The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	1388877	1397909	5589073	tRNA	Planktothrix_phage(16.67%)	9	NA	NA
WP_015903127.1|1388877_1389654_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.2	7.3e-25
WP_041273091.1|1389922_1390984_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015903129.1|1391001_1392516_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	36.4	5.0e-86
WP_015903130.1|1392535_1394686_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	32.8	4.1e-09
WP_015903131.1|1394682_1394907_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_049770407.1|1395068_1395755_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_015903133.1|1395754_1396684_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.9	3.5e-66
WP_015903134.1|1396719_1397040_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.0	6.7e-17
WP_015903135.1|1397189_1397909_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.6	5.4e-14
>prophage 2
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	1966889	2032583	5589073	transposase,integrase,protease	Acinetobacter_phage(23.08%)	56	1990522:1990568	1999621:1999667
WP_015903610.1|1966889_1967960_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015903611.1|1967961_1970967_+	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
WP_015903612.1|1970966_1971788_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015903613.1|1971790_1972405_+	poly-gamma-glutamate hydrolase family protein	NA	A0A076G746	Bacillus_phage	34.9	3.0e-21
WP_015903614.1|1972654_1973257_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0D3MVF0	Staphylococcus_phage	34.9	2.7e-27
WP_015903615.1|1973296_1973722_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_015903616.1|1973860_1979674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903617.1|1979670_1981953_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_015903618.1|1982536_1984171_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015903619.1|1984607_1986284_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015903620.1|1986318_1986633_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_015903621.1|1986902_1988282_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148214530.1|1988826_1989060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015903624.1|1989672_1990422_+	endonuclease	NA	NA	NA	NA	NA
1990522:1990568	attL	TGGTGCGCCTGGCGAGATTCGAACTCACGACCTCCTGATTCGTAGTC	NA	NA	NA	NA
WP_015903625.1|1990731_1991886_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	27.5	2.1e-15
WP_015903626.1|1991875_1992769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903627.1|1993010_1993226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903628.1|1993335_1995858_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_015903630.1|1996375_1997080_+	Rha family transcriptional regulator	NA	A0A2I7RDN1	Vibrio_phage	33.3	4.6e-26
WP_041273156.1|1997120_1997378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049770421.1|1997847_1998213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041273157.1|1998578_1998767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041273158.1|1998922_1999147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903633.1|1999794_2000247_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	38.5	5.6e-09
1999621:1999667	attR	TGGTGCGCCTGGCGAGATTCGAACTCACGACCTCCTGATTCGTAGTC	NA	NA	NA	NA
WP_015903634.1|2000249_2001539_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.9	4.6e-72
WP_187149348.1|2002297_2003683_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_015903637.1|2003811_2004156_+	DsrE family protein	NA	NA	NA	NA	NA
WP_187149349.1|2004917_2005532_+	DUF1638 domain-containing protein	NA	NA	NA	NA	NA
WP_041273159.1|2005590_2008137_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_015903640.1|2008105_2009002_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_015903641.1|2009272_2010346_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_148214751.1|2010393_2011128_+	lipo-like protein	NA	NA	NA	NA	NA
WP_015903643.1|2011198_2012560_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015903644.1|2012606_2013158_-	DUF4178 domain-containing protein	NA	NA	NA	NA	NA
WP_015903645.1|2013173_2013875_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_015903646.1|2013998_2014388_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_015903647.1|2014415_2015444_-	potassium channel family protein	NA	A0A249XST9	Mycobacterium_phage	40.0	1.7e-05
WP_015903648.1|2015600_2016056_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_015903649.1|2016033_2016645_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015903650.1|2016641_2017706_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.7	1.2e-14
WP_015903651.1|2017705_2018392_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015903652.1|2018408_2019245_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015903653.1|2019390_2019906_-	YfcE family phosphodiesterase	NA	NA	NA	NA	NA
WP_015903654.1|2019905_2020154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187149350.1|2020414_2021320_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015903656.1|2021339_2022194_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	33.8	1.1e-29
WP_015903657.1|2022297_2022990_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015903658.1|2022991_2024446_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	35.9	6.6e-35
WP_015903659.1|2024447_2025467_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.5	1.3e-66
WP_015903660.1|2025469_2026039_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	51.1	1.7e-50
WP_015903661.1|2026032_2027526_-	chorismate-binding protein	NA	S4VT78	Pandoravirus	35.0	6.8e-43
WP_041273160.1|2027949_2028213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041273161.1|2028203_2029712_+	methyltransferase	NA	NA	NA	NA	NA
WP_041273802.1|2029838_2030486_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_015903664.1|2030604_2032104_+|protease	serine protease	protease	NA	NA	NA	NA
WP_015903665.1|2032100_2032583_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	2220982	2259700	5589073	transposase,integrase,protease	Lactococcus_phage(100.0%)	38	2216223:2216238	2223560:2223575
