The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010622	Paraburkholderia phymatum STM815 chromosome 1, complete sequence	3479187	635153	649013	3479187	protease	Streptococcus_phage(12.5%)	11	NA	NA
WP_012399977.1|635153_637259_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	25.9	6.4e-55
WP_012399978.1|637526_638042_-	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	42.4	3.6e-12
WP_028370957.1|638186_638381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012399980.1|638814_639384_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012399981.1|639715_640972_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	1.3e-10
WP_007586257.1|642760_642967_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	4.0e-23
WP_012399982.1|643499_643814_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	41.2	1.7e-12
WP_012399983.1|643810_646111_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	6.1e-168
WP_012399984.1|646212_646659_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.0	2.3e-47
WP_012399985.1|646723_647728_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012399986.1|647801_649013_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	2.3e-41
>prophage 2
NC_010622	Paraburkholderia phymatum STM815 chromosome 1, complete sequence	3479187	2120887	2138968	3479187	tail,plate	Moraxella_phage(15.38%)	24	NA	NA
WP_041763899.1|2120887_2121064_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	56.4	1.4e-08
WP_012401246.1|2121119_2121536_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PH90	Moraxella_phage	59.6	4.8e-39
WP_041763505.1|2121568_2121874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401247.1|2121908_2122289_-	DUF1353 domain-containing protein	NA	M1PQ58	Synechococcus_phage	38.2	2.8e-09
WP_012401248.1|2122288_2122708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401249.1|2122749_2122962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401250.1|2123013_2123853_-	hypothetical protein	NA	I6WLM5	Burkholderia_virus	50.3	2.2e-43
WP_012401251.1|2123921_2124419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401252.1|2124415_2124988_-	lysozyme	NA	A0A059VA40	Pseudomonas_phage	48.8	2.5e-38
WP_041763509.1|2124989_2125289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401254.1|2125473_2125758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401255.1|2125760_2126453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401256.1|2126505_2127699_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	25.1	2.3e-17
WP_052306069.1|2127688_2127880_-	hypothetical protein	NA	Q6UIZ9	Burkholderia_virus	50.9	4.6e-05
WP_012401258.1|2128762_2129356_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_012401259.1|2129364_2130468_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	33.5	1.9e-34
WP_083775865.1|2130467_2131034_-	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	37.7	2.2e-18
WP_012401261.1|2131681_2132281_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_012401262.1|2132277_2133369_-	Mu P family protein	NA	M1PVV2	Vibrio_phage	30.1	1.1e-31
WP_012401263.1|2133372_2134845_-	DNA circulation family protein	NA	U5P4I0	Shigella_phage	24.6	3.0e-19
WP_012401264.1|2134841_2136644_-|tail	phage tail tape measure protein	tail	Q4L1H3	Burkholderia_phage	24.5	8.8e-21
WP_012401265.1|2136762_2137050_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012401266.1|2137053_2137425_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012401267.1|2137486_2138968_-|tail	tail protein	tail	S5FKL0	Shigella_phage	39.1	3.0e-91
>prophage 3
NC_010622	Paraburkholderia phymatum STM815 chromosome 1, complete sequence	3479187	2148982	2172348	3479187	integrase	Burkholderia_virus(33.33%)	40	2156176:2156192	2172511:2172527
WP_157686524.1|2148982_2149453_-	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	31.7	2.9e-08
WP_157686525.1|2149562_2149802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041763915.1|2150349_2150790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686526.1|2151183_2151765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401284.1|2151794_2152049_-	hypothetical protein	NA	I6NMK4	Burkholderia_virus	42.5	2.4e-09
WP_012401285.1|2152045_2152312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401286.1|2152308_2152590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401287.1|2152586_2152847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401288.1|2152897_2153632_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	48.5	2.8e-58
WP_012401289.1|2153628_2154078_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	62.5	8.0e-40
WP_012401290.1|2154074_2154437_-	DUF4406 domain-containing protein	NA	A0A0U4IBL4	Pseudomonas_phage	54.2	9.3e-23
WP_041763515.1|2154433_2154922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401292.1|2154981_2155512_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	50.0	1.0e-17
WP_012401294.1|2155671_2155902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401295.1|2155898_2156918_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	64.4	4.4e-118
2156176:2156192	attL	TCGCCCTTGACCGGGAA	NA	NA	NA	NA
WP_012401296.1|2156914_2157226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401297.1|2157239_2157476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041763516.1|2157612_2157804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686572.1|2157805_2158150_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_052306070.1|2158305_2158593_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	59.3	2.1e-09
WP_012401300.1|2158678_2159674_+	LexA family transcriptional regulator	NA	B6SCU0	Bacteriophage	47.0	8.5e-26
