The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	204186	255293	4689441	tail,transposase,integrase,plate,protease	Pseudomonas_phage(33.33%)	56	233159:233173	256118:256132
WP_002216348.1|204186_205023_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002218928.1|205040_205370_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_002208926.1|205744_208456_-	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_012105894.1|208773_211179_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
WP_012303379.1|211191_213288_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_002208924.1|213472_214048_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_002208923.1|214107_214809_-	DNA utilization protein GntX	NA	NA	NA	NA	NA
WP_002208922.1|214895_215672_+	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_002208921.1|215841_216111_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002208920.1|216248_216506_-	ferrous iron transporter C	NA	NA	NA	NA	NA
WP_012303380.1|216541_218857_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_002208918.1|218948_219176_-	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_012303381.1|219699_222075_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002208915.1|222608_223124_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_002208914.1|223259_223979_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
WP_002208913.1|223975_225328_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
WP_011193240.1|225666_227286_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
WP_012303382.1|227482_228364_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002208910.1|228526_228934_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_002208909.1|228962_229643_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_011193239.1|229786_231934_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
WP_002208907.1|232520_233066_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
233159:233173	attL	TCTATTCTGCACAAT	NA	NA	NA	NA
WP_012303383.1|233186_233942_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.1	9.1e-97
WP_012303384.1|234073_234511_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	35.4	4.0e-12
WP_112473240.1|235749_236301_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	34.8	4.0e-25
WP_012303387.1|236315_237377_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.0	1.6e-75
WP_032466774.1|237376_237727_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.7e-29
WP_012303389.1|237781_238432_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	48.2	2.5e-50
WP_012303390.1|238421_239645_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.0	2.8e-71
WP_112473238.1|239628_240930_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.9	1.4e-41
WP_012303392.1|240949_243157_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	41.8	3.5e-96
WP_012303395.1|243594_243792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303396.1|243784_244285_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	59.0	1.3e-51
WP_012303397.1|244287_244575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303398.1|244571_244814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112473237.1|244810_245350_-	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	44.3	1.5e-24
WP_012303400.1|245375_245630_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	47.6	1.8e-12
WP_041176032.1|245620_246253_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	61.1	4.1e-66
WP_012303402.1|246350_246620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032466757.1|246631_247066_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	50.7	3.8e-31
WP_012303404.1|247065_247467_-	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	42.7	2.3e-22
WP_112473235.1|247451_247916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303406.1|247917_248310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123767121.1|248302_248515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303408.1|248511_249054_-	hypothetical protein	NA	J9Q748	Salmonella_phage	52.9	5.6e-48
WP_012303409.1|249043_249286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303410.1|249282_249504_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	54.5	9.1e-13
WP_012303411.1|249500_250001_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012303412.1|250000_250699_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	33.5	1.7e-17
WP_012303413.1|250781_250973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303414.1|250974_251613_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	56.5	1.6e-62
WP_012303415.1|251602_251803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303416.1|251809_252043_-	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	55.3	1.5e-18
WP_012303417.1|252061_252952_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	52.1	5.9e-79
WP_112473233.1|252994_255037_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	51.7	3.6e-188
WP_032898438.1|255050_255293_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	59.4	1.1e-16
256118:256132	attR	ATTGTGCAGAATAGA	NA	NA	NA	NA
>prophage 2
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	963066	1063056	4689441	head,tail,tRNA,transposase,terminase,capsid,holin,integrase,portal,protease	Cronobacter_phage(57.63%)	99	1036787:1036804	1047667:1047684
WP_012104670.1|963066_963579_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|963770_964925_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|966131_968111_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_012303654.1|968310_968769_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_002213775.1|969022_969481_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
WP_012303655.1|969794_970547_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011192968.1|971020_973015_+	transketolase	NA	NA	NA	NA	NA