2216223:2216238	attL	CTGTTGTTGAAAACGA	NA	NA	NA	NA
WP_148214523.1|2220982_2222062_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012662388.1|2222043_2222214_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012662387.1|2222195_2222957_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015903854.1|2223126_2223651_+	EpsI family protein	NA	NA	NA	NA	NA
2223560:2223575	attR	CTGTTGTTGAAAACGA	NA	NA	NA	NA
WP_015903855.1|2223647_2224052_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015903856.1|2224026_2224452_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_015903857.1|2224456_2225290_+	exosortase/archaeosortase family protein	NA	NA	NA	NA	NA
WP_015903858.1|2225424_2225685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041273839.1|2225681_2226068_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015903860.1|2226060_2226927_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015903862.1|2227219_2227903_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_083776556.1|2228018_2229119_+	FemAB family PEP-CTERM system-associated protein	NA	NA	NA	NA	NA
WP_015903864.1|2229134_2230379_+	TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase	NA	NA	NA	NA	NA
WP_015903865.1|2230381_2231521_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015903866.1|2231584_2232646_+	acyltransferase	NA	NA	NA	NA	NA
WP_015903867.1|2232674_2234222_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015903868.1|2234309_2235488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903869.1|2235610_2236180_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015903870.1|2236317_2237934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903871.1|2238310_2239411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903872.1|2239666_2240980_+|transposase	ISKra4-like element ISDau4 family transposase	transposase	NA	NA	NA	NA
WP_015903873.1|2241148_2242429_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015903874.1|2242433_2243762_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_015903875.1|2243774_2244395_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_041273190.1|2244441_2245566_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015903877.1|2245571_2246744_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015903878.1|2246757_2246997_+	addiction module protein	NA	NA	NA	NA	NA
WP_015903879.1|2246993_2247284_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015903880.1|2247312_2248584_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_015903881.1|2248595_2249600_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_015903882.1|2249624_2251001_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_015903883.1|2251012_2251801_-	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_015903884.1|2251849_2252833_+	TIGR03790 family protein	NA	NA	NA	NA	NA
WP_015903886.1|2253604_2254879_+	VanZ family protein	NA	NA	NA	NA	NA
WP_015903887.1|2254888_2255977_+	CapA family protein	NA	NA	NA	NA	NA
WP_015903888.1|2255973_2259126_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_148214759.1|2259155_2259335_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	47.5	7.1e-08
WP_015903890.1|2259418_2259700_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	2841851	2905569	5589073	transposase,tRNA	Enterobacteria_phage(30.0%)	54	NA	NA
WP_015904348.1|2841851_2844662_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.8e-81
WP_015904349.1|2844666_2845155_+	signal peptidase II	NA	NA	NA	NA	NA
WP_015904350.1|2845163_2845952_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_015904351.1|2845938_2847201_+	protein HolA	NA	NA	NA	NA	NA
WP_015904352.1|2847193_2848609_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_015904353.1|2848612_2848861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015904354.1|2849007_2849874_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_148214773.1|2849882_2850587_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_015904356.1|2850628_2852116_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	38.7	6.4e-78
WP_015904357.1|2852115_2853447_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	M4QFZ1	Prochlorococcus_phage	33.0	1.5e-41
WP_015904358.1|2853463_2853862_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_015904359.1|2853973_2855224_-	protein GcvT	NA	NA	NA	NA	NA
WP_015904360.1|2855509_2856943_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_015904361.1|2857090_2857534_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015904362.1|2857602_2858316_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.7	1.3e-07
WP_015904363.1|2858315_2859089_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	24.4	5.8e-14
WP_015904364.1|2859088_2860399_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015904365.1|2860427_2861342_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_041273242.1|2861684_2862866_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015904367.1|2863208_2865788_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.5	1.2e-119
WP_015904368.1|2865782_2866832_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_015904369.1|2866828_2867230_-	response regulator	NA	NA	NA	NA	NA
WP_015904370.1|2867315_2868248_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_015904371.1|2868535_2869549_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_041273243.1|2869550_2870759_+	protein GlmU	NA	NA	NA	NA	NA
WP_015904373.1|2870783_2872175_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_015904374.1|2872187_2872583_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_041273932.1|2872707_2874399_+	bifunctional sulfate adenylyltransferase/adenylylsulfate kinase	NA	A0A2P1ELS9	Moumouvirus	36.6	4.6e-104
WP_187149243.1|2874576_2874834_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015904377.1|2874830_2876090_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_015904378.1|2876161_2877058_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_148214616.1|2877624_2877912_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_015904381.1|2877908_2878430_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015904382.1|2878505_2879381_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.3	3.3e-98