WP_157686528.1|2159912_2160089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686529.1|2160106_2160310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686530.1|2160467_2160617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401302.1|2160648_2160984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401303.1|2161028_2161859_+	YfdQ family protein	NA	I6NVL7	Burkholderia_virus	36.6	3.6e-38
WP_012401304.1|2162050_2162797_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	45.0	1.4e-36
WP_012401305.1|2162799_2163777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401306.1|2163785_2165393_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	43.8	6.6e-137
WP_012401307.1|2165423_2166110_+	hypothetical protein	NA	A4JWW2	Burkholderia_virus	58.0	1.9e-08
WP_012401308.1|2166111_2166621_+	hypothetical protein	NA	A0A2I7RKD9	Vibrio_phage	42.2	2.2e-22
WP_052306105.1|2166653_2167139_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	60.4	1.5e-47
WP_012401310.1|2167135_2167333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401311.1|2167344_2167923_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_041763520.1|2167879_2168290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012401313.1|2168319_2169207_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	64.7	6.5e-110
WP_157686531.1|2169203_2169671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012401315.1|2169667_2169889_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_012401316.1|2169888_2170941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	31.5	4.8e-27
WP_012401317.1|2171358_2172348_-	zinc-ribbon domain-containing protein	NA	A0A1V0SKV6	Klosneuvirus	27.0	3.3e-30
2172511:2172527	attR	TTCCCGGTCAAGGGCGA	NA	NA	NA	NA
>prophage 4
NC_010622	Paraburkholderia phymatum STM815 chromosome 1, complete sequence	3479187	2801395	2810545	3479187		Pandoravirus(33.33%)	7	NA	NA
WP_012401868.1|2801395_2803012_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	34.5	7.6e-24
WP_012401869.1|2803060_2803651_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	40.1	2.6e-14
WP_041764031.1|2803662_2804343_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_012401871.1|2804385_2805201_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	29.6	2.6e-36
WP_012401872.1|2805304_2807170_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	32.7	6.9e-53
WP_012401873.1|2807194_2808328_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.3	8.2e-25
WP_012401874.1|2808583_2810545_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	48.7	4.6e-148
>prophage 1
NC_010623	Paraburkholderia phymatum STM815 chromosome 2, complete sequence	2697374	148251	219219	2697374	integrase,holin,transposase	Burkholderia_phage(40.0%)	57	154483:154498	167802:167817
WP_012402562.1|148251_149355_-|transposase	IS5-like element ISBph3 family transposase	transposase	NA	NA	NA	NA
WP_012402564.1|151121_152426_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	51.6	2.7e-112
WP_012402565.1|153283_153865_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012402566.1|153892_154384_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_012402567.1|154447_155914_-	indoleacetamide hydrolase	NA	NA	NA	NA	NA
154483:154498	attL	CGATCTGGCGGGCAAG	NA	NA	NA	NA
WP_012402568.1|157194_158121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157686753.1|159117_159333_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	55.1	8.0e-14
WP_012402570.1|159817_161092_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	68.4	6.3e-175
WP_085965105.1|161312_161954_-	GTP cyclohydrolase II	NA	A0A2I2L4Y7	Orpheovirus	41.9	1.4e-29
WP_012402572.1|162300_162735_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012402573.1|162992_163319_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_012402574.1|163549_164188_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_012402575.1|164515_164872_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_041764907.1|165101_166193_+	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_041764909.1|166231_167107_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012402578.1|167367_168177_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
167802:167817	attR	CGATCTGGCGGGCAAG	NA	NA	NA	NA
WP_012402579.1|168220_168967_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012402580.1|168963_169620_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012402581.1|170190_171459_-	cytochrome c	NA	NA	NA	NA	NA
WP_012402582.1|171470_173711_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_012402583.1|173712_174168_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012402584.1|174461_179090_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157686755.1|179062_180256_-	cellulase	NA	NA	NA	NA	NA
WP_012402586.1|180296_182861_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_012402587.1|182864_185096_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_012402588.1|185092_185881_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_041764272.1|185877_186735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012402590.1|186859_187315_-	cellulose synthase	NA	NA	NA	NA	NA
WP_041764912.1|187650_188052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012402592.1|188142_188961_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012402593.1|189080_190076_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	41.7	8.3e-13
WP_012402594.1|190481_190889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012402595.1|190912_191668_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012402596.1|191829_192417_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012402597.1|192871_193870_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012402598.1|194426_195551_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012402599.1|195547_196534_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012402600.1|196533_197058_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_012402601.1|197054_198257_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_041764916.1|198283_199516_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_157686757.1|199682_200324_-	sugar transferase	NA	NA	NA	NA	NA