WP_002209964.1|973429_974446_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|974548_975712_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|975831_976911_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_071820209.1|976814_977024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209961.1|977348_978218_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_012303656.1|978463_979081_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_011192966.1|979270_980050_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|980060_980969_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|981310_981967_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|982273_983515_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_011192965.1|983779_984376_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002209954.1|984739_985069_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002209953.1|985405_985984_+	YecA family protein	NA	NA	NA	NA	NA
WP_011192964.1|986071_987385_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_002209951.1|987521_988700_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_002209950.1|988872_990093_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_012303660.1|990813_991911_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_002209948.1|991979_992366_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_002209947.1|992577_995457_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
WP_002209946.1|995834_996272_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012303661.1|997331_999482_+	autotransporter adhesin YapN	NA	NA	NA	NA	NA
WP_072080522.1|999543_1000689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303662.1|1000890_1001592_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002209941.1|1001883_1002381_+	DUF2165 family protein	NA	NA	NA	NA	NA
WP_002209940.1|1002453_1003446_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_002209939.1|1003762_1004029_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_002215144.1|1004009_1004435_+	membrane protein	NA	NA	NA	NA	NA
WP_002209937.1|1004434_1005133_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_012104678.1|1005157_1006591_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_072084532.1|1006654_1008133_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_002209934.1|1008217_1008736_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_041175955.1|1008806_1009853_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	54.1	2.4e-103
WP_012303666.1|1009882_1010446_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	36.0	2.6e-32
WP_012303667.1|1010584_1010815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176057.1|1010841_1011351_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	51.8	1.8e-43
WP_012303669.1|1011360_1011546_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_012303670.1|1011557_1011875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303671.1|1011941_1012814_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.1	9.0e-72
WP_041175956.1|1012810_1013080_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012303673.1|1013091_1013364_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	44.3	2.0e-14
WP_012303674.1|1013367_1014372_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	1.8e-63
WP_012303675.1|1014368_1016648_+	replication endonuclease	NA	Q858T4	Yersinia_virus	56.0	9.4e-238
WP_041176059.1|1016667_1017027_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	42.5	1.1e-18
WP_012303677.1|1017226_1017442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175957.1|1017418_1017739_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	65.3	1.0e-33
WP_112473340.1|1017735_1018707_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	69.2	5.6e-139
WP_012303680.1|1018757_1020545_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	68.6	1.1e-236
WP_012303681.1|1020711_1021566_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	49.1	1.3e-67
WP_012303682.1|1021620_1022652_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	75.8	6.1e-144
WP_012303683.1|1022662_1023361_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.2	1.1e-64
WP_012303684.1|1023456_1023909_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.7	2.3e-39
WP_012303685.1|1023905_1024394_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	43.0	3.9e-32
WP_041175959.1|1024393_1025068_+	phage protein	NA	F1BUL6	Cronobacter_phage	67.3	5.3e-80
WP_012303687.1|1025094_1026234_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	65.7	4.0e-136
WP_012303688.1|1026230_1026683_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	59.5	2.4e-44
WP_012303689.1|1026692_1026983_+|holin	holin	holin	Q6K1I2	Salmonella_virus	52.8	2.2e-14
WP_024063639.1|1026979_1027321_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.5e-43
WP_012303691.1|1027320_1027662_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	40.9	6.3e-13
WP_012303692.1|1027811_1028078_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	54.9	1.0e-18
WP_012303693.1|1028265_1030242_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	3.5e-172
WP_012303694.1|1030241_1030574_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.3	1.5e-35
WP_012303695.1|1030566_1031751_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	65.7	2.3e-150
WP_012303696.1|1031743_1032379_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.5	9.2e-58
WP_012303697.1|1032389_1034159_+|tail	tail fiber protein	tail	F1BUK3	Cronobacter_phage	47.5	2.2e-69
WP_012303698.1|1034169_1034598_+|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	45.3	1.5e-08
WP_012303699.1|1034587_1035319_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	44.6	1.7e-39
WP_012303700.1|1035284_1035833_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	63.7	6.3e-55
WP_012303701.1|1035829_1037485_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	52.8	4.1e-166
1036787:1036804	attL	GGCATGTTCCAGTTCCCG	NA	NA	NA	NA
WP_012303702.1|1037660_1037858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209933.1|1038280_1039180_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_002209932.1|1039210_1039927_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_012303703.1|1039933_1041667_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	1.2e-64
WP_002228062.1|1041845_1042943_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209930.1|1042953_1044471_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_011192954.1|1044903_1046118_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	3.7e-132
WP_012303704.1|1046940_1048638_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.9	2.4e-129
1047667:1047684	attR	CGGGAACTGGAACATGCC	NA	NA	NA	NA