WP_015904383.1|2879385_2879934_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	7.2e-51
WP_015904384.1|2880028_2881468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015904386.1|2882503_2883052_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.3	1.8e-49
WP_015904387.1|2883231_2884365_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015904388.1|2884438_2885770_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015904389.1|2885837_2887022_+	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_015904390.1|2887025_2888141_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_148214774.1|2888395_2888563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015904392.1|2888669_2889566_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015904393.1|2889617_2890055_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_041273245.1|2891553_2892807_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_041273246.1|2892867_2894067_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015904396.1|2894081_2895080_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015904397.1|2895083_2896184_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041273938.1|2897113_2898532_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_049770444.1|2898637_2900029_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015904400.1|2900240_2901692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015904401.1|2901742_2902423_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_015904402.1|2902622_2903498_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_012663325.1|2903928_2905569_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	2983628	3011236	5589073	transposase,integrase	Pelagibacter_phage(25.0%)	17	2980678:2980694	3017405:3017421
2980678:2980694	attL	AACAGGCCTTGAGGATA	NA	NA	NA	NA
WP_015904471.1|2983628_2985317_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_015904472.1|2985303_2985885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015904473.1|2985884_2986256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012663014.1|2986556_2986955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015904475.1|2987452_2991004_-	AAA family ATPase	NA	M1HLN3	Pelagibacter_phage	26.5	2.1e-10
WP_015904476.1|2991212_2992043_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015904479.1|2992657_2992963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187149248.1|2992959_2993451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015904484.1|2995576_2995672_+	UvrB/UvrC motif-containing protein	NA	NA	NA	NA	NA
WP_015904485.1|2997004_2997577_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_015904489.1|3000452_3001124_-	putative reverse transcriptase/maturase family protein	NA	NA	NA	NA	NA
WP_015904491.1|3001914_3003144_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041273261.1|3003140_3004127_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015904493.1|3004113_3005127_+|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.6	2.1e-19
WP_015904495.1|3006413_3007061_-	protein LtrA	NA	A0A0C5K882	ANMV-1_virus	21.8	4.9e-06
WP_015904497.1|3007901_3009956_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	38.0	1.1e-62
WP_015904499.1|3010543_3011236_+|transposase	transposase	transposase	NA	NA	NA	NA
3017405:3017421	attR	AACAGGCCTTGAGGATA	NA	NA	NA	NA
>prophage 6
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	3542212	3550490	5589073	tRNA	Staphylococcus_phage(42.86%)	11	NA	NA
WP_015904969.1|3542212_3542686_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.7	3.4e-33
WP_015904970.1|3542716_3543922_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.8	2.7e-98
WP_015904971.1|3543940_3544609_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.4	4.5e-31
WP_041274024.1|3544623_3545736_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.7	1.9e-50
WP_015904973.1|3545728_3546226_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_041274025.1|3546222_3546678_-	cytidine deaminase	NA	A7KUY9	Bacillus_phage	40.9	3.1e-23
WP_187149263.1|3546682_3547954_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.4	4.2e-94
WP_148214789.1|3547956_3548409_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_015904977.1|3548430_3548664_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_015904978.1|3548708_3548894_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_015904979.1|3549098_3550490_+|tRNA	glutamate--tRNA ligase	tRNA	A0A1V0SFT2	Hokovirus	30.0	2.7e-09
>prophage 7
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	3878968	3936914	5589073	transposase,integrase	Bacillus_thuringiensis_phage(16.67%)	58	3873473:3873494	3942127:3942148
3873473:3873494	attL	TTTATATGAAACACTCACCAAA	NA	NA	NA	NA
WP_015904912.1|3878968_3880522_-|transposase	IS1380-like element ISDau2 family transposase	transposase	NA	NA	NA	NA
WP_015905259.1|3880638_3882264_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_015905260.1|3883014_3883920_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083776608.1|3884388_3884613_+	response regulator	NA	NA	NA	NA	NA
WP_015905262.1|3885120_3886203_+	response regulator	NA	NA	NA	NA	NA
WP_015905263.1|3886357_3887212_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012663095.1|3887429_3887624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012663096.1|3887623_3887953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015905264.1|3888076_3888739_+	cobalamin B12-binding domain-containing protein	NA	NA	NA	NA	NA
WP_187149366.1|3889552_3890245_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012663098.1|3890222_3891911_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_012663155.1|3891897_3892479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012663013.1|3892478_3892850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012663014.1|3893150_3893549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148214657.1|3894084_3894480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015905266.1|3894498_3895011_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015905267.1|3895068_3897393_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_148214801.1|3897642_3900120_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_015905269.1|3900181_3900577_+	hemerythrin family protein	NA	NA	NA	NA	NA
