The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	910095	973330	5068389	head,tail,integrase,protease,tRNA,terminase,capsid,transposase,portal	uncultured_Caudovirales_phage(47.37%)	57	945465:945480	962275:962290
WP_000868863.1|910095_911121_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000691708.1|911622_911706_-	protein YohP	NA	NA	NA	NA	NA
WP_001078163.1|911929_913366_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079513.1|913418_914180_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|914299_914878_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|915047_915635_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001319943.1|915808_916741_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097379.1|916779_918495_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871485.1|918690_920988_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131262.1|921239_922157_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221775.1|922163_923321_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569360.1|923313_924240_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783133.1|924244_924976_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|924956_925064_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|925123_925855_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001334139.1|926076_927762_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_012311742.1|927758_928478_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_012311821.1|928524_928995_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	8.8e-82
WP_001296231.1|929035_929497_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_012311938.1|929621_931622_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_012311939.1|931618_932755_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001294440.1|932747_935027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012311965.1|935037_936126_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636920.1|936701_937022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356771.1|937082_940745_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001215564.1|940754_944543_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|944683_946717_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
945465:945480	attL	AACTGCGGGTCAGCCA	NA	NA	NA	NA
WP_001005448.1|946848_947958_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046488.1|948220_948502_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|948797_949340_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000945421.1|950110_952591_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405736.1|952606_953641_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|953722_954061_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134614.1|954279_955104_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|955224_955497_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000513574.1|955826_957047_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	2.4e-131
WP_000163378.1|957043_957898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075377.1|958001_958226_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	3.6e-17
WP_001113141.1|959270_959591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261505.1|959597_959897_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000710160.1|959893_961711_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.6e-129
WP_000125507.1|961998_962244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126652.1|962240_962666_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
962275:962290	attR	TGGCTGACCCGCAGTT	NA	NA	NA	NA
WP_024167808.1|962682_962931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053662.1|962966_963473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733253.1|963759_964929_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_000798773.1|964983_965544_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_000270251.1|965545_966760_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	2.2e-209
WP_001287546.1|966752_967055_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_001145897.1|967054_967495_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001251188.1|967478_967664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353110.1|967783_968140_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_000127869.1|968123_969785_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.3	4.9e-276
WP_001353111.1|969790_970072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195575.1|970861_971650_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|971646_972447_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_012311759.1|972511_973330_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.1e-23
>prophage 2
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	1173550	1215190	5068389	head,tail,integrase,protease,holin,terminase,capsid,transposase,portal	Escherichia_phage(52.08%)	55	1166612:1166627	1195874:1195889
1166612:1166627	attL	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_000533615.1|1173550_1174576_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|1174575_1174779_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000102142.1|1174837_1177279_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	3.5e-113
WP_001070260.1|1177372_1177564_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1177560_1177749_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|1178316_1178535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379594.1|1178694_1178850_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	9.8e-06
WP_001003379.1|1179039_1179447_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1179524_1179752_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1179735_1180287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|1180258_1181299_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|1181210_1181753_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450714.1|1181786_1182557_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	4.3e-86
WP_001141099.1|1182572_1182965_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1182961_1183258_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209471.1|1183254_1183716_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_000403785.1|1183693_1184050_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224665.1|1184143_1184326_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|1184318_1184495_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289982.1|1184491_1185007_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.2	5.0e-38
WP_000902693.1|1185493_1185706_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_000687435.1|1185926_1186187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024210535.1|1186253_1186532_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001265039.1|1186533_1187589_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	1.2e-89
WP_000140004.1|1187589_1187955_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_001064893.1|1187951_1188641_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	7.4e-61