WP_041764275.1|200997_201993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012402605.1|202126_204337_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_085965115.1|204355_204790_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012402607.1|204854_206027_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041764925.1|206381_207485_+	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_012402609.1|207558_208644_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012402610.1|209020_209308_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_012402611.1|209355_210291_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012402612.1|210345_210837_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012402613.1|210923_211889_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_012402614.1|211938_212868_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_012402615.1|212954_213905_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012402616.1|214219_215215_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012402617.1|215286_216429_-	porin	NA	NA	NA	NA	NA
WP_012402618.1|216670_217636_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012402619.1|217677_219219_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
>prophage 1
NC_010625	Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence	1904893	661144	689124	1904893	transposase,plate	Escherichia_phage(50.0%)	26	NA	NA
WP_012405326.1|661144_662491_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012405327.1|662514_663021_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012405328.1|663138_663624_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012405329.1|663702_665196_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012405330.1|665220_665754_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012405331.1|665803_668524_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	32.7	8.1e-87
WP_012405332.1|668948_669632_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_012405333.1|669628_670495_+	virulence protein SciE type	NA	NA	NA	NA	NA
WP_012405334.1|670481_671033_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012405335.1|671059_672949_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012405336.1|672948_674037_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012405337.1|674033_675119_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_012405338.1|675122_675779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686867.1|675750_676455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405340.1|676638_678783_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_012405341.1|678825_681066_+	M23 family metallopeptidase	NA	G3BM12	Salmonella_phage	29.0	2.8e-08
WP_012405342.1|681062_681656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405343.1|681695_681950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405344.1|681981_682656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052306199.1|682616_683600_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_052306200.1|683569_684685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686868.1|684867_685413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405346.1|685479_686142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405347.1|686268_686934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012405348.1|687104_688211_+|transposase	IS5-like element ISBph2 family transposase	transposase	NA	NA	NA	NA
WP_095211895.1|688366_689124_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_010627	Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence	595108	128433	205889	595108	integrase,transposase	Phage_21(16.67%)	56	128921:128939	202395:202413
WP_012406494.1|128433_129564_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
128921:128939	attL	TTGAGGACCGCCTCGCGCA	NA	NA	NA	NA
WP_012406497.1|132168_133401_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012406498.1|134194_134740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406499.1|134791_135319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406500.1|135616_136168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146174482.1|137455_137797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406501.1|138648_139440_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_052306260.1|141007_141478_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012406504.1|142089_144249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406505.1|144296_144860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107203824.1|145166_145454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406507.1|145624_145996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146174484.1|146415_146724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686956.1|147272_147449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406509.1|147596_147947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406511.1|148687_148906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167538912.1|149164_149335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406514.1|149477_149678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146174485.1|149717_149987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406515.1|149983_150403_+	excisionase domain-containing protein	NA	NA	NA	NA	NA
WP_052306261.1|150408_151005_+	hypothetical protein	NA	O21940	Phage_21	39.5	4.2e-20
WP_041766554.1|151674_151983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406517.1|152051_152303_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_157686957.1|152536_152695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406518.1|153129_153333_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	8.3e-21
