA	NA	NA
WP_012333154.1|3727536_3727758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333155.1|3727870_3728104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043702460.1|3728211_3729042_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_012333157.1|3729041_3729317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333158.1|3729387_3729879_-	DUF992 domain-containing protein	NA	NA	NA	NA	NA
WP_012333159.1|3730846_3731155_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.7	8.5e-09
WP_012333160.1|3731283_3731535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333161.1|3731842_3732805_+|transposase	IS481-like element ISMtsp15 family transposase	transposase	NA	NA	NA	NA
WP_012333162.1|3733935_3734364_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_012330561.1|3734541_3735942_+|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
3735593:3735609	attR	TCGCCGGCACGATCGCG	NA	NA	NA	NA
WP_012333163.1|3736062_3737175_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_012333164.1|3737555_3738401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333165.1|3738926_3739892_+|transposase	IS481-like element ISMtsp16 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	4434163	4469928	7659055	transposase,integrase	Staphylococcus_phage(50.0%)	26	4428547:4428562	4446360:4446375
4428547:4428562	attL	CCGCTGCCATTCGGCT	NA	NA	NA	NA
WP_150108856.1|4434163_4435327_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	49.7	2.3e-91
WP_150108857.1|4436673_4438431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108858.1|4438560_4440111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333747.1|4440412_4442020_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012333748.1|4442557_4444117_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_012333749.1|4444155_4445721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333750.1|4445717_4446893_+	glycosyltransferase	NA	NA	NA	NA	NA
4446360:4446375	attR	CCGCTGCCATTCGGCT	NA	NA	NA	NA
WP_012333751.1|4446855_4448226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333752.1|4448727_4449327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333753.1|4450311_4451289_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_012333755.1|4452679_4453132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333756.1|4453189_4453681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333757.1|4453730_4454234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012333758.1|4454237_4455170_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012333759.1|4455166_4457167_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_012333760.1|4457563_4457794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108704.1|4457810_4458038_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_012333762.1|4458121_4458769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333763.1|4459029_4459251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012331380.1|4459611_4460610_+|transposase	IS110-like element ISMtsp7 family transposase	transposase	NA	NA	NA	NA
WP_012330561.1|4460995_4462396_+|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_083784708.1|4462295_4462979_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.9	3.9e-22
WP_157182184.1|4462975_4463266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043702545.1|4464077_4465436_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
WP_012333767.1|4466849_4467374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012330561.1|4468527_4469928_-|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
>prophage 5
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	4571401	4610034	7659055	transposase,head,portal,tail,capsid,plate,terminase	Aurantimonas_phage(14.29%)	42	NA	NA
WP_012333874.1|4571401_4571635_-|tail	tail X family protein	tail	NA	NA	NA	NA
WP_012333875.1|4571639_4572065_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012333876.1|4572086_4576331_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_012333877.1|4576437_4576986_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012333878.1|4577041_4577569_-|tail	tail tube protein	tail	NA	NA	NA	NA
WP_012333879.1|4577636_4578923_-	hypothetical protein	NA	E5FFG9	Burkholderia_phage	27.4	4.1e-20
WP_012333880.1|4579006_4579519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333881.1|4579555_4580326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333882.1|4580344_4580908_-|tail	tail fiber protein	tail	A2I2X8	Vibrio_virus	32.7	1.2e-08
WP_012333883.1|4580900_4581569_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	5.9e-15
WP_012333884.1|4581561_4582557_-|plate	baseplate J protein	plate	A0A088FQL4	Escherichia_phage	36.6	3.5e-27
WP_012333885.1|4582580_4583000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333886.1|4583003_4583333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063826007.1|4583350_4583929_-|plate	baseplate assembly protein	plate	A0A219VHA3	Ochrobactrum_phage	28.2	2.3e-07
WP_012333888.1|4583925_4584720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333889.1|4584716_4585133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333890.1|4585144_4586170_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	34.8	1.1e-44
WP_012333891.1|4586290_4586962_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012333892.1|4587004_4588450_-	S49 family peptidase	NA	V5Q836	Xylella_phage	39.1	2.4e-45