WP_000839572.1|1189436_1189652_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193280.1|1189656_1190007_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000991413.1|1190070_1190604_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	5.3e-99
WP_032193450.1|1190820_1191006_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	1.1e-19
WP_001140099.1|1191110_1191461_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|1191609_1192092_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140891.1|1192091_1193849_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000478567.1|1193860_1194043_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|1194042_1195284_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|1195261_1195912_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
1195874:1195889	attR	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_000257489.1|1195926_1197132_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|1197183_1197372_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|1197383_1197689_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|1197697_1198036_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|1198035_1198482_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|1198478_1198823_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|1198882_1199587_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|1199601_1199973_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|1199996_1200275_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_000224017.1|1200320_1203548_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_001330090.1|1203525_1203882_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152420.1|1203881_1204580_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	9.9e-130
WP_012311596.1|1204584_1205328_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	2.9e-143
WP_012311734.1|1205225_1205873_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_000515358.1|1205933_1209413_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001228253.1|1209480_1210080_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	4.0e-103
WP_089541817.1|1212521_1213750_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000654145.1|1213858_1214140_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	2.4e-18
WP_000235970.1|1214149_1215190_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	81.4	4.1e-156
>prophage 3
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	2227126	2294205	5068389	tRNA,transposase	Escherichia_phage(13.64%)	51	NA	NA
WP_024210537.1|2227126_2228473_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000445250.1|2228598_2229882_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|2229952_2231041_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642852.1|2231239_2231932_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001361418.1|2232061_2233822_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2234227_2235085_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|2235139_2237422_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111039.1|2237613_2238354_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000918513.1|2238563_2239994_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|2240203_2241352_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|2241666_2242293_+	hydrolase	NA	NA	NA	NA	NA
WP_000534644.1|2242328_2243192_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213103.1|2243193_2243811_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850334.1|2243821_2246266_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000886683.1|2246504_2247797_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2247887_2249231_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2249241_2249853_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077118.1|2250011_2254121_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2254255_2254750_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|2255294_2256260_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043594.1|2256382_2258149_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
WP_001202209.1|2258149_2259871_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.9e-20
WP_001241678.1|2259912_2260617_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2260901_2261120_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001274547.1|2261610_2262453_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839253.1|2262537_2262735_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054233.1|2262751_2263240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|2263236_2263620_-	toxin	NA	NA	NA	NA	NA
WP_001360163.1|2263696_2264077_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086769.1|2264087_2264771_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.6	3.1e-27
WP_000692298.1|2264789_2265011_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|2265073_2265550_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|2265565_2266051_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234732.1|2266142_2266961_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	1.0e-45
WP_000820472.1|2267287_2270134_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069757.1|2270505_2271378_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000200811.1|2271641_2273213_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_000721956.1|2274062_2276285_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000183578.1|2276382_2277192_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_000019443.1|2278305_2279298_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.2e-182
WP_162842843.1|2279745_2280959_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	3.9e-166
WP_089578733.1|2280951_2282081_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.5e-47
WP_000654812.1|2282077_2283046_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_160379547.1|2284329_2285475_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000683047.1|2285475_2286366_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000828112.1|2286362_2287517_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.6	7.7e-79
WP_001084506.1|2287535_2289428_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_000433876.1|2289442_2290183_-	O-antigen export ABC transporter ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	27.2	3.5e-08
WP_000876712.1|2290182_2290950_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012311662.1|2292407_2292560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012311606.1|2292585_2294205_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	2554185	2567107	5068389		Escherichia_phage(83.33%)	6	NA	NA
WP_000368131.1|2554185_2555118_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001361863.1|2555705_2556224_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	1.4e-83
WP_012311963.1|2556283_2564197_-	phase-variable autotransporter adhesin UpaE	NA	A0A2L1IV38	Escherichia_phage	93.4	0.0e+00
WP_000243052.1|2564221_2564842_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
WP_001181154.1|2565159_2565789_-	tyrosine-type DNA invertase IpuA	NA	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_001224626.1|2566537_2567107_+	tyrosine-type DNA invertase IpuB	NA	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
