The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011138	Alteromonas mediterranea DE, complete sequence	4480937	646025	673058	4480937	transposase,integrase	Acinetobacter_phage(50.0%)	34	656690:656704	683049:683063
WP_012517123.1|646025_647072_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012517124.1|647506_647767_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_012517125.1|647771_648029_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_012517126.1|648231_648483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517127.1|648613_648856_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_012517128.1|648852_649155_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012517129.1|649522_649786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517130.1|650070_650550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148291036.1|650663_651191_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_012517123.1|651949_652996_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041912814.1|653887_654196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517136.1|654931_655969_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023559504.1|656230_656830_-	hypothetical protein	NA	NA	NA	NA	NA
656690:656704	attL	TAAAAATAAAACGAT	NA	NA	NA	NA
WP_012517138.1|656991_657180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517139.1|657324_657687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517140.1|657805_658255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517142.1|658839_659547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517143.1|659664_660213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517144.1|660327_661113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517145.1|661262_661631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517146.1|661736_662150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020744876.1|662781_663120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517148.1|663227_663683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085929700.1|664259_665427_+|transposase	IS3-like element ISAma1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.6	2.6e-58
WP_167539666.1|665943_666174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041912815.1|666290_666713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148291021.1|666830_667130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517155.1|667306_667645_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012517136.1|667826_668864_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012517158.1|669904_670405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517159.1|670444_670729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020744878.1|670866_671232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517161.1|671350_671797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012517162.1|672089_673058_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	41.4	1.7e-55
683049:683063	attR	ATCGTTTTATTTTTA	NA	NA	NA	NA
>prophage 2
NC_011138	Alteromonas mediterranea DE, complete sequence	4480937	1016883	1025588	4480937		Streptococcus_phage(16.67%)	6	NA	NA
WP_012517443.1|1016883_1018176_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	4.2e-134
WP_012517444.1|1018235_1019867_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	3.2e-147
WP_012517445.1|1020003_1022595_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	6.4e-33
WP_012517446.1|1022755_1023295_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	45.2	1.0e-25
WP_012517447.1|1023415_1024462_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.8	2.5e-116
WP_012517448.1|1024766_1025588_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-26
>prophage 3
NC_011138	Alteromonas mediterranea DE, complete sequence	4480937	1117000	1176271	4480937	transposase,tRNA,integrase	Leptospira_phage(25.0%)	56	1124136:1124159	1130500:1130523
WP_023559543.1|1117000_1118578_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	30.5	2.8e-39
WP_023559544.1|1118549_1118945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023559545.1|1118965_1120201_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_041912837.1|1120677_1121298_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_007106067.1|1121515_1121869_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_080663258.1|1121885_1122209_+	cation transporter	NA	NA	NA	NA	NA
WP_007106065.1|1122573_1122921_+	mercury transporter	NA	NA	NA	NA	NA
WP_007106064.1|1123020_1123422_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_012517601.1|1123718_1124105_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
1124136:1124159	attL	CTTGACTCCGTACATTGGTACGGC	NA	NA	NA	NA
WP_012517603.1|1127676_1128726_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_012517604.1|1128931_1129942_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012517605.1|1130077_1130473_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023559547.1|1130621_1132025_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.4	7.0e-42
1130500:1130523	attR	CTTGACTCCGTACATTGGTACGGC	NA	NA	NA	NA
WP_023559548.1|1132038_1132674_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_137093190.1|1132681_1133086_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008295681.1|1133163_1133394_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_012517609.1|1133489_1133942_+	DoxX family protein	NA	NA	NA	NA	NA
WP_008295684.1|1134250_1134646_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_008295685.1|1134734_1136036_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_012517611.1|1136047_1136851_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_012517612.1|1136942_1139915_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.3	1.5e-78
WP_012517615.1|1140773_1142141_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012517616.1|1142141_1142738_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080653170.1|1142712_1143096_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012517619.1|1143368_1144553_-	flagellar assembly protein T N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012517620.1|1144851_1145337_+	LPP20 family lipoprotein	NA	NA	NA	NA	NA
WP_012517621.1|1145383_1145815_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_012517622.1|1145845_1146175_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_015066430.1|1146277_1146994_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_015066431.1|1147265_1148195_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	7.0e-30
WP_012517625.1|1148210_1149041_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_012517626.1|1149237_1149672_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_012517627.1|1149674_1150097_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_012517628.1|1150128_1150815_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_012517629.1|1150829_1152215_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_012517630.1|1152439_1153183_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_012517631.1|1153229_1154018_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_012517632.1|1154029_1154710_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_012517633.1|1154730_1155843_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_012517634.1|1155903_1156854_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	D6PHK9	uncultured_phage	26.9	5.5e-06