WP_012333893.1|4588462_4588714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108862.1|4588716_4590222_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_150108863.1|4590324_4592331_-|terminase	terminase	terminase	A0A2H4JG09	uncultured_Caudovirales_phage	37.8	3.2e-96
WP_012333896.1|4592466_4592913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333897.1|4593174_4593732_-	protein tyrosine phosphatase-like protein	NA	NA	NA	NA	NA
WP_168169169.1|4593728_4593881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333899.1|4593977_4594388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333900.1|4594384_4594921_-	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	51.8	2.6e-21
WP_012333902.1|4595057_4595462_-	hypothetical protein	NA	A0A0F6R7L8	Sinorhizobium_phage	50.4	2.7e-23
WP_012333903.1|4595464_4596007_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	43.0	9.3e-27
WP_012333904.1|4596011_4596257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018261519.1|4596253_4596493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333906.1|4596489_4596969_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012333907.1|4596965_4597247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333909.1|4597825_4598104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012333910.1|4598361_4598625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085984469.1|4599586_4600530_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.8	3.6e-10
WP_150108709.1|4600709_4601426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085984499.1|4601957_4602797_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.5	3.0e-24
WP_012331380.1|4604074_4605073_-|transposase	IS110-like element ISMtsp7 family transposase	transposase	NA	NA	NA	NA
WP_012333913.1|4606392_4607499_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_043702575.1|4607723_4608839_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.0	4.5e-76
WP_150108864.1|4608816_4610034_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	4913605	4920567	7659055		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_012334189.1|4913605_4914106_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	31.3	1.6e-20
WP_012334190.1|4914207_4914747_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	50.9	2.9e-36
WP_012334191.1|4914736_4915222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012334192.1|4915214_4915676_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.0	3.1e-39
WP_012334193.1|4915801_4916470_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012334194.1|4916536_4917445_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.7	6.2e-15
WP_012334195.1|4917685_4919443_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	42.2	4.2e-28
WP_012334196.1|4919583_4920567_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.3	2.4e-81
>prophage 7
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	6070795	6139187	7659055	transposase	uncultured_virus(22.22%)	48	NA	NA
WP_012290058.1|6070795_6072079_-|transposase	IS21-like element ISMtsp8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.9	1.6e-45
WP_085984471.1|6072157_6072400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335232.1|6072503_6073292_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012335233.1|6073341_6074694_-	MFS transporter	NA	NA	NA	NA	NA
WP_083784819.1|6076206_6077286_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169191.1|6077712_6078057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083784790.1|6078291_6078402_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012330759.1|6078459_6079029_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_168169173.1|6079517_6080612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335237.1|6080668_6080941_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	48.7	1.5e-12
WP_012335238.1|6080977_6083212_-	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	27.5	1.9e-57
WP_012335239.1|6085395_6085821_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012332367.1|6086851_6087865_-|transposase	IS110-like element ISMtsp9 family transposase	transposase	Q75QL1	Wolbachia_phage	36.9	7.6e-30
WP_012335242.1|6090346_6090772_+	PAS sensor domain-containing protein	NA	NA	NA	NA	NA
WP_012335243.1|6092220_6092430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335244.1|6095508_6095694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335245.1|6095774_6096986_+	depolymerase	NA	NA	NA	NA	NA
WP_012335246.1|6097217_6098057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108736.1|6098221_6098527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335248.1|6099536_6100301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335249.1|6100597_6101620_-	lytic transglycosylase domain-containing protein	NA	A0A0A0P1R1	Enterobacteria_phage	35.6	2.3e-10
WP_012335251.1|6102582_6103014_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012335252.1|6103253_6103724_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012335254.1|6104766_6105078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169174.1|6105086_6105251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050777587.1|6105250_6106252_-	transporter	NA	NA	NA	NA	NA
WP_043701673.1|6106486_6106738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043701676.1|6107230_6107440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335258.1|6107966_6109487_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_012335259.1|6109580_6109898_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.0	1.8e-09
