The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010939	Actinobacillus pleuropneumoniae serovar 7 str. AP76, complete sequence	2331981	464600	471237	2331981		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005616827.1|464600_465695_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.9	3.5e-49
WP_005596391.1|465818_466466_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.7	3.1e-45
WP_005603681.1|466526_467732_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.0	5.0e-97
WP_005596393.1|467842_468304_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.5	7.9e-43
WP_005596395.1|468392_468881_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_005596397.1|468890_469826_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.2	2.7e-37
WP_005596399.1|469953_471237_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	32.9	1.1e-30
>prophage 2
NC_010939	Actinobacillus pleuropneumoniae serovar 7 str. AP76, complete sequence	2331981	498924	576418	2331981	protease,terminase,tail,integrase,portal,transposase,holin	Mannheimia_phage(39.02%)	88	517113:517159	561473:561519
WP_005616851.1|498924_500238_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_005596459.1|500244_501114_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005619022.1|501138_501852_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.9	1.8e-22
WP_005607164.1|502023_502731_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005596465.1|502789_503707_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012262812.1|503709_504447_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005619024.1|504505_504823_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_005596471.1|504944_505703_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005596473.1|505765_506587_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_005614646.1|506669_507707_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011848374.1|507950_509282_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	3.2e-52
WP_005614648.1|509403_509865_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.2	8.4e-45
WP_005600518.1|510021_510525_+	colicin V biosynthesis protein	NA	NA	NA	NA	NA
WP_005614650.1|510538_512056_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.8	1.6e-87
WP_005596484.1|512124_512583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616859.1|512678_514019_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005596488.1|514322_514667_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_005596490.1|514737_515739_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	45.3	3.2e-73
WP_005616862.1|515830_516220_+	RidA family protein	NA	NA	NA	NA	NA
WP_005616864.1|516247_516985_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
517113:517159	attL	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCGGTAGGGGGGACCA	NA	NA	NA	NA
WP_005616866.1|517225_518242_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	35.8	1.5e-57
WP_113667366.1|518145_518448_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005616868.1|518471_519329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616871.1|519378_519606_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_005616872.1|519598_520069_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	S5M9Z4	Pseudoalteromonas_phage	53.9	9.5e-36
WP_012478353.1|520201_520657_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012478354.1|520691_521414_-	hypothetical protein	NA	D0UIN3	Aggregatibacter_phage	34.2	2.5e-27
WP_005616876.1|521415_521658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616877.1|521955_522858_-	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	41.0	1.5e-58
WP_043877953.1|522867_523743_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	75.7	2.9e-22
WP_012478356.1|523792_523993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616881.1|523996_524686_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	67.4	1.5e-82
WP_005616883.1|524669_525626_-	recombinase	NA	A0A0M3LNU3	Mannheimia_phage	78.5	1.9e-131
WP_005616885.1|525629_526109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616887.1|526112_526343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616889.1|526621_526813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005606276.1|527322_527550_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	64.0	1.1e-21
WP_012478357.1|528069_528885_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_012478358.1|528881_529622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005616897.1|529665_530343_-	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	41.6	1.5e-37
WP_012478359.1|530464_530677_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	58.2	1.9e-15
WP_012478360.1|530731_531481_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	60.0	2.8e-37
WP_012478361.1|531477_532248_+	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	97.3	9.4e-57
WP_005606259.1|532247_532904_+	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	73.9	6.7e-80
WP_012478362.1|532900_533458_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	53.2	3.7e-47
WP_012478363.1|533447_533636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478364.1|533619_534576_+	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	64.6	2.7e-109
WP_012478365.1|534572_535022_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	67.1	5.7e-54
WP_012478366.1|535442_535712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478367.1|535698_536277_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	75.5	6.6e-79
WP_012478368.1|536280_536766_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	53.5	1.6e-41
WP_005620835.1|537022_537406_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	40.4	4.1e-13
WP_009875097.1|537392_538025_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.2	7.7e-57
WP_005616915.1|538026_538392_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_012478369.1|538877_539357_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	57.9	1.8e-42
WP_012478370.1|539356_541474_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	66.3	3.5e-271
WP_043877954.1|541470_541695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011848405.1|541694_543215_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	58.0	2.4e-160
WP_043877971.1|543180_545175_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	54.9	7.5e-199
WP_005596673.1|545248_545572_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	41.7	3.3e-11
WP_011848407.1|545564_545867_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005596676.1|545869_546397_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	30.6	1.1e-08
WP_011848408.1|546393_546807_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011848409.1|546806_547463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011848410.1|547521_547914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011848411.1|547937_548213_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_043877972.1|548326_548521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012478372.1|548578_552007_+	tape measure protein	NA	A0A0E3JPV7	Enterobacteria_phage	27.9	5.3e-67
WP_012478373.1|552016_552352_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	30.3	1.5e-06
WP_012478374.1|552351_553083_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	54.5	3.7e-71
WP_043877955.1|553084_553858_+	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	48.4	4.7e-64
WP_043877956.1|553875_554397_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	50.9	7.1e-32