WP_012406519.1|153745_154510_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012406520.1|154987_155431_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_012406521.1|155740_156241_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_012406522.1|156237_156759_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_041766558.1|157189_157567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041766560.1|157612_158212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063713894.1|158301_158712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406526.1|158924_159866_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012406527.1|159961_160417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406426.1|160872_161883_-	YecA family protein	NA	NA	NA	NA	NA
WP_012406528.1|162439_163636_+	pectate lyase	NA	A0A076FFT1	Aureococcus_anophage	24.6	1.3e-07
WP_107203682.1|164187_166326_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	28.7	5.2e-20
WP_041766561.1|166607_166796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406530.1|167154_168996_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012406532.1|170152_171646_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	2.5e-29
WP_012406533.1|175678_177157_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012406534.1|177245_179309_+	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_012406537.1|183741_183990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406540.1|185491_186448_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_012406541.1|186434_187673_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_052306265.1|187776_188691_-	HTH-type transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_012406543.1|189401_190163_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012406544.1|190682_191996_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_107203684.1|192173_193235_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012406547.1|194453_195311_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012406548.1|196835_197414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406549.1|198067_199666_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012406550.1|200047_201064_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012406551.1|201865_202996_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
202395:202413	attR	TGCGCGAGGCGGTCCTCAA	NA	NA	NA	NA
WP_012406553.1|204013_204772_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.8	3.0e-63
WP_167538891.1|205634_205889_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_010627	Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence	595108	228639	256529	595108	integrase,transposase	Bacillus_phage(25.0%)	19	225548:225563	235299:235314
225548:225563	attL	CGGCGCATTGCTGCGC	NA	NA	NA	NA
WP_012406571.1|228639_229647_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	25.2	1.6e-11
WP_012406572.1|229633_230590_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012406573.1|230586_231843_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JBC4	uncultured_Caudovirales_phage	22.6	9.5e-06
WP_012405793.1|232354_233563_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012405792.1|233571_234450_-|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	30.3	1.3e-30
WP_012406574.1|235359_236871_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	54.6	1.1e-149
235299:235314	attR	CGGCGCATTGCTGCGC	NA	NA	NA	NA
WP_012406575.1|238311_238665_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_012406576.1|238664_239129_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_083775967.1|239209_239446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012406577.1|241111_242344_+	glutamine amidotransferase class-II	NA	NA	NA	NA	NA
WP_083775968.1|243001_243730_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083775976.1|243866_244271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406578.1|244326_244761_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_085965140.1|245371_245569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_107204265.1|245934_246816_+	GHMP kinase	NA	NA	NA	NA	NA
WP_052306267.1|246852_248478_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_012406581.1|250051_250774_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012406583.1|254003_254888_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012406584.1|255305_256529_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_010627	Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence	595108	331917	456947	595108	integrase,transposase	uncultured_Caudovirales_phage(17.65%)	82	371727:371743	396779:396808
WP_012406494.1|331917_333048_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012406651.1|334038_335280_+	cystathionine gamma-synthase family protein	NA	A0A2I2L687	Orpheovirus	24.1	1.6e-05
WP_012406652.1|335655_335955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406653.1|336580_338311_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	5.1e-10
WP_012406656.1|340416_340635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107203130.1|340634_340937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041766597.1|340991_341306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041766718.1|341374_342085_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_012406660.1|342132_343095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406661.1|343197_343557_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_012406662.1|343853_344132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041766720.1|344697_345099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041766600.1|345301_345526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406665.1|345522_347478_-	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	37.7	8.5e-54