WP_112473342.1|1048634_1049180_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	8.5e-36
WP_012303706.1|1049181_1049892_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	28.1	4.2e-11
WP_012303707.1|1049888_1050407_-|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	50.6	8.3e-41
WP_012303708.1|1050406_1052002_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	40.2	1.8e-54
WP_011192948.1|1052011_1052635_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.9	1.2e-57
WP_012303709.1|1052627_1053812_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	59.0	3.0e-134
WP_011192946.1|1053808_1054138_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	60.4	4.6e-29
WP_012303712.1|1054582_1055749_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	52.6	1.1e-101
WP_012303713.1|1055745_1056447_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.8	3.3e-40
WP_012303714.1|1056406_1056913_-	hypothetical protein	NA	F1BUL7	Cronobacter_phage	38.9	2.7e-20
WP_012303715.1|1056909_1057362_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.7	2.8e-37
WP_012303716.1|1057481_1058225_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.6	1.4e-65
WP_012303717.1|1058242_1059415_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	46.7	2.0e-82
WP_012303718.1|1059497_1060433_-|capsid	phage capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	54.3	3.5e-37
WP_012303719.1|1060610_1062704_+|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	49.7	2.0e-170
WP_123767123.1|1062720_1063056_+	hypothetical protein	NA	F1BUM7	Cronobacter_phage	67.4	2.9e-34
>prophage 3
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	1331574	1371200	4689441	holin,head,terminase	Burkholderia_phage(35.14%)	50	NA	NA
WP_012303784.1|1331574_1332966_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	70.6	2.0e-198
WP_041176066.1|1333012_1333750_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	48.9	1.5e-32
WP_012303786.1|1333814_1333997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303787.1|1334123_1334435_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012303788.1|1334437_1334575_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012303789.1|1334571_1334841_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	71.9	3.4e-30
WP_012303790.1|1334824_1335055_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012303791.1|1335059_1337141_-	DNA polymerase	NA	Q775A3	Bordetella_phage	65.1	3.1e-264
WP_012303792.1|1337237_1338017_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	31.3	2.5e-20
WP_012303793.1|1338074_1338452_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	45.7	4.4e-07
WP_012303794.1|1338504_1339053_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	56.3	1.1e-51
WP_012303795.1|1339065_1340376_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	54.4	2.3e-127
WP_012303796.1|1340378_1341113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303797.1|1341571_1342201_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.2	2.1e-38
WP_012303798.1|1342346_1342562_+	helix-turn-helix transcriptional regulator	NA	A0A220NRR8	Escherichia_phage	64.8	7.4e-20
WP_012303799.1|1342565_1344743_+	virulence-associated E family protein	NA	B6SCU2	Bacteriophage	32.0	1.4e-105
WP_012303800.1|1345021_1345234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303801.1|1345315_1345741_+	hypothetical protein	NA	B6SCY2	Bacteriophage	38.6	9.6e-19
WP_012303802.1|1346112_1346493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303803.1|1346755_1347187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012303804.1|1347391_1347724_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	41.0	7.0e-17
WP_041176069.1|1347716_1348106_+	M15 family metallopeptidase	NA	A0A060DAL8	Salmonella_phage	78.0	2.6e-55
WP_012303806.1|1348102_1348480_+	exotoxin	NA	B6SD18	Bacteriophage	33.3	2.8e-06
WP_012303807.1|1348699_1349251_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	61.3	3.1e-54
WP_012303808.1|1349274_1349634_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	41.7	1.9e-12
WP_041175966.1|1349685_1349946_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	40.7	3.6e-08
WP_012303809.1|1350089_1351694_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	71.6	1.8e-235
WP_123772596.1|1351943_1353485_+	DUF1073 domain-containing protein	NA	Q6IWU2	Burkholderia_phage	44.6	2.2e-113
WP_042593175.1|1353522_1354323_+|head	head morphogenesis protein SPP1	head	Q6IWU3	Burkholderia_phage	41.1	1.6e-51
WP_080513663.1|1354309_1355464_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	42.1	2.5e-53
WP_012303813.1|1355463_1355955_+	hypothetical protein	NA	A1Z022	Burkholderia_virus	30.0	7.7e-12
WP_012303814.1|1355968_1357102_+	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	48.4	1.5e-90
WP_155115697.1|1357130_1357529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303816.1|1357538_1357970_+	DUF4054 domain-containing protein	NA	B7VFH0	Pseudomonas_phage	41.9	9.1e-25
WP_012303817.1|1357969_1358467_+	hypothetical protein	NA	A0A088C495	Shewanella_sp._phage	33.0	1.5e-15
WP_012303818.1|1358466_1358850_+	hypothetical protein	NA	Q6IWV0	Burkholderia_phage	38.1	1.9e-13
WP_012303819.1|1358839_1359379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303820.1|1359391_1360906_+	DUF3383 family protein	NA	I7B2P4	Escherichia_phage	40.9	4.5e-95
WP_012303821.1|1360917_1361358_+	hypothetical protein	NA	A0A0F6SJB3	Pseudomonas_phage	50.0	2.0e-35
WP_012303822.1|1361357_1361813_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	54.7	6.6e-34
WP_012303823.1|1361898_1363470_+	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	29.1	4.8e-31
WP_012303824.1|1363469_1363979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303825.1|1363980_1364283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303826.1|1364286_1365126_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	41.6	1.3e-51
WP_012303827.1|1365107_1365785_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	43.2	1.1e-40
WP_012303828.1|1365781_1366141_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	47.8	5.6e-20
WP_012303829.1|1366124_1367324_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	46.0	2.3e-81
WP_012303830.1|1367389_1369201_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	37.2	5.3e-34