WP_168169175.1|6109924_6110662_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012335261.1|6110789_6111980_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043701679.1|6113533_6114775_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012335263.1|6114801_6115779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335264.1|6116429_6116960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012335265.1|6117015_6118800_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_012335266.1|6120581_6122222_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	57.8	4.3e-168
WP_012335267.1|6122311_6122599_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	59.6	1.3e-22
WP_012335268.1|6123548_6125309_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_012335269.1|6125377_6125752_-	histidine kinase	NA	NA	NA	NA	NA
WP_012335270.1|6125901_6127074_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012335271.1|6127719_6129090_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_012335272.1|6129133_6131455_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012335273.1|6132309_6133431_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_150108738.1|6134348_6134774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012330561.1|6134911_6136312_+|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_012335274.1|6136434_6137955_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012335275.1|6138164_6139187_+|transposase	IS110-like element ISMtsp17 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	6411629	6422681	7659055	tRNA	Escherichia_phage(28.57%)	9	NA	NA
WP_012335499.1|6411629_6414290_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	1.8e-83
WP_012335500.1|6414435_6414990_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	39.5	2.1e-26
WP_012335501.1|6415014_6416067_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	2.2e-88
WP_012335502.1|6416074_6416968_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.2	2.9e-17
WP_018263793.1|6416979_6417864_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.9	1.3e-94
WP_018263792.1|6417906_6419181_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	1.7e-50
WP_012335505.1|6419342_6420470_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_012335506.1|6420466_6421060_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_012335507.1|6421307_6422681_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	30.3	3.9e-13
>prophage 9
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	6547031	6556312	7659055	terminase	Rhizobium_phage(50.0%)	13	NA	NA
WP_012335614.1|6547031_6548402_+|terminase	phage terminase large subunit	terminase	H9C0U8	Aeromonas_phage	45.1	7.7e-94
WP_012335615.1|6548401_6549664_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	41.0	1.3e-74
WP_012335616.1|6550022_6550934_+	DUF2213 domain-containing protein	NA	L7TMD6	Rhizobium_phage	49.4	6.2e-39
WP_012335617.1|6550933_6551371_+	DUF2190 family protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	41.9	2.3e-15
WP_012335618.1|6551382_6552327_+	DUF2184 domain-containing protein	NA	L7TMZ5	Rhizobium_phage	48.9	7.2e-75
WP_012335619.1|6552331_6552541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335620.1|6552542_6552908_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_012335621.1|6552907_6553228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335622.1|6553227_6553521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335623.1|6553522_6553936_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012335624.1|6554002_6554470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012335625.1|6554478_6555060_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_012335626.1|6555043_6556312_+	hypothetical protein	NA	A0A2D2W291	Sinorhizobium_phage	32.4	2.1e-05
>prophage 10
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	7398115	7430781	7659055	transposase,integrase	Erythrobacter_phage(18.18%)	33	7397892:7397948	7430798:7430854
7397892:7397948	attL	GCTGGTGCGGACGGCGGGACTCGAACCCGCACGGCCTTGCGGCCGCAAGATTTTAAG	NA	NA	NA	NA
WP_043701891.1|7398115_7399369_+|integrase	site-specific integrase	integrase	A0A0R6PIF4	Moraxella_phage	27.3	5.0e-23
WP_150108781.1|7399365_7399929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336349.1|7400035_7400251_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012336350.1|7400254_7400707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083784824.1|7400954_7403162_+	AAA family ATPase	NA	A0A1U9ZA69	Proteus_phage	38.5	3.5e-11
WP_012336353.1|7403687_7404023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336354.1|7404130_7404565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336355.1|7404620_7405448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336356.1|7405449_7405713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012330561.1|7406351_7407752_-|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_012336358.1|7408413_7409448_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012336359.1|7409890_7410463_+	class I SAM-dependent methyltransferase	NA	A0A1V0S9B9	Catovirus	35.3	1.7e-26
WP_012336360.1|7410735_7411488_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	5.8e-43
WP_012336361.1|7411606_7412050_-	CHRD domain-containing protein	NA	NA	NA	NA	NA