WP_012406666.1|347479_347779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406667.1|347756_348317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406668.1|348409_350005_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.0	3.4e-16
WP_012406669.1|350555_353177_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012406670.1|353344_359959_-	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_012406671.1|361034_362291_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_012406672.1|362294_365756_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041766601.1|366078_366282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406673.1|366847_367297_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_012406674.1|367561_367738_+	DNA-binding protein HU-alpha	NA	NA	NA	NA	NA
WP_012406675.1|367806_368802_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	25.6	1.2e-16
WP_012406676.1|368794_369724_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012406677.1|369720_370962_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012406678.1|371381_371651_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
371727:371743	attL	CGTTCGACAGGGATTTG	NA	NA	NA	NA
WP_012406679.1|371753_372050_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
371727:371743	attL	CGTTCGACAGGGATTTG	NA	NA	NA	NA
WP_012406680.1|372046_372505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406681.1|372506_372812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406682.1|374028_375477_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012406684.1|376290_377352_+	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	29.9	7.7e-25
WP_012406685.1|377348_379244_+	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	24.9	5.6e-34
WP_012406686.1|379240_379603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406689.1|383648_383981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107203132.1|384033_384315_-	Y4bD/Y4pK family protein	NA	NA	NA	NA	NA
WP_095211896.1|384332_385358_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_107203129.1|388391_388886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012406692.1|388885_389239_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	5.7e-17
WP_012405793.1|391093_392302_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012405792.1|392310_393189_-|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	30.3	1.3e-30
WP_012406693.1|393452_394484_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A076YL28	Mesorhizobium_phage	27.9	1.2e-11
WP_012406694.1|394480_395458_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012406695.1|395454_396672_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167538891.1|398159_398414_+|transposase	transposase	transposase	NA	NA	NA	NA
396779:396808	attR	CTCCACATAACCGCGCGCTACACATAAGTC	NA	NA	NA	NA
WP_012404130.1|398602_399055_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
396779:396808	attR	CTCCACATAACCGCGCGCTACACATAAGTC	NA	NA	NA	NA
WP_012404129.1|399325_401410_+	recombinase family protein	NA	NA	NA	NA	NA
WP_041766609.1|403071_404058_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012406699.1|406020_407094_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_012406700.1|407422_408811_+	multi anti extrusion protein MatE	NA	NA	NA	NA	NA
WP_012406701.1|409523_413858_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	26.8	4.7e-36
WP_012406702.1|413873_414629_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012406703.1|415071_415668_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.3	7.1e-20
WP_012406704.1|419298_420885_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012406705.1|420895_421966_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012406706.1|422024_422939_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012406707.1|422940_423816_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_012406708.1|423812_424571_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-22
WP_012406709.1|424752_426249_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_012406710.1|427103_428459_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012406711.1|428553_429423_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107203687.1|429434_430322_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_167538906.1|430275_431283_+	DUF5376 domain-containing protein	NA	NA	NA	NA	NA
WP_012406713.1|431279_432278_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083775972.1|432307_432577_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107203689.1|432677_432827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012406714.1|432982_433807_+	inositol phosphatase	NA	NA	NA	NA	NA
WP_012406715.1|436054_436894_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.4	5.8e-76
WP_012406716.1|436890_437937_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.6	1.6e-75
WP_012404963.1|441180_442509_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012404130.1|443564_444017_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_167538891.1|444205_444460_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012406553.1|445322_446081_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.8	3.0e-63
WP_107204354.1|446748_447207_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_012406719.1|447241_447493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686964.1|447532_447706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167538907.1|447732_447933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107204378.1|451530_451788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012406723.1|452219_452588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012406724.1|452708_453299_-	hypothetical protein	NA	A0A2D1GNJ8	Pseudoalteromonas_phage	38.5	1.5e-25
WP_041766763.1|456671_456947_-|transposase	transposase	transposase	NA	NA	NA	NA