WP_015905270.1|3900604_3901084_+	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_015905271.1|3901080_3901929_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_015905272.1|3901947_3902373_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	1.8e-09
WP_148214802.1|3902386_3902776_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_015905274.1|3902799_3903846_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_015905275.1|3903870_3904653_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015905276.1|3904701_3905214_+	chemotaxis protein CheD	NA	NA	NA	NA	NA
WP_015905277.1|3905280_3906645_+	ABC transporter substrate-binding protein	NA	Q8QKV4	Ectocarpus_siliculosus_virus	32.8	8.7e-05
WP_049770544.1|3906821_3908261_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_187149271.1|3908249_3908522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015905281.1|3909088_3909670_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	42.5	1.2e-27
WP_015905282.1|3910103_3911603_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_041273338.1|3911735_3911969_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015905284.1|3912753_3913041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015905285.1|3913359_3914553_+	MFS transporter	NA	NA	NA	NA	NA
WP_015905286.1|3914577_3915270_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_015905287.1|3915404_3915845_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_015905288.1|3915982_3917467_+	sugar (pentulose and hexulose) kinase	NA	NA	NA	NA	NA
WP_015905289.1|3917664_3918606_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_148214803.1|3918677_3919604_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015905291.1|3919622_3920390_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	3.6e-16
WP_015905292.1|3920452_3921085_-	DUF3786 domain-containing protein	NA	NA	NA	NA	NA
WP_083776609.1|3921157_3921400_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148214658.1|3921544_3921847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015905295.1|3921969_3922272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015905296.1|3922510_3924088_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_015905297.1|3924328_3924967_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_015905298.1|3925174_3926062_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_015905299.1|3926243_3926930_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_015905300.1|3927029_3927683_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_015903451.1|3928381_3929638_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.1	6.9e-49
WP_148214659.1|3929904_3930015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015905302.1|3930308_3930959_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_041274081.1|3931086_3932157_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_015905304.1|3932254_3932770_+	flavodoxin domain-containing protein	NA	NA	NA	NA	NA
WP_148214660.1|3933289_3934090_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_015905306.1|3934349_3935336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903891.1|3935803_3936652_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	28.8	7.8e-20
WP_015903890.1|3936632_3936914_-|transposase	transposase	transposase	NA	NA	NA	NA
3942127:3942148	attR	TTTGGTGAGTGTTTCATATAAA	NA	NA	NA	NA
>prophage 8
NC_012108	Desulfobacterium autotrophicum HRM2, complete sequence	5589073	4916221	5032542	5589073	transposase,integrase	Leptospira_phage(25.0%)	100	4977092:4977106	5032585:5032599
WP_015903451.1|4916221_4917478_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.1	6.9e-49
WP_049770491.1|4917778_4919509_-	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.8	7.6e-46
WP_015906162.1|4919758_4919974_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_015906163.1|4920470_4921127_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_041273427.1|4921129_4922041_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_015906165.1|4922054_4922645_-	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	31.2	6.8e-07
WP_015906166.1|4923054_4923384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906167.1|4923727_4924096_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_083776632.1|4924751_4926410_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	80.6	4.3e-06
WP_015906169.1|4926958_4928098_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_015906170.1|4928289_4928847_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_083776633.1|4928902_4930075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906172.1|4930193_4931105_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_015906174.1|4931783_4932266_-	universal stress protein	NA	NA	NA	NA	NA
WP_015906176.1|4932648_4933266_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015906177.1|4933349_4934168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906178.1|4934275_4934659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906179.1|4934705_4935125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906180.1|4935274_4936873_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_015906181.1|4937259_4938144_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_015906182.1|4939516_4943632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906183.1|4943815_4944430_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_187149373.1|4944607_4944949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083776634.1|4945052_4945412_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_015906186.1|4945408_4945642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041273431.1|4945914_4946220_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.0	1.6e-12