WP_012303831.1|1369204_1369426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303832.1|1369418_1371200_+	hypothetical protein	NA	H9C1B7	Pectobacterium_phage	59.6	3.5e-195
>prophage 4
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	1966772	2007969	4689441	protease,coat,transposase	Moraxella_phage(16.67%)	33	NA	NA
WP_011192561.1|1966772_1967762_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012304005.1|1967967_1970415_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1970517_1971270_-	molecular chaperone	NA	NA	NA	NA	NA
WP_012304006.1|1971300_1971858_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1971878_1972409_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1972414_1972969_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_012304007.1|1973449_1976080_-	PqiB family protein	NA	NA	NA	NA	NA
WP_012105007.1|1976048_1977296_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|1977527_1978025_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|1978120_1978834_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_011192556.1|1978853_1980932_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|1981387_1982269_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012105009.1|1982927_1983470_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012304009.1|1983605_1984385_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002210844.1|1984466_1987079_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012304010.1|1987075_1988239_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210843.1|1988235_1989039_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210842.1|1989092_1990460_-	MFS transporter	NA	NA	NA	NA	NA
WP_011192552.1|1990826_1991993_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210840.1|1992179_1992971_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_012304011.1|1993337_1994189_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.7e-11
WP_072080401.1|1994402_1995800_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210837.1|1995997_1996546_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210836.1|1997043_1997754_-	porin	NA	NA	NA	NA	NA
WP_002210835.1|1998051_1999344_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210834.1|1999359_2000487_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210833.1|2000500_2001421_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210832.1|2001413_2002304_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012304012.1|2002344_2004012_-	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210830.1|2004356_2005118_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_012105015.1|2005209_2006046_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_012105016.1|2006381_2006714_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012304013.1|2006760_2007969_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 5
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	2538244	2586852	4689441	lysis,head,tail,capsid,holin,integrase,plate,portal,transposase	Salmonella_phage(44.19%)	65	2552877:2552936	2587005:2587127
WP_002215419.1|2538244_2538349_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012304154.1|2539026_2539461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304155.1|2539472_2540042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304157.1|2541705_2542782_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_002213209.1|2542847_2543138_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
WP_012304158.1|2543139_2543391_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_012304159.1|2543421_2543781_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.9e-18
WP_012304160.1|2543777_2544077_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002215413.1|2544093_2544381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304161.1|2544817_2545336_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_002227958.1|2545340_2545595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304162.1|2545759_2546929_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.2	5.6e-178
WP_012304163.1|2546940_2547456_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.9	8.5e-62
WP_011192297.1|2547509_2547857_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|2547871_2547991_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012304164.1|2547983_2550899_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	7.5e-155
WP_012304165.1|2550910_2551375_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_012304166.1|2551371_2552466_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.2	2.1e-126
WP_012105206.1|2552540_2552756_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
2552877:2552936	attL	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAA	NA	NA	NA	NA
WP_012304167.1|2553106_2554114_-|integrase	tyrosine-type recombinase/integrase	integrase	P79671	Haemophilus_phage	59.3	3.4e-107
WP_012304168.1|2554121_2554634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304169.1|2554695_2555334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304170.1|2555351_2555744_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	47.2	3.2e-21
WP_012304171.1|2555822_2556014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304172.1|2556026_2556230_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	41.1	9.8e-06
WP_012304173.1|2556241_2556448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304174.1|2556444_2556759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304176.1|2556900_2557161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304177.1|2557191_2557497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304178.1|2557579_2558341_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
WP_012304179.1|2558397_2559051_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	61.2	1.5e-55
WP_012304180.1|2559047_2559866_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.9	1.1e-76
WP_012304181.1|2559862_2560726_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	59.7	8.0e-105
WP_012304182.1|2560722_2563278_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.4	3.8e-126
WP_012304183.1|2563258_2563489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304184.1|2563485_2563830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304185.1|2564512_2565544_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.8	3.5e-131