>prophage 5
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	3168081	3221243	5068389	integrase,transposase,tRNA,protease	Stx2-converting_phage(50.0%)	43	3183982:3183999	3241092:3241109
WP_001297457.1|3168081_3168840_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3168887_3169808_-	agmatinase	NA	NA	NA	NA	NA
WP_000758893.1|3169943_3170675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3170820_3172797_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3172805_3172937_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3173072_3173288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3173591_3174746_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3175181_3176576_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3176652_3177150_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286519.1|3177244_3177952_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001376015.1|3178031_3178763_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3178775_3179726_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001355636.1|3179834_3180398_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3180397_3180814_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001546096.1|3180992_3181973_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3181990_3182695_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3182712_3183279_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3183275_3183566_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174747.1|3183573_3184167_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
3183982:3183999	attL	CACGGTAGCTGGCCGGGC	NA	NA	NA	NA
WP_000239978.1|3184159_3185296_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745201.1|3185364_3186372_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3186488_3187535_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3187710_3188430_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3188613_3188940_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3188939_3189659_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001376017.1|3189819_3190872_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3190899_3191175_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001618095.1|3191238_3192318_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001360964.1|3192519_3193776_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001376254.1|3193822_3195958_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001218742.1|3197410_3198595_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
WP_000053331.1|3198744_3199755_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000253907.1|3199850_3201977_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083368.1|3202039_3203317_+	MFS transporter	NA	NA	NA	NA	NA
WP_024144973.1|3203313_3204747_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001037798.1|3204941_3206336_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_012311683.1|3207579_3207804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|3210659_3211337_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3211336_3211684_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381337.1|3211703_3213278_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.2	6.0e-167
WP_001266790.1|3214174_3216262_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	33.8	2.3e-09
WP_001354603.1|3218015_3219047_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000881113.1|3220850_3221243_+|transposase	transposase	transposase	NA	NA	NA	NA
3241092:3241109	attR	GCCCGGCCAGCTACCGTG	NA	NA	NA	NA
>prophage 6
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	3231312	3310462	5068389	transposase	Enterobacteria_phage(23.53%)	60	NA	NA
WP_000952436.1|3231312_3232485_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.4	4.0e-224
WP_000248798.1|3232550_3232871_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.9	8.8e-33
WP_000502867.1|3236888_3237533_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.5	1.6e-54
WP_012311602.1|3237517_3238744_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.2	1.1e-64
WP_024211228.1|3244028_3244349_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012311653.1|3245597_3245822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823671.1|3245950_3246475_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
WP_113684727.1|3246928_3248156_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.2e-177
WP_106376905.1|3248277_3248511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555617.1|3251172_3252087_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983727.1|3252086_3252914_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.9	5.6e-07
WP_001101719.1|3252910_3253768_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968123.1|3253764_3254643_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000973518.1|3257232_3259434_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_012311881.1|3259515_3260793_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015723.1|3260789_3262532_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011911.1|3262531_3263479_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|3263479_3265204_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095522.1|3265339_3266533_+	MFS transporter	NA	NA	NA	NA	NA
WP_032145598.1|3270341_3270566_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000920000.1|3270858_3271968_-	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	76.5	2.0e-20
WP_032346664.1|3272790_3272904_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_001323513.1|3274496_3274688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323514.1|3274756_3275005_+	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001167455.1|3275022_3275571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958153.1|3275771_3276008_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991602.1|3276076_3276649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075482.1|3277009_3277741_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000147745.1|3279259_3280390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010402.1|3280574_3281459_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_001282919.1|3281661_3282342_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097302.1|3282489_3283167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278287.1|3283172_3283406_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001175148.1|3283495_3284314_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
WP_000860076.1|3284395_3284875_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001424026.1|3284890_3285367_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692309.1|3285429_3285651_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001285415.1|3285730_3286105_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854735.1|3286151_3286529_+	toxin	NA	NA	NA	NA	NA
WP_000761676.1|3286525_3287014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839291.1|3287025_3287223_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001280433.1|3287307_3288174_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001143297.1|3288245_3288509_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000779482.1|3288505_3288832_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001298261.1|3290288_3291272_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