WP_012478376.1|554468_560531_+	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	38.2	5.6e-237
WP_012478377.1|560766_561108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017357778.1|561107_561335_+	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	68.9	1.1e-26
WP_005613725.1|561564_561795_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
561473:561519	attR	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCGGTAGGGGGGACCA	NA	NA	NA	NA
WP_005611645.1|561908_562991_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005620040.1|563114_563510_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005620042.1|563732_564737_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005607179.1|564932_565985_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	23.1	1.0e-05
WP_005600525.1|566101_567151_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005596506.1|567150_567639_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012478378.1|567651_568992_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.3	8.6e-82
WP_005616958.1|569072_569858_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005596509.1|570036_570834_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005619029.1|570913_571990_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_005611655.1|572281_572971_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_012478345.1|575443_576418_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 3
NC_010939	Actinobacillus pleuropneumoniae serovar 7 str. AP76, complete sequence	2331981	859166	912675	2331981	protease,terminase,tail,integrase,portal,tRNA,capsid,head	uncultured_Caudovirales_phage(27.78%)	54	885364:885383	906098:906117
WP_005600941.1|859166_860315_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	3.1e-88
WP_012478420.1|860637_861210_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_005597111.1|861317_861524_+	cold shock domain-containing protein CspD	NA	A0A1X9IGI9	Lactococcus_phage	56.2	1.0e-13
WP_005597113.1|861641_862358_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_005617214.1|862674_864399_+	acetolactate synthase 3 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	27.8	6.8e-47
WP_005597116.1|864391_864883_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_005617216.1|865152_866502_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005607621.1|866609_867140_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_005617220.1|867613_868186_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_005604249.1|868188_868902_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005600963.1|868948_869398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005617222.1|869470_869782_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_005597131.1|869861_870554_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012478422.1|870578_871775_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005617226.1|871774_872065_-	LapA family protein	NA	NA	NA	NA	NA
WP_005597138.1|872133_872415_-	integration host factor subunit beta	NA	A4JWM7	Burkholderia_virus	43.3	1.2e-09
WP_017357667.1|872488_874153_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005607632.1|874249_874924_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005597146.1|876231_876558_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005617231.1|876689_878606_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	4.2e-37
WP_012478425.1|878788_880231_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012478426.1|880280_881111_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_005607638.1|881205_882288_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.3	1.6e-89
WP_012478427.1|882309_885618_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
885364:885383	attL	TTTTTGCAACTGTTTTTCTA	NA	NA	NA	NA
WP_005617238.1|885635_888980_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_005617240.1|888960_890391_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_005597175.1|890408_890969_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_005617242.1|891092_891878_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005607644.1|891885_892611_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.6	2.1e-21
WP_005597178.1|892814_893603_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005617244.1|893797_894076_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_005607647.1|894050_894329_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	2.3e-05
WP_005617246.1|894460_896437_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.8	5.1e-30
WP_005597186.1|896511_896883_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005617247.1|896879_897566_+	LrgB family protein	NA	NA	NA	NA	NA
WP_011848461.1|897590_898403_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	36.6	7.0e-10
WP_012478428.1|898744_899965_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	37.4	3.2e-75
WP_005617251.1|900135_901938_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	37.7	7.1e-79
WP_012478429.1|901924_902350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005607662.1|902342_902717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005607665.1|902709_903486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005617257.1|903970_904330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478431.1|904340_904544_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005617263.1|904692_905334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017357665.1|905429_905630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005617264.1|905701_906169_-	hypothetical protein	NA	NA	NA	NA	NA
906098:906117	attR	TTTTTGCAACTGTTTTTCTA	NA	NA	NA	NA
WP_005617267.1|906416_908087_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.4	2.2e-244
WP_005617270.1|908083_908443_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	67.8	2.9e-40
WP_012478432.1|908612_908969_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_005620819.1|908977_909286_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2D1GNK0	Pseudomonas_phage	34.0	8.5e-09
WP_017357664.1|909275_909623_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_012478433.1|909606_910839_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	58.5	2.6e-133
WP_005617277.1|910840_911413_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	55.3	3.1e-49
WP_005617280.1|911487_912675_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	66.4	2.0e-138
>prophage 4
NC_010939	Actinobacillus pleuropneumoniae serovar 7 str. AP76, complete sequence	2331981	1318433	1328619	2331981	transposase	uncultured_Caudovirales_phage(14.29%)	10	NA	NA
WP_005601574.1|1318433_1319066_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	48.5	1.2e-09
WP_005617598.1|1319125_1319806_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005597990.1|1319891_1320623_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.0	3.6e-42
WP_011848533.1|1320737_1321775_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.9	6.8e-18
WP_012478345.1|1321806_1322781_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_005617603.1|1322927_1324103_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2P1ELP3	Moumouvirus	31.6	2.0e-13
WP_005597992.1|1324309_1325620_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.4	1.2e-131
WP_005617605.1|1325698_1326328_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005617606.1|1326341_1326752_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_005617607.1|1326810_1328619_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.7	2.7e-86