WP_012304186.1|2565540_2566266_-	hypothetical protein	NA	F1BUR2	Erwinia_phage	31.8	2.1e-26
WP_011192317.1|2566265_2568029_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.6	3.1e-228
WP_012304187.1|2568199_2569015_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	71.1	9.6e-76
WP_012304188.1|2569051_2570107_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	8.5e-125
WP_011192314.1|2570113_2570767_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.7e-43
WP_011192313.1|2571000_2571492_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
WP_011192312.1|2571491_2571695_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
WP_011192311.1|2571724_2572111_+|holin	holin	holin	NA	NA	NA	NA
WP_012304189.1|2572097_2572493_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	1.2e-47
WP_012304190.1|2572497_2572920_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.6	4.9e-23
WP_072083431.1|2572807_2573032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192308.1|2573018_2573486_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
WP_012304191.1|2573482_2573929_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	51.4	3.4e-35
WP_012304193.1|2574260_2574962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112473311.1|2575229_2575928_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	5.0e-65
WP_011192304.1|2575924_2576278_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
WP_011192303.1|2576280_2577189_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
WP_011192302.1|2577181_2577790_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
WP_012304196.1|2577786_2579226_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	3.8e-75
WP_012304197.1|2579236_2579716_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	2.0e-28
WP_012304198.1|2579849_2581025_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	3.9e-179
WP_012105203.1|2581036_2581552_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
WP_011192297.1|2581605_2581953_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|2581967_2582087_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_012304199.1|2582079_2584995_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	1.5e-155
WP_012304200.1|2585006_2585471_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_012304201.1|2585467_2586562_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.0	1.2e-126
WP_012304202.1|2586636_2586852_+	transcriptional activator Ogr/delta	NA	S4TNZ3	Salmonella_phage	62.0	4.8e-19
2587005:2587127	attR	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 6
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	3096881	3105927	4689441	tail,plate	Shigella_phage(33.33%)	12	NA	NA
WP_012304333.1|3096881_3097301_-|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	33.9	1.4e-06
WP_011192007.1|3097302_3098019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192006.1|3098115_3098718_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
WP_011192005.1|3098714_3099851_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
WP_002208848.1|3099854_3100310_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|3100306_3100903_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|3100918_3101974_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_012304334.1|3101970_3103377_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_154018379.1|3103330_3103504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304335.1|3103643_3105137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208854.1|3105257_3105557_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|3105558_3105927_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 7
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	3372557	3464671	4689441	protease,tail,tRNA,capsid,plate,integrase,transposase	Enterobacteria_phage(18.75%)	93	3394745:3394782	3445399:3445436
WP_012304013.1|3372557_3373766_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011191911.1|3373913_3374786_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_012304416.1|3375185_3377393_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_011191909.1|3377385_3377916_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_012304417.1|3378071_3380453_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_012304418.1|3380531_3382160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191906.1|3382632_3383484_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	5.5e-50
WP_002209763.1|3383509_3384499_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|3384553_3385447_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215253.1|3385749_3386055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227854.1|3386151_3386523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105549.1|3386534_3387854_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_012304419.1|3387846_3389610_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|3389606_3390239_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011191901.1|3390248_3391178_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|3391170_3391773_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|3392172_3392379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080513694.1|3392590_3392869_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.8	8.4e-32
WP_002215266.1|3392951_3393290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304420.1|3393274_3393922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|3394035_3394236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|3394494_3394677_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
3394745:3394782	attL	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_112473254.1|3394936_3395305_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	32.0	9.5e-07
WP_012304424.1|3396784_3397783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304428.1|3399757_3400390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304429.1|3400650_3401361_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	77.3	8.8e-110
WP_012304430.1|3401363_3402116_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_012304431.1|3402132_3402474_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.4	3.1e-28
WP_012304432.1|3402476_3402683_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	74.4	2.5e-09