WP_000905920.1|3291343_3292492_+	capsule polysaccharide export inner-membrane protein KpsE	NA	NA	NA	NA	NA
WP_001332993.1|3292515_3294192_+	polysialic acid transporter KpsD	NA	NA	NA	NA	NA
WP_012311673.1|3294201_3294942_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000579532.1|3294938_3296972_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_001161844.1|3296994_3298200_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_000575413.1|3299835_3301065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197078.1|3301054_3302203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000723248.1|3302195_3303371_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_001259304.1|3303367_3304624_-	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000066002.1|3304623_3305664_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_000038461.1|3305660_3306284_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000590258.1|3306333_3306993_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
WP_000124301.1|3306989_3307766_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012311830.1|3308799_3309999_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	93.2	3.5e-167
WP_001175008.1|3310057_3310462_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	1.4e-32
>prophage 7
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	4081596	4092196	5068389	integrase	Enterobacteria_phage(100.0%)	11	4071907:4071920	4088848:4088861
4071907:4071920	attL	AGATATTGATTTTG	NA	NA	NA	NA
WP_001218976.1|4081596_4082760_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.7	1.2e-209
WP_000365012.1|4082772_4085493_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_012311686.1|4085694_4086267_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.9	5.3e-97
WP_000984201.1|4086281_4086527_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_001283022.1|4086523_4087258_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
WP_001149160.1|4087810_4088077_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980222.1|4088073_4088664_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001244665.1|4088656_4088944_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
4088848:4088861	attR	AGATATTGATTTTG	NA	NA	NA	NA
WP_000459327.1|4088936_4089392_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
WP_000856729.1|4089527_4089848_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783687.1|4089862_4092196_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
>prophage 8
NC_010498	Escherichia coli SMS-3-5, complete sequence	5068389	4371622	4461152	5068389	head,tail,plate,integrase,protease,lysis,tRNA,holin,terminase,capsid,transposase,portal	Escherichia_phage(32.0%)	96	4408771:4408817	4443772:4443818
WP_000560983.1|4371622_4372060_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4372104_4373046_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000226332.1|4373461_4375276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298592.1|4375971_4376190_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001309881.1|4376408_4376651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027718.1|4376979_4377909_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829018.1|4377905_4378541_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4378537_4379440_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_012311905.1|4379452_4382503_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753600.1|4382696_4383533_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000105771.1|4383842_4385678_+	ATP-binding protein	NA	A0A1V0SAD6	Catovirus	24.3	6.6e-24
WP_000355938.1|4385679_4387986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012311904.1|4388180_4389236_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931327.1|4389291_4391040_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001019502.1|4391039_4392110_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446000.1|4392099_4393551_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729606.1|4393561_4394008_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000749944.1|4394484_4395879_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619503.1|4395919_4396234_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179733.1|4396243_4397068_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211494.1|4397150_4398410_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144113.1|4398406_4399876_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217150.1|4400163_4401000_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_012311625.1|4400983_4401922_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063508.1|4401918_4402953_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001361705.1|4403237_4403858_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	1.1e-63
WP_001166063.1|4404117_4405101_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270277.1|4405249_4405924_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4406028_4407402_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4407398_4408097_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4408246_4408747_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4408771:4408817	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023386.1|4408932_4409913_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192857.1|4409982_4410276_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4410428_4410701_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_024210514.1|4410676_4410874_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
WP_000217671.1|4410870_4411371_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|4411434_4411659_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|4411658_4411961_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113264.1|4411960_4412185_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4412181_4412457_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_000268608.1|4412446_4414732_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_001696366.1|4414731_4415184_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.0e-79
WP_000554771.1|4415183_4415390_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|4415632_4416571_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_001350076.1|4416567_4417593_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_000368931.1|4417597_4418671_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038165.1|4419086_4420121_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_000156845.1|4420120_4421893_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_001085972.1|4422066_4422921_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248571.1|4422979_4424053_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	2.5e-201
WP_000203422.1|4424056_4424800_+|terminase	terminase endonuclease subunit	terminase	Q94MG8	Enterobacteria_phage	100.0	2.8e-122
WP_000988633.1|4424899_4425409_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846415.1|4425408_4425612_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