WP_148214689.1|4946508_4949934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049770492.1|4950613_4950859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906190.1|4951634_4953251_-	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_015906191.1|4953540_4955574_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_015906192.1|4955725_4957585_-	aldehyde ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_187149298.1|4957621_4957783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906193.1|4957801_4959259_-	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_015906194.1|4959285_4960065_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_015906196.1|4960230_4961775_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.7	3.5e-95
WP_015906197.1|4961786_4963232_-	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_015906198.1|4963317_4964259_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015906199.1|4964255_4966334_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	2.0e-16
WP_015906200.1|4966330_4967257_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015906201.1|4967328_4968837_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015906202.1|4970074_4970761_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015906203.1|4971085_4972555_-	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_041274234.1|4973310_4973595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083776635.1|4973732_4975175_+	trimethylamine methyltransferase family protein	NA	NA	NA	NA	NA
WP_083776636.1|4975216_4975501_-	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_015906207.1|4975919_4976309_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_015906208.1|4976505_4977159_-	HAD family hydrolase	NA	NA	NA	NA	NA
4977092:4977106	attL	TCTGCAAGGTCTTCT	NA	NA	NA	NA
WP_015906209.1|4977263_4977797_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
4977092:4977106	attL	TCTGCAAGGTCTTCT	NA	NA	NA	NA
WP_015906210.1|4977793_4978063_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_187149299.1|4978721_4980380_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015906211.1|4980564_4981104_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015906212.1|4981287_4981800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012663014.1|4982208_4982607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015906213.1|4982907_4983279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012663155.1|4983278_4983860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012663098.1|4983846_4985535_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_187149366.1|4985512_4986205_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015906214.1|4986739_4988212_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015906217.1|4989418_4990267_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	20.2	1.7e-06
WP_015906218.1|4990592_4991441_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	28.4	3.0e-19
WP_015903890.1|4991421_4991703_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015906220.1|4991674_4991932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906221.1|4992519_4992822_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_015906222.1|4992923_4993466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049770494.1|4993456_4995262_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_012662387.1|4995503_4996265_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4996033:4996047	attR	AGAAGACCTTGCAGA	NA	NA	NA	NA
WP_012662388.1|4996246_4996417_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4996033:4996047	attR	AGAAGACCTTGCAGA	NA	NA	NA	NA
WP_148214523.1|4996398_4997478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015906224.1|4997802_4998486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906225.1|4998653_4999952_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_015906226.1|4999951_5000272_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015906227.1|5000530_5001496_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015906228.1|5002001_5005268_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_041273434.1|5005264_5007091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906230.1|5007083_5008316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041273435.1|5008614_5009940_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_015906232.1|5010039_5010639_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015906233.1|5010875_5011082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906234.1|5011071_5011338_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	51.9	1.2e-19
WP_148214825.1|5011337_5011685_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_148214691.1|5011776_5012181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906236.1|5012226_5013189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083776496.1|5013670_5014078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015906238.1|5014077_5014365_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	6.2e-22
WP_148214756.1|5014616_5015063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015903809.1|5015224_5016673_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015903810.1|5016665_5017511_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012662743.1|5017919_5019515_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	43.0	3.3e-112
WP_049770496.1|5020199_5020787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015905485.1|5021134_5022655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041273436.1|5022680_5022923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906242.1|5023021_5024872_-	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_015906243.1|5025118_5027104_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_015906244.1|5027115_5029092_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_187149300.1|5029523_5030288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015906246.1|5030359_5030710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041273437.1|5030850_5031132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187149374.1|5031128_5031560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015906248.1|5031739_5032372_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_015906249.1|5032368_5032542_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
5032585:5032599	attR	ACAGGCAAATTATGA	NA	NA	NA	NA