WP_012304433.1|3402787_3403510_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_012304434.1|3403646_3404069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176002.1|3404181_3404880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304436.1|3404876_3405458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304437.1|3405526_3405763_-	DUF2767 family protein	NA	NA	NA	NA	NA
WP_050756397.1|3406155_3406776_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	34.5	6.9e-18
WP_012304439.1|3406849_3407092_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	2.5e-24
WP_012304440.1|3407105_3407351_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	45.0	1.5e-11
WP_012304441.1|3407737_3408175_-|tail	tail assembly chaperone gp38	tail	B6SCW7	Bacteriophage	34.7	6.8e-12
WP_012304442.1|3408184_3409276_-	hypothetical protein	NA	Q76YB0	Aeromonas_virus	38.6	4.8e-06
WP_012304443.1|3409326_3409923_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.3	1.1e-33
WP_012304444.1|3409919_3411056_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.7	3.7e-33
WP_012304445.1|3411059_3411497_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.3e-20
WP_012304446.1|3411493_3412087_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_012304447.1|3412086_3413157_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.9	3.1e-42
WP_012304448.1|3413153_3414560_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	2.3e-24
WP_012304449.1|3414636_3415167_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	59.8	4.2e-24
WP_012304450.1|3415270_3417217_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	24.0	2.3e-14
WP_012304451.1|3417339_3417639_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012304452.1|3417640_3418015_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012304453.1|3418027_3419461_-|tail	Mu tail sheath family protein	tail	B5TK67	Pseudomonas_phage	47.4	4.3e-71
WP_012304454.1|3419457_3419802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304455.1|3419801_3420194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304456.1|3420195_3421242_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	31.4	2.6e-41
WP_123767129.1|3421351_3421762_-	hypothetical protein	NA	K7PH49	Enterobacterial_phage	47.0	2.4e-11
WP_050756398.1|3421932_3422262_+	hypothetical protein	NA	H6WRV0	Salmonella_phage	43.3	8.5e-07
WP_012304459.1|3422432_3423587_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	70.7	3.6e-161
WP_012304460.1|3423792_3424641_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_012304462.1|3425307_3425691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304463.1|3425754_3426084_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_012304464.1|3426096_3426567_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012304465.1|3426637_3427459_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	4.0e-45
WP_012304466.1|3427547_3427886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304467.1|3427906_3428371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098087307.1|3428383_3428482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304468.1|3428871_3429759_-	HSR1-like GTP-binding protein	NA	NA	NA	NA	NA
WP_050320373.1|3429850_3431224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012304470.1|3431787_3432375_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_012304471.1|3432472_3432679_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012304473.1|3433249_3433945_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012304474.1|3434267_3435014_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012304475.1|3435096_3437145_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012304476.1|3437155_3439078_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012304477.1|3439342_3439672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304478.1|3439671_3442944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304480.1|3443987_3445196_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.5	6.1e-135
WP_002209774.1|3445683_3446550_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
3445399:3445436	attR	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_002209775.1|3446564_3446777_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_012304481.1|3446998_3448384_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.9	2.6e-41
WP_002208567.1|3448594_3449089_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|3449099_3449822_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208569.1|3450137_3450662_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|3450658_3451723_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_012304482.1|3451766_3454196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191895.1|3454192_3454879_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
WP_002227832.1|3454846_3455485_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208574.1|3455871_3456648_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208575.1|3456724_3457594_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208576.1|3457788_3458703_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208577.1|3458705_3459155_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002208578.1|3459334_3459754_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011191893.1|3459960_3462846_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
WP_002208580.1|3463118_3463928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191892.1|3464191_3464671_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 8
NC_010465	Yersinia pseudotuberculosis YPIII, complete genome	4689441	3473941	3481398	4689441		Bacillus_phage(16.67%)	6	NA	NA
WP_012304486.1|3473941_3475315_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.1	2.8e-35
WP_012304487.1|3475618_3476578_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2D2W2D2	Stenotrophomonas_phage	29.3	4.7e-05
WP_012304488.1|3476925_3477675_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	1.8e-07
WP_080513696.1|3477709_3479104_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	2.6e-52
WP_002223297.1|3479305_3480271_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
WP_011191888.1|3480276_3481398_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	5.8e-132