WP_012517635.1|1156870_1158913_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_012517636.1|1158920_1160135_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_012517637.1|1160664_1161624_+	flagellin	NA	NA	NA	NA	NA
WP_012517639.1|1162111_1163071_+	flagellin	NA	NA	NA	NA	NA
WP_012517640.1|1163144_1163660_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_012517641.1|1163688_1165104_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_023559551.1|1165140_1165569_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_012517643.1|1165561_1165858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012517644.1|1165869_1167972_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_041912755.1|1168259_1168937_+	PIG-L family deacetylase	NA	A0A1L6BYV0	Mycobacterium_phage	28.3	4.3e-05
WP_012517646.1|1168933_1169602_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_012517649.1|1170257_1171301_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_012517650.1|1171519_1172563_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012516695.1|1173031_1174666_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_012517651.1|1174962_1175154_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.8	6.0e-05
WP_088123849.1|1175202_1176271_+|transposase	IS3-like element ISAma2 family transposase	transposase	S5WIU1	Leptospira_phage	37.3	3.5e-41
>prophage 4
NC_011138	Alteromonas mediterranea DE, complete sequence	4480937	2173388	2244236	4480937	tRNA,integrase,transposase,protease	Vibrio_phage(13.33%)	58	2181675:2181690	2216279:2216294
WP_012518380.1|2173388_2175056_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	71.7	3.5e-242
WP_012518381.1|2175181_2175928_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_023559704.1|2176278_2178876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012518383.1|2179128_2181654_+	acylase	NA	NA	NA	NA	NA
2181675:2181690	attL	GCAATGAAAACAGCGA	NA	NA	NA	NA
WP_012518384.1|2181772_2182795_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.6	7.7e-22
WP_012518385.1|2182906_2183530_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012518386.1|2183629_2183944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174377458.1|2184196_2184952_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012518388.1|2184967_2185711_+	methyltransferase	NA	NA	NA	NA	NA
WP_012518389.1|2185707_2186733_-	2-hydroxyacid dehydrogenase	NA	M1H214	Paramecium_bursaria_Chlorella_virus	41.0	1.9e-60
WP_167539667.1|2186788_2187286_-	redoxin domain-containing protein	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	31.2	4.6e-12
WP_012518391.1|2187367_2188243_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071960415.1|2188338_2189922_-	response regulator	NA	NA	NA	NA	NA
WP_012518393.1|2190179_2191334_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012518394.1|2191418_2192549_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012518396.1|2192743_2193616_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012518398.1|2194308_2195835_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_012518399.1|2195843_2196062_-	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_012518400.1|2196221_2197328_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	33.2	2.1e-49
WP_012518401.1|2197443_2198319_+	6-carboxytetrahydropterin synthase	NA	A0A140B3G6	Vibrio_phage	28.8	1.3e-17
WP_012518402.1|2198360_2199278_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.1	5.5e-11
WP_012518403.1|2199358_2201161_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_012518404.1|2201353_2202037_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_012518405.1|2202109_2202571_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_012518406.1|2202720_2203794_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.8	4.1e-26
WP_012518407.1|2203795_2204623_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	23.4	1.7e-11
WP_041703295.1|2204697_2205708_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_012518409.1|2205909_2206752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012518410.1|2207186_2207642_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_012518412.1|2208138_2209242_-|transposase	ISAs1-like element ISAma3 family transposase	transposase	NA	NA	NA	NA
WP_012518414.1|2209958_2210966_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012518415.1|2210988_2211996_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012518416.1|2212070_2212829_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.7	1.0e-07
WP_041912891.1|2212984_2213878_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012518418.1|2213969_2214431_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012518419.1|2214939_2215353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023559708.1|2215524_2216316_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
2216279:2216294	attR	GCAATGAAAACAGCGA	NA	NA	NA	NA
WP_012518421.1|2216703_2218215_+|transposase	ISNCY family transposase	transposase	A0A0M3LR35	Mannheimia_phage	40.5	1.7e-17
WP_012518422.1|2218302_2218689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012518423.1|2219002_2219800_-	TIGR03915 family putative DNA repair protein	NA	NA	NA	NA	NA
WP_012518424.1|2219816_2221058_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_012518425.1|2221378_2223019_-	response regulator	NA	NA	NA	NA	NA
WP_012518426.1|2223140_2223695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012518427.1|2223861_2224857_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_012518428.1|2224915_2225158_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_012518429.1|2225399_2226725_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	2.8e-40
WP_012518430.1|2226934_2227588_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_012518431.1|2227587_2228295_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_023559709.1|2228417_2229302_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015067249.1|2229372_2230131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012518434.1|2230226_2230931_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012518435.1|2231140_2232115_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_012518437.1|2233803_2234376_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_023559710.1|2234424_2235885_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	41.5	5.6e-42
WP_012518439.1|2236172_2237702_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_012518441.1|2237926_2239216_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	50.0	4.7e-08
WP_012518442.1|2239260_2243226_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_012518443.1|2243474_2244236_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.5	1.1e-12
>prophage 5
NC_011138	Alteromonas mediterranea DE, complete sequence	4480937	4435543	4446586	4480937		Organic_Lake_phycodnavirus(16.67%)	7	NA	NA
WP_012518686.1|4435543_4438801_-	DEAD/DEAH box helicase	NA	F2Y0S4	Organic_Lake_phycodnavirus	22.5	2.8e-09
WP_041702929.1|4438797_4439595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012518684.1|4439613_4441755_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	27.3	5.9e-24
WP_012518683.1|4441775_4444166_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	26.1	1.7e-24
WP_001083515.1|4444167_4444365_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	56.5	1.2e-16
WP_012518682.1|4444614_4446357_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.2	9.3e-60
WP_007146785.1|4446343_4446586_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	1.5e-08