WP_012336362.1|7412101_7412518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336363.1|7412783_7413278_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	51.6	2.5e-26
WP_012336366.1|7414700_7415132_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	53.3	5.9e-24
WP_085984506.1|7415372_7415786_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169122.1|7416005_7416323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169183.1|7416458_7416977_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_043701906.1|7416924_7417254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108782.1|7417574_7418060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150108902.1|7418604_7419585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336370.1|7419771_7420377_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	54.1	4.5e-46
WP_012336371.1|7420862_7421150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336372.1|7421349_7422273_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_012336373.1|7422269_7423979_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	33.8	1.5e-54
WP_012336374.1|7424329_7425343_+	transporter	NA	NA	NA	NA	NA
WP_012336375.1|7425381_7426830_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	33.0	1.1e-53
WP_083784772.1|7427689_7427911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050777534.1|7427981_7428236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012330183.1|7429015_7430215_+|transposase	IS256-like element ISMtsp13 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.4	9.1e-91
WP_168169184.1|7430397_7430781_-|transposase	transposase	transposase	NA	NA	NA	NA
7430798:7430854	attR	GCTGGTGCGGACGGCGGGACTCGAACCCGCACGGCCTTGCGGCCGCAAGATTTTAAG	NA	NA	NA	NA
>prophage 11
NC_010511	Methylobacterium sp. 4-46, complete sequence	7659055	7557844	7608665	7659055	transposase	Rhizobium_phage(16.67%)	42	NA	NA
WP_012336480.1|7557844_7559053_+|transposase	IS701-like element ISMtsp19 family transposase	transposase	NA	NA	NA	NA
WP_012336481.1|7559533_7560196_+	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_012336482.1|7560538_7561231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043702834.1|7562206_7562674_+	ATPase	NA	NA	NA	NA	NA
WP_012336485.1|7562679_7563312_+	deaminase reductase	NA	NA	NA	NA	NA
WP_012336486.1|7563515_7563899_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_012336487.1|7564519_7565692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336488.1|7566255_7566495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336489.1|7567382_7568756_-	MFS transporter	NA	NA	NA	NA	NA
WP_012336490.1|7568954_7570859_-	phenol 2-monooxygenase	NA	NA	NA	NA	NA
WP_012336491.1|7571217_7571697_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043701921.1|7573272_7573470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043702837.1|7574467_7574725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169185.1|7575542_7575692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336497.1|7576163_7576400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083784778.1|7576775_7577060_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085984477.1|7577075_7578169_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012336500.1|7578976_7579660_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	29.0	3.6e-07
WP_012336501.1|7579654_7580287_-	recombinase family protein	NA	NA	NA	NA	NA
WP_012336502.1|7580938_7581154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336504.1|7583368_7583596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168169186.1|7585415_7585733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336507.1|7585984_7586437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336508.1|7587075_7587255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336509.1|7587500_7587761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150108785.1|7587902_7588127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336511.1|7588263_7588758_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012336512.1|7588971_7589424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169187.1|7589566_7590955_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_012336514.1|7591400_7592876_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.9	1.5e-05
WP_012336515.1|7593344_7594145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085984480.1|7594366_7595310_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.8	7.3e-11
WP_168169188.1|7595532_7595694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043701932.1|7596171_7596426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336520.1|7596894_7597083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168169189.1|7597445_7597901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336521.1|7598523_7599360_+|transposase	IS5-like element ISMtsp20 family transposase	transposase	NA	NA	NA	NA
WP_150108787.1|7600175_7601006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012336523.1|7601459_7602449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012336525.1|7604394_7605795_+|transposase	IS30-like element ISMtsp4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.4e-26
WP_012290057.1|7606509_7607385_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.6	2.1e-52
WP_012290058.1|7607381_7608665_-|transposase	IS21-like element ISMtsp8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	35.9	1.6e-45