WP_000123127.1|4425615_4425897_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	98.9	3.7e-43
WP_001144099.1|4425896_4426394_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	1.7e-91
WP_000736589.1|4426408_4426834_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	93.6	1.4e-57
WP_000040662.1|4426821_4427247_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_000917174.1|4427354_4427822_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001001781.1|4427814_4428267_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_000490546.1|4428338_4429124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093714.1|4429207_4429843_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_000127163.1|4429839_4430187_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121500.1|4430191_4431100_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	6.3e-161
WP_001285325.1|4431092_4431623_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_000104681.1|4431633_4433655_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	3.5e-260
WP_000972099.1|4433656_4434184_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_000014361.1|4434399_4435299_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_001286680.1|4435618_4436809_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|4436821_4437340_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4437396_4437672_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4437704_4437824_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069974.1|4437816_4440264_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.0	0.0e+00
WP_000978888.1|4440278_4440758_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	7.3e-84
WP_000882932.1|4440757_4441921_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	98.2	2.9e-203
WP_000468308.1|4442002_4442221_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_024179531.1|4442259_4443606_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001076748.1|4443896_4444799_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4443772:4443818	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4444979_4445942_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4446261_4447251_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708998.1|4447357_4448113_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4448167_4448935_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802233.1|4449042_4449642_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4449742_4450183_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4450394_4450694_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4450720_4451149_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796322.1|4451153_4451900_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4451996_4453007_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4453141_4454650_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4454672_4455518_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4455942_4456188_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_122991692.1|4456226_4456853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572157.1|4456975_4457650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|4457709_4458195_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4458287_4459214_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4459280_4460612_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4460621_4461152_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NC_010488	Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence	130440	50337	78056	130440	integrase,protease,transposase	Macacine_betaherpesvirus(33.33%)	20	57397:57411	72518:72532
WP_000082154.1|50337_51309_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_001513511.1|52513_52852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817028.1|53663_54635_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|54634_55801_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|56953_58456_-	hypothetical protein	NA	NA	NA	NA	NA
57397:57411	attL	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000238252.1|59055_59505_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000190053.1|59622_60102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968140.1|61385_62243_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|62239_63097_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|63093_63921_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|63920_64835_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_085947772.1|67319_68532_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000361611.1|69077_70055_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|70339_71080_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_014640565.1|71200_71389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|71762_72665_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
72518:72532	attR	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000771475.1|72733_73843_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|74275_75229_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|76501_76660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|76843_78056_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
>prophage 2
NC_010488	Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence	130440	84260	98568	130440	integrase,transposase	Escherichia_phage(45.45%)	13	85310:85369	106441:107262
WP_000016493.1|84260_85052_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
85310:85369	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|85372_86077_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|86857_87562_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|87705_88347_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|88496_88997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|89076_89781_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|90228_91242_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|91397_91871_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|91940_92645_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|93015_95982_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|96060_97065_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|97246_97423_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|97752_98568_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
106441:107262	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTACTGAGCAGACTGACTCCAGGCCTGATAAGAGAACGTAATTTCGAAGAGTGCGCAGGACTGGTTCATTTTTTCTTCGATCACACCGATGAGGTGAGCACTCGCTTCAGTATCCGTAACCCATGGTTTTCCCTGCGTGAAATGGCCATTAATGAGGTTGTACGGCATCTGCTGAAGCATATGCAGGATATTGATGAGACCAGAACGATCACGCTTATGGAAAAACTGATCGTTACGGGTGCTTCGCCGTTCTGGATAGCCGATTTTATGCGGGATCTTATCTGGGAACATGGACTTGCTCAGAATGCAGTACCTTCGCCTTCAGACGCTCTTTTCAGTCGCGATATTACGGAACGGTTGCGTGACAGGTTTGCGGAACGTATGAATCAACCAGAACTTCAGCAACAGCTTCTCCTGCGCAAGTCTCTTCTCGGGTATCTCTACGCCTGGAGAGACATGAGTTCAGGTGAAACCGTGAAGCAATGGGTCAGAGAAGTTACTACCACTGATGAAGGCCTTGTTAACCTGTTGATACGATTACAGACCAGTGTCTTCAGCTCCCACCGAGGGGCATATCGCCGGATTGCGCGTGACCAGGTCAGTCCGTTCTTTGATGACTGGCCAGCAGTCGAAGAGAAGTTGAAGGTTATGCTGTCCGGCAACGAGCTGACTCCGGAGCAGGAAGCGCTCAAAACAGCGCTGGAAAATGACGACTGACCAAAAATTAAGGCCGCTTAGCGGCCTTTTTCTTACTAAATGAAGG	NA	NA	NA	NA
